Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (79)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tassabehji, M.
Right arrow Articles by Read, A. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tassabehji, M.
Right arrow Articles by Read, A. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1029-1036

Elastin: genomic structure and point mutations in patients with supravalvular aortic stenosis
Introduction
Results
   Structure of the elastin gene
   Alu and microsatellite repeats
   Mutations in SVAS patients
Discussion
Materials And Methods
   Exon-intron structure of ELN
   Elastin FISH and microsatellite analysis
   Mutation detection and sequencing
   Confirmation of mutations
Acknowledgements
References

Elastin: genomic structure and point mutations in patients with supravalvular aortic stenosis

Elastin: genomic structure and point mutations in patients with supravalvular aortic stenosis Mayada Tassabehji*, Kay Metcalfe, Dian Donnai, Jane Hurst1, William Reardon2, Michael Burch3 and Andrew P. Read

Department of Medical Genetics, St Mary's Hospital, Manchester M13 OJH, UK, 1Department of Clinical Genetics, Churchill Hospital, Oxford OX3 7LJ, UK, 2Institute of Child Health, London WC1N 1EH, UK and 3Department of Paediatric Cardiology, John Radcliffe Hospital, Oxford OX3 9DU, UK

Received February 24, 1997; Revised and Accepted April 23, 1997

We describe the complete exon-intron structure of the human elastin (ELN) gene located at chromosome 7q11.23. There are 34 exons occupying ~47 kb of genomic DNA. All exons are in-frame, allowing exon skipping without disrupting the reading frame. Microsatellites are located in introns 17 and 18. Deletions of all or large parts of the ELN gene have been previously reported in two patients with supravalvular aortic stenosis (SVAS), and SVAS is also a frequent feature of Williams syndrome, where patients are hemizygous for ELN. We list primer pairs for amplifying each exon, with flanking intron, from genomic DNA to allow detection of point mutations in the ELN gene. We show that some patients with isolated SVAS have point mutations that are predicted to lead to premature chain termination. Knowledge of the genomic structure will allow more extensive mutation screening in genomic DNA of patients with SVAS and other conditions.

INTRODUCTION

The protein elastin is responsible for the characteristic elastic properties of many tissues including skin, lung and large blood vessels. The elasticity of these tissues depends on elastic fibres in the extracellular matrix. These are composed of an amorphous and a microfibrillar component, and the amorphous component (~90% of the mature elastic fibre) is composed of elastin. The human elastin cDNA has been isolated and sequenced (1 ). Early reports that ELN mapped to chromosome 2 proved mistaken; it maps to 7q11.2 (2 ) and has 34 exons. Comparative studies showed that the human cDNA lacks sequences corresponding to exons 34 and 35 of the bovine elastin gene, so that human exon 34 is homologous to bovine exon 36 (1 ).

The initial product of the ELN gene is tropoelastin, a 72 kDa polypeptide with a characteristic primary structure of alternating hydrophobic and cross-linking domains. The hydrophobic domains are thought to form a floppy structure of stacked [beta]-sheets with [beta]-turns that is responsible for the resilience of the protein. After secretion, individual tropoelastin chains are covalently cross-linked to form a highly insoluble network of elastic fibres. Cross-linking requires oxidation of lysyl residues by the copper-dependent enzyme lysyl oxidase (3 -5 ). Alanine(A)- lysine(K) rich motifs (A3-10KA2-3K) occur in the cross-linking domains in exons 15, 17, 19, 21, 23, 27, 29 and 31, and in modified form in exons 6 and 25.

Since elastin is a major component of the aorta and large arteries, disruption of the elastin gene might be expected to cause vascular problems. One candidate condition is supravalvular aortic stenosis (SVAS) (6 ). SVAS is a congenital narrowing of the ascending aorta. The condition is frequently progressive and may lead to heart failure and early death, so that patients often need corrective surgery in early infancy. SVAS may occur sporadically or as a familial condition with autosomal dominant inheritance (7 ). Linkage analysis mapped familial SVAS to chromosome 7q (8 ) and a family in which a translocation t(6:7)(p21.1;q11.23) co-segregated with SVAS showed disruption of the elastin gene at 7q11.23 (9 ,10 ). Subsequently large intragenic deletions involving the elastin gene have been reported in two unrelated SVAS patients (11 ,12 ). SVAS also occurs as part of Williams syndrome (WS). WS (MIM 194050) is a contiguous gene syndrome caused by a microdeletion at 7q11.23 (13 ). WS patients are hemizygous for the elastin gene. Affected individuals are mentally retarded but with an unusual cognitive profile (they speak fluently but have poor visuospatial skills). They have dysmorphic facies, frequently heart abnormalities (mainly SVAS), short stature, hyperacusis, and often infantile hypercalcaemia. Other connective tissue phenotypes associated with WS include hernias, hoarse voice, joint abnormalities, and premature ageing of skin.


Figure 1. ELASTIN cDNA sequence showing exon-intron boundaries. (H) hydrophobic domain; (X) cross-linking domain; *subject to alternative splicing; + (C-terminus): conserved cysteines and four terminal basic residues.

SVAS is very variable, both in familial dominant SVAS and amongst patients with Williams syndrome. Nickerson et al. (14 ) report that the elastin deletion is seen in ~90% of Williams syndrome patients, and in our experience, all patients with a classic WS phenotype are hemizygous at the elastin locus (unpublished data). Nevertheless, only 5% have severe clinical SVAS. It is unclear to what extent the facial and other features of WS can be attributed to haploinsufficiency for elastin, rather than to deletion or silencing of other genes flanking the elastin locus. It is also unknown what proportion of SVAS patients have abnormalities at the ELN locus, what types of ELN mutations can cause SVAS, and whether other categories of ELN mutation might cause different connective tissue problems. To address these issues and allow screening of genomic DNA for mutations, we have determined the complete genomic structure of the human ELN gene. Until now, only partial exon-intron structures have been available in the literature (1 ) or in databases. In this study we have defined the unpublished exon-intron boundaries of the elastin gene and have carried out mutation screening in patients with dominant SVAS. We show that point mutations in the elastin gene can cause SVAS.

RESULTS

Structure of the elastin gene

We isolated a 125 kb bacterial artificial chromosome (BAC) containing the complete ELN coding sequence from a commercial library (Genosys), by screening with primers designed from the 5' and 3' ends of the published elastin cDNA sequence (1 ). We used fluorescent in situ hybridisation (FISH) to confirm that the BAC mapped to 7q11.23 (data not shown). To define the unpublished exon-intron boundaries of the ELN gene, PCR primers were designed randomly using the last published exon boundary from the 3' end of the human cDNA sequence (1 ) as a starting point, and PCR products from genomic DNA were sized and sequenced. In cases where no amplification was obtained between a set of primers, the vectorette method was used to define exon boundaries, as described by Riley et al. (15 ). Primers designed from the intronic sequence were used to amplify each exon from genomic DNA, and in each case gave a product of the expected size. Our method of analysis leaves open the possibility that some transcripts might contain additional exons not present in the published cDNA sequence we relied on, such as the bovine exon 34 and 35 sequences that are missing from the published human sequence.

Figure 1 shows the complete ELN cDNA sequence with exon-intron boundaries marked, and Table 1 summarises the splice junctions and surrounding sequence in the elastin gene. The coding sequence we have determined agrees with that published by Indik et al. (1 ). It comprises 2361 bp (including the termination codon) split into 34 small exons ranging in size from 30 to 225 bp and extending over ~47 kb of genomic sequence. The introns range from 82 bp to ~10 kb, and all the exon-intron boundaries conform to the published consensus sequences (16 ). Twenty-seven out of the 33 codons split by introns encode glycine residues (Table 1 ).

Table 1 . Structure of the elastin gene X = cross-linking domain. *Subject to alternative splicing.C = C-terminal exon containing conserved cysteines and four basic residues; corresponds to exon 36 of bovine elastin.The polymorphic microsatellite in intron 18 is indicated as (gt)n. It has 17-20 repeats. A second microsatellite, (AG)n, is present in intron 17 ~230 bp upstream of the 3' end.

Alu and microsatellite repeats

As previously reported (17 ), the 3' region of the gene is rich in Alu sequences. A BLAST search of our sequence showed that introns 18, 19, 22, 27, 30, 32 and 33 gave high homology with Alu-like sequences, especially Alu J and Alu Sx. Introns 30 (~50% Alu), 32 (~40% Alu) and 33 (~33% Alu) were particularly rich in Alu-like sequences.

Intron sequencing detected two microsatellite repeats. An (AG)n repeat was located ~230 bp upstream of the 5' acceptor splice site of exon 18. At 10 bp downstream from the 3' donor splice site of exon 18 is a (GT)17-20 repeat. This latter repeat has been reported previously (2 ; because of ambiguity in numbering of exons, it was said to be in intron 17), and is polymorphic with heterozygosity 0.626.

Mutations in SVAS patients

Patients with diagnosed SVAS were analysed for mutations in the elastin gene. Intronic primers were designed to amplify each of the 34 exons from genomic DNA (Table 2 ). Mutations were sought by combined single-strand conformation polymorphism (SSCP) and heteroduplex analysis (18 ). Where bands of abnormal mobility were seen, the relevant exon was sequenced.

Table 2 . Primer sequences for the amplification of exons 1-34 of the human elastin gene

Patient SVAS12presented at birth with a heart murmur. Cardiac catheterisation was thought to show obstruction, and an initial diagnosis of hypertrophic obstructive cardiomyopathy was made. The patient was seen at another centre at the age of 3 years for assessment of his heart murmur. Echocardiography suggested SVAS on the basis of waisting of the ascending aorta and post-stenotic dilatation. Subsequent cardiac catheterisation revealed a significant pressure gradient (106 mm Hg) between his left ventricle and aorta. At surgery he was found to have severe SVAS, a thickened aortic valve, stenosis at the origin of the right pulmonary artery, subvalvular infundibular pulmonary stenosis and severe left ventricular hypertrophy. He did not have the facial features of WS, and his psychomotor development was normal. Of significance in the family history, his brother died suddenly in the first year of life and at autopsy was noted to have repaired SVAS, repaired central pulmonary artery stenosis and marked ventricular hypertrophy. The aortic valve and proximal aorta were markedly dysplastic with extreme thickening beyond the valve. The proband's mother had presented to cardiologists in childhood with a murmur and a clinical diagnosis of aortic stenosis was made.

SVAS12 showed no evidence of a large deletion: elastin FISH (WSCR probe, Oncor) was normal. Amplified DNA gave an abnormal band in exon 26 on heteroduplex analysis, which was not present in 40 non-SVAS controls (Fig. 2 ). Sequencing revealed insertion of a T base in codon 606 of exon 26, producing a frameshift predicted to cause premature termination 10 codons downstream:


Figure 2. Mutation analysis of patient SVAS12. (A) Heteroduplex analysis of exon 26 PCR product, showing a shift in lane 5. (B) Double strand sequence analysis shows the proband (bottom) and his mother (top) are heterozygous for a T insertion, resulting in a frameshift. The father (middle) has two normal alleles. (C) Confirmation of the mutation by ARMS PCR analysis. The allele-specific ARMS primer allows selective amplification of the mutant allele only in the proband and his mother, giving a 210 bp product. An internal control giving a 450 bp band was included to ensure that amplification had taken place in each sample. Lane 1: father; lane 2: proband; lane 3: mother; lane 4: control.

Normal allele:
603GGTGCTGGTGTTCCTGGCTTCGGGGCAGGTGCAGATGAG
 GAGVPGFGAGADE
Mutant allele:
603GGTGCTGGTTGTTCCTGGCTTCGGGGCAGGTGCAGATGA
 GAGCSWLRGRCRStop

The mutation was confirmed by designing an allele-specific ARMS primer to allow selective amplification of the mutant allele (19 ). ARMS amplification and sequencing showed that the proband's mother also has the mutation (Fig. 2 ).

Patient SVAS50presented at the age of 8 weeks with a heart murmur and episodes of cyanosis. Echocardiography at 4 months of age showed SVAS and pulmonary arterial stenosis. This was progressive and cardiac catheterisation at 18 months showed a left ventricular pressure of 142 mm Hg with a pull back gradient of 66 mm Hg from left ventricle to aorta at the supravalvular level. There was no gradient at the level of the aortic valve. The right ventricular systolic pressure and branch pulmonary artery pressures were 76 and 15 mm Hg respectively although the catheter wedged very quickly in the branch pulmonary arteries because of the very small size of the branch vessels. Angiography showed the supravalvular aortic narrowing and the very abnormal pulmonary arteries. Corrective open heart surgery was performed at the age of 21 months and at this time it was noted that the aorta and pulmonary arteries were very thick and abnormal. His developmental progress is normal to date and he has no features of Williams syndrome. His mother had cardiac follow up for a heart murmur until the age of 6 years, but a recent echocardiogram showed no evidence of supravalvular aortic stenosis and no pulmonary artery stenosis.

Patient SVAS50 showed no evidence of a large deletion: elastin FISH (WSCR probe, Oncor) was normal. Heteroduplex-SSCP analysis showed a heteroduplex shift in exon 21 which was not present in 43 normal controls. Sequence analysis revealed a single base substitution (CAG -> TAG) in codon 442 which changed a glutamine to a stop codon (Q442X). This mutation creates a HindIII site, allowing us to confirm the mutation by restriction digest analysis:

Normal allele: Mutant allele (HindIII site underlined):
440GAAGCTCAGGCAGCA 440GAAGCTTAGGCAGCA
 EAQAA EAStop

The PCR product from the normal allele is not digested (275 bp), whereas the mutant allele gives two restriction fragments of 150 bp and 125 bp (Fig. 3 ). Restriction digest analysis and sequencing showed that the Q442X mutation was also present in the mother's DNA (Fig. 3 ).


Figure 3. Mutation analysis of patient SVAS50. (A) Heteroduplex analysis of exon 1 showing a shift in lane 3. Lanes 1, 2, 4: controls; lane 3: patient SVAS50. (B) Double strand sequence analysis shows a C-T base substitution (N = C or T) in one allele of the proband (bottom) and his mother (top). The father (middle) has two normal alleles. (C) Confirmation of the mutation by HindIII digestion. The C-T base substitution creates a HindIII site that cleaves the 275 bp product into fragments of 150 and 125 bp that are present only in the proband and his mother. Lane 1: mother; lane 2: proband; lane 3: father; lanes 4, 5: controls.

DISCUSSION

Elastin is an important structural component of the aorta and pulmonary arteries. The walls of these large elastic vessels are primarily composed of alternating layers of smooth muscle and elastic fibres. Two theories explaining the molecular pathology of SVAS can be proposed: the defects in elastin could be qualitative or quantitative. Evidence favouring a quantitative mechanism rather than production of abnormal elastin, as the pathogenic mechanism in SVAS includes the fact that Williams syndrome (WS) patients are hemizygous for elastin because of a chromosomal microdeletion, and these patients are at high risk of SVAS. Also elastin mutations reported so far in patients with isolated SVAS have been disruptions or large deletions. Curran et al. (9 ) reported a family segregating a balanced translocation t(6:7)(p21.1;q11.23) with a breakpoint in intron 27 of the ELN gene. Ewart et al. (11 ) described a 100 kb deletion in an SVAS patient, which deleted all 3' ELN sequences from exon 28. Olson et al. (12 ) reported a patient with severe SVAS who had a 30 kb intragenic deletion that removed exons 2-27 of the elastin gene whilst maintaining the 3' terminus intact. Our two SVAS patients have point mutations that are predicted to truncate the transcript in exon 21 or exon 26. ELN transcripts lacking the 3' terminus may be unstable or poorly translated. High sequence homology (80%) in the 3' untranslated region in different species suggests that it has an important conserved function and may play a role in stabilising the mature mRNA or in modulating translation (20 ). Finally, variable expressivity and reduced penetrance of SVAS is seen both in Williams syndrome and familial isolated SVAS. SVAS varies from subtle cardiac abnormalities to severe stenosis of multiple arteries, although there is no evidence of locus heterogeneity. In our two SVAS families with point mutations, each mutation manifests as severe SVAS in the proband,but as mild cardiac features or non-penetrance in the mothers. Such variability is typical of phenotypes produced by haploinsufficiency, where genetic background is expected to have a major modifying effect.

The alternative hypothesis is that a dominant negative elastin mutation could result in SVAS. Research into the assembly of elastic fibres suggests that the C-terminus of tropoelastin mediates elastin polymerisation through interaction with microfibril-associated glycoproteins (MAGP) (21 ). If the mutant elastin genes described above are expressed, truncated proteins would probably be produced that would lack several important features. These include consensus sites for desmosine cross-linking, exon 36 (which contains important functional domains), and also the two highly conserved cysteine residues in exon 34 thought to be important for interaction with fibrillin in arrays of microfibrils, as well as a MAGP binding domain. Truncated proteins in which some but not all domains critical for intermolecular interaction are absent may disrupt post-translational processing and consequently, the development of elastic fibres.

It is possible that SVAS arises as a result of both mechanisms, depending on the particular mutation involved. Haploinsufficiency of elastin, where a half dose of normal elastin is being produced, or abnormal elastic fibres arising from dominant negative elastin mutations, could both manifest as SVAS. It is intriguing that WS patients show a wider range of connective tissue phenotypes than SVAS patients-whether this is caused by deletion or silencing of other adjacent genes remains to be seen. However, no obvious phenotype-genotype correlation has emerged in SVAS.

Elucidating the molecular pathogenesis of SVAS may also have implications for treatment. Pre-natal diagnosis can be offered to families with autosomal dominant SVAS to allow early diagnosis and treatment. At present vascular surgery is the only treatment for SVAS; however, it has been suggested that early intervention with drug treatment to lower the heart rate and blood pressure may slow progression of the disease (9 ). The use of elastase inhibitors in preventing pulmonary hypertension and associated pulmonary arterial abnormalities is also being investigated (23 ).

Defining the elastin gene structure has allowed us to identify the first point mutations that cause SVAS and will enable us to carry out mutation screening on a larger scale. Continued mutation analysis in SVAS and WS patients may help distinguish the vascular pathology of these conditions, and will allow other conditions to be investigated for involvement of elastin mutations.

MATERIALS AND METHODS

Exon-intron structure of ELN

A 125 kb BAC clone containing the elastin gene was isolated from a BAC library (Genosys) by PCR screening with primers P1-P2 and P3-P4, designed from the ELN cDNA sequence:

PrimerP1:5'CCGGGATAAAACGAGGTGCGGGAG
PrimerP2:5'TCCAGGCCGAGAGGGGTGGAGGAT
PrimerP3:5'AGCCGAAACTGAGAGGGGCCGGAC
PrimerP4:5'TCATTTTCTCTTCCGGCCACAAGC

FISH analysis showed that the BAC hybridised to 7q11.2 and that it was not chimaeric. Vectorette libraries were constructed from EcoRI, EcoRV, RsaI and PvuII-digested BAC DNA and subjected to PCR amplification using a vectorette specific primer and one cDNA primer as described by Riley et al. (15 ). Column-purified PCR products were sequenced by direct double-strand fluorescent cycle sequencing using an ABI 373 sequencer. Intron PCR was carried out using the BCL XL Expand system according to the manufacturer's instructions.

Elastin FISH and microsatellite analysis

Elastin FISH was carried out using the Oncor WSCR probe according to manufacturer's instructions. Intron 18 microsatellite analysis was carried out by PCR amplification of genomic DNA using the following primers:
ELNintron18F:5'ATGAGACGTGGTCAAGGGTAT
ELNintron18R:5'GGGATCCCAGGTGCTGCGGTT

All amplifications were carried out using 100 ng of genomic DNA and 10 pmol of each primer in 20 [mu]l reaction volumes. Cycle conditions were: 95oC for 2 min, then 27 cycles of: 94oC for 1 min, 60oC for 1 min and 72oC for 1 min, with a final extension step of 5 min at 72oC. PCR products were electrophoresed on 8% polyacrylamide gels (acrylamide:N,N' bis-acrylamide 19:1) for 3 h at 300 V then visualised by silver staining.

Mutation detection and sequencing

Exons 21 and 26 of the ELN gene were PCR amplified using the primers listed below and amplification conditions as described above. Mutations were detected by a combination of SSCP and heteroduplex analysis (18 ). Briefly, PCR products were run on 1 mm thick non-denaturing 8% polyacrylamide gels (acrylamide:N,N' bisacrylamide 49:1) at 4oC overnight at a constant 350 V. Products were detected by silver staining. Mutations were initially characterised by direct double-strand cycle sequencing of column-purified PCR products in both orientations with a matched control on a fluorescent sequencer (ABI 373).
ELNX21F:5'GAGGTCGTATCCATGCCTTACAG
ELNX21R:5'TCCAGGCCATTTCAGTCCTGGAG
ELNX26F:5'GGCATGCTCCCTGCCTGCTGTCG
ELNX26R:5'CCCAGATGCTTAGGAGAACCTAA

Confirmation of mutations

For confirmation of the exon 21 mutation, HindIII digestion of PCR products was carried out according to manufacturer's instructions (Gibco-BRL). The restriction fragments were separated on a 2% agarose gel and visualised by ethidium bromide staining. For confirmation of the exon 26 mutation, ARMS PCR (19 ) was carried out using the ELN X26R primer and a primer designed to amplify the mutant allele only:
ELNX26R:5'CCCAGATGCTTAGGAGAACCTAA
ELNX26FARMSM:5'TGGACTTGGAGTTGGTGCTGATT

No amplification is obtained in the absence of the mutation, so intron 26 of the elastin gene was used as an internal control for amplification, which gave a 450 bp product. PCR was carried out as above. Cycle conditions were: 95oC for 2 min, then 30 cycles of 94oC for 1 min, 55oC for 1 min and 72oC for 1 min, with a final extension step of 5 min at 72oC. The products were separated on a 2% agarose gel.

ACKNOWLEDGEMENTS

We thank Dr Carrie Wilmot for helpful discussions. M.T. was supported by the Wellcome Trust (grant 045998) and K.M by the Birth Defects Foundation.

REFERENCES

1 Indik, Z., Yeh, H., Ornstein-Goldstein, N., Sheppard, P., Anderson, N., Rosenbloom, J.C., Peltonen, L. and Rosenbloom, J. (1987) Alternative splicing of human elastin mRNA indicated by sequence analysis of cloned genomic and complementary DNA. Proc. Natl. Acad. Sci. USA, 84, 5680-5684. MEDLINE Abstract

2 Foster, K., Ferrell, R., King-Underwood, L., Povey, S., Attwood, J., Rennick, R., Humphries, S.E. and Henney, A. M. (1993) Description of a dinucleotide repeat polymorphism in the human elastin gene and its use to confirm assignment of the gene to chromosome 7. Ann. Hum. Genet., 57, 87-96. MEDLINE Abstract

3 Partridge, S.M. (1962) Elastin. Adv. Protein Chem., 17, 227-297.

4 Franzblau, C., Sinex, F.M., Faris, B. and Lampidis, R. (1965) Identification of a new crosslinking aminoacid in elastin. Biochem. Biophys. Res. Comm., 21, 575-81. MEDLINE Abstract

5 Pinnel, S.R. and Martin, G.R. (1968) The crosslinking of collagen and elastin: enzymatic conversion of lysine in peptide linkage to allysin by an extract from bone. Proc. Natl. Acad. Sci. USA, 61, 708-16.

6 Wren, C., Oslizlok, P. and Bull, C. (1990) Natural history of SVAS and pulmonary aortic stenosis. J. Am. Coll. Cardiol., 15, 1625-1630. MEDLINE Abstract

7 Eisenberg, R., Young, D., Jacobson, B. and Boito, A. (1964) Familial supravalvar aortic stenosis. Am. J. Dis. Child., 108, 341-347.

8 Ewart, A.K., Morris, C.A., Ensing, G.J., Loker, J., Moore, C., Leppert, M. and Keating, M.T. (1993) Human vascular disorder, supravalvular aortic stenosis, maps to chromosome 7. Proc. Natl. Acad. Sci. USA, 90, 3226-3230. MEDLINE Abstract

9 Curran, M.E., Atkinson, D.L., Ewart, A.K., Morris, C.A., Leppert, M.F. and Keating, M.T. (1993) The elastin gene is disrupted by a translocation causing supravalvular aortic stenosis. Cell, 73, 159-168. MEDLINE Abstract

10 Morris, C.A., Loker, J., Ensing, G. and Stock, A.D. (1993) Supravalvular aortic stenosis cosegregates with a familial 6;7 translocation which disrupts the elastin gene. Am. J. Med. Genet., 46, 737-744. MEDLINE Abstract

11 Ewart, A.K., Jin, W., Atkinson, D., Morris, C.A. and Keating, M.T. (1994) Supravalvular aortic stenosis associated with a deletion disrupting the elastin gene. J. Clin. Invest., 93, 1071-1077. MEDLINE Abstract

12 Olson, T.M., Michels, V.V., Urban, Z., Csiszar, K., Christiano, A.M., Driscoll, D.J., Feldt, R.H., Boyd, C.D. and Thibodeau, S.N. (1995) A 30kb deletion within the elastin gene results in familial SVAS. Hum. Mol. Genet., 4, 1677-1679. MEDLINE Abstract

13 Ewart, A.K., Morris, C.A., Atkinson, D., Weishan, J., Sternes, K., Spallone, P., Stock, A.D., Leppert, M. and Keating, M.T. (1993) Hemizygosity at the elastin locus in a developmental disorder, Williams syndrome. Nature Genet., 5, 11-15. MEDLINE Abstract

14 Nickerson,E., Greenberg, F., Keating, M.T., McCaskill, C. and Shaffer, L.G. (1995) Deletions of the elastin gene at 7q11.23 occur in ~90% of patients with Williams Syndrome. Am. J .Hum. Genet., 56, 1156-1161.

15 Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J.C. and Markham, A.F. (1990) A novel rapid method for isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res., 18, 2887-2890. MEDLINE Abstract

16 Padgett, R.A., Grabowski, P.J., Konarsks, M.M., Seiler, S. and Sharp, P.A. (1986) Splicing of mRNA precursors. Annu. Rev. Biochem., 55, 1119-1150. MEDLINE Abstract

17 Indik, Z., Yoon, K., Morrow, S.D., Cicila, G., Rosenbloom, J.C., Rosenbloom, J. and Ornstein-Goldstein, N. (1987) Structure of the 3' region of the human elastin gene: great abundance of Alu repetitive sequences and few coding sequences. Connect. Tissue Res., 16, 197-211. MEDLINE Abstract

18 Tassabehji, M., Newton, V.E., Leverton, K., Turnbull, K., Seemanova, E., Kunze, J., Sperling, K., Strachan, T. and Read, A.P. (1994) PAX3 gene structure and mutations: close analogies between Waardenburg syndrome Type 1 and the Splotch mouse. Hum. Mol. Genet., 3, 1069-1074. MEDLINE Abstract

19 Newton, C.R., Graham, A. and Heptinstall, L.E. (1989) Analysis of any point mutation in DNA: the amplification refractory mutation system. Nucleic Acids Res. 17, 2503-2516. MEDLINE Abstract

20 Indik, Z., Yeh, H., Ornstein-Goldstein, N., Kucich, U., Abrams, W., Rosenbloom, J.C. and Rosenbloom, J. (1989) Structure of the elastin gene and alternative splicing of elastin mRNA: implications for human disease. Am. J. Med. Genet., 34, 81-90. MEDLINE Abstract

21 Brownaugsburger, P., Broekelmann, T., Rosenbloom J. and Mecham, R.P. (1996) Functional domains on elastin and microfibril-associated glycoprotein involved in elastic fibre assembly. Biochem. J., 318, 149-155.

22 Dietz, H.C., Valle, D., Francomano, C.A., Kendzior, R.J., Pyeritz, R.E. and Cutting, G.R. (1993) The skipping of constitutive exons in vivo induced by nonsense mutations. Science, 259, 680-3. MEDLINE Abstract

23 Rabinovitch, M. (1996) Alterations in elastin and cardiovascular malformations of Wiliams syndrome. 7th International Professional Conference on Williams syndrome: biology, medicine, behavior. Philadelphia July 1996.

*To whom correspondence should be addressed. Tel. +44 161 276 6608; Fax: +44 161 276 6606; Email: m.tassabehji{at}man.ac.uk

-->
This page is maintained by OUP admin. Last updated Tue Jun 10 19:01:42 BST 1997. Part of the OUP Journals World Wide Web service. Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Am. J. Respir. Cell Mol. Bio.Home page
M. H. Cho, D. M. Ciulla, B. J. Klanderman, C. P. Hersh, A. A. Litonjua, D. Sparrow, B. A. Raby, and E. K. Silverman
Analysis of Exonic Elastin Variants in Severe, Early-Onset Chronic Obstructive Pulmonary Disease
Am. J. Respir. Cell Mol. Biol., June 1, 2009; 40(6): 751 - 755.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Q. Liu, P. K. Alkema, C. Tieche, B. J. Tefft, D. Z. Liu, Y. C. Li, B. E. Sumpio, J. A. Caprini, and M. Paniagua
Negative Regulation of Monocyte Adhesion to Arterial Elastic Laminae by Signal Regulatory Protein {alpha} and Src Homology 2 Domain-containing Protein-Tyrosine Phosphatase-1
J. Biol. Chem., November 25, 2005; 280(47): 39294 - 39301.
[Abstract] [Full Text] [PDF]

Home page
 Arch DermatolHome page
L. Rodriguez-Revenga, P. Iranzo, C. Badenas, S. Puig, A. Carrio, and M. Mila
A Novel Elastin Gene Mutation Resulting in an Autosomal Dominant Form of Cutis Laxa
Arch Dermatol, September 1, 2004; 140(9): 1135 - 1139.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
G. Merla, C. Howald, S. E. Antonarakis, and A. Reymond
The subcellular localization of the ChoRE-binding protein, encoded by the Williams-Beuren syndrome critical region gene 14, is regulated by 14-3-3
Hum. Mol. Genet., July 15, 2004; 13(14): 1505 - 1514.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. A. Kozel, H. Wachi, E. C. Davis, and R. P. Mecham
Domains in Tropoelastin That Mediate Elastin Deposition in Vitro and in Vivo
J. Biol. Chem., May 9, 2003; 278(20): 18491 - 18498.
[Abstract] [Full Text] [PDF]

Home page
 BMJHome page
I. N M Day and D. I Wilson
Science, medicine, and the future: Genetics and cardiovascular risk
BMJ, December 15, 2001; 323(7326): 1409 - 1412.
[Full Text] [PDF]

Home page
 Hum Mol GenetHome page
S. Cairo, G. Merla, F. Urbinati, A. Ballabio, and A. Reymond
WBSCR14, a gene mapping to the Williams-Beuren syndrome deleted region, is a new member of the Mlx transcription factor network
Hum. Mol. Genet., March 1, 2001; 10(6): 617 - 627.
[Abstract] [Full Text] [PDF]

Home page
 HeartHome page
Y Aggoun, D Sidi, B I Levy, S Lyonnet, J Kachaner, and D Bonnet
Mechanical properties of the common carotid artery in Williams syndrome
Heart, September 1, 2000; 84(3): 290 - 293.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
A. Hinek and S. E. Wilson
Impaired Elastogenesis in Hurler Disease : Dermatan Sulfate Accumulation Linked to Deficiency in Elastin-Binding Protein and Elastic Fiber Assembly
Am. J. Pathol., March 1, 2000; 156(3): 925 - 938.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
B. W. Robb, H. Wachi, T. Schaub, R. P. Mecham, and E. C. Davis
Characterization of an In Vitro Model of Elastic Fiber Assembly
Mol. Biol. Cell, November 1, 1999; 10(11): 3595 - 3605.
[Abstract] [Full Text]

Home page
 Hum Mol GenetHome page
U. Francke
Williams-Beuren syndrome:genes and mechanisms
Hum. Mol. Genet., September 1, 1999; 8(10): 1947 - 1954.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M.-C. Zhang, L. He, M. Giro, S. L. Yong, G. E. Tiller, and J. M. Davidson
Cutis Laxa Arising from Frameshift Mutations in Exon 30 of the Elastin Gene (ELN)
J. Biol. Chem., January 8, 1999; 274(2): 981 - 986.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (79)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tassabehji, M.
Right arrow Articles by Read, A. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tassabehji, M.
Right arrow Articles by Read, A. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?