Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (67)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Woodward, E. R.
Right arrow Articles by Maher, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Woodward, E. R.
Right arrow Articles by Maher, E. R.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1051-1056

Genetic predisposition to phaeochromocytoma: analysis of candidate genes GDNF, RET and VHL
Introduction
Results
   Identification of germline VHL gene mutations in familial phaeochromocytoma
   Analysis of GDNF
   Analysis of RET
Discussion
Materials And Methods
   Patients
   Molecular analysis
Acknowledgements
References

Genetic predisposition to phaeochromocytoma: analysis of candidate genes GDNF, RET and VHL

Genetic predisposition to phaeochromocytoma: analysis of candidate genes GDNF , RET and VHL Emma R. Woodward1, Charis Eng2,4, Rob McMahon3, Raimo Voutilainen5, Nabeel A. Affara1, Bruce A. J. Ponder4 and Eamonn R. Maher1,6,*

1Department of Pathology, Tennis Court Road, Cambridge CB2 1QP, UK, 2Division of Cancer Epidemiology and Control and Charles A. Dana Division of Human Cancer Genetics Dana-Farber Cancer Institute, Harvard Medical School, Boston, USA, 3East Anglian Regional Genetics Service, Molecular Genetics Laboratory, Addenbrooke's NHS Trust, Cambridge CB2 2QQ, UK, 4CRC Human Cancer Genetics Research Group, University of Cambridge, Box 238 Addenbrooke's Hospital, Cambridge CB2 2QQ, UK, 5Department of Pathology, University of Helsinki, P.O. Box 21 (Haartmaninkatu 3), FIN-00014 Helsinki, Finland and 6Division of Medical Genetics, Department of Paediatrics and Child Health, University of Birmingham, Birmingham B15 2TG, UK

Received December 31, 1997; Revised and Accepted April 14, 1997

Inherited predisposition to phaeochromocytoma (MIM No 171300) occurs in multiple endocrine neoplasia type 2 (MEN 2) (MIM No 171400), von Hippel-Lindau (VHL) disease (MIM No 199300), and neurofibromatosis type 1 (NF1) (MIM No 162200). In addition, familial phaeochromocytoma alone has also been reported and we and others have identified germline VHL mutations in five of six kindreds analysed previously. Germline mutations in the RET proto-oncogene, which encodes a receptor tyrosine kinase, and in the VHL tumour suppressor gene cause MEN 2 and VHL disease, respectively. To further investigate the genetics of phaeochromocytoma predisposition, we analysed three groups of patients with no evidence of VHL disease, MEN 2 or NF1: Group A, eight kindreds with familial phaeochromocytoma; Group B, two patients with isolated bilateral phaeochromocytoma; and Group C, six cases of multiple extra-adrenal phaeochromocytoma or adrenal phaeochromocytoma with a family history of neuroectodermal tumours. Germline missense VHL mutations were identified in three of eight kindreds with familial phaeochromocytoma. A germline VHL mutation was also characterised in one of the two patients with bilateral phaeochromocytoma. No VHL or RET mutations were detected in the final group of patients with multiple extra-adrenal phaeochromocytoma or adrenal phaeochromocytoma with a family history of neuroectodermal tumours. The absence of germline VHL and RET gene mutations in many of these families suggested that other phaeochromocytoma susceptibility loci may exist. Glial cell line-derived neurotrophic factor (GDNF) has been recently identified as a natural ligand for RET. Thus, it seems plausible that GDNF is a good candidate gene to play a role in phaeochromocytoma susceptibility. We searched for germline mutations in GDNF in 16 cases of familial phaeochromocytoma (groups A, B and C) and looked for evidence of somatic change in GDNF in 28 sporadic phaeochromocytomas, 12 MEN 2 phaeochromocytomas and five VHL phaeochromocytomas. No GDNF mutations were identified in patients with familial phaeochromocytoma disease, but a c277C -> T (R93W) sequence variant was identified in one of 28 sporadic tumours. This candidate mutation was identified in the germline and tumour tissue but was not present in 104 control GDNF alleles. GDNF sequence variants including R93W have been suggested previously to represent low penetrance susceptibility mutations for Hirschsprung disease and the R93W was not identified in 376 control alleles studied by others. These findings suggest that although GDNF mutations do not appear to have a major role in the pathogenesis of familial or sporadic phaeochromocytomas, allelic variation at the GDNF locus may modify phaeochromocytoma susceptibility.

INTRODUCTION

Phaeochromocytoma is a tumour of chromaffin-staining cells which are derived from the embryonic neural crest. Most phaeochromocytomas arise within the adrenal medulla but extra-adrenal phaeochromocytomas (paraganglioma) account for ~10% of cases. It has been estimated that 10% of patients with phaeochromocytoma have a genetic susceptibility (1 ). Predisposition to phaeochromocytoma occurs in three familial cancer syndromes: (i) multiple endocrine neoplasia type 2 (MEN 2) (MIM No 171400) (2 ); (ii) von Hippel-Lindau (VHL) disease (MIM No 199300) (3 ); and (iii) rarely, in neurofibromatosis type 1 (NF1) (MIM No 162200) (4 ). In addition, familial phaeochromocytoma (MIM No 171300) alone has also been reported (5 ). VHL disease is caused by mutations in the VHL tumour suppressor gene and certain germline missense mutations have been associated with a high risk of phaeochromocytoma in addition to other classical features of VHL disease such as retinal and cerebellar haemangioblastomas and renal cell carcinoma (3 ,6 -8 ). The three clinical variants of MEN 2 [MEN 2A, MEN 2B and familial medullary thyroid cancer (FMTC)] are caused by gain of function mutations of the RET proto-oncogene which encodes a receptor tyrosine kinase (9 -16 ). Most cases of MEN 2A and FMTC have amino acid substitutions at one of five cysteine residues in the extracellular domain (exons 10 and 11) (17 ) and MEN 2B patients usually have missense mutations in the methionine of codon 918 in the intracellular tyrosine kinase domain (11 -13 ). Germline RET mutations may also cause Hirschsprung disease (HSCR) (18 -20 ). Recently, glial cell line-derived neurotrophic factor (GDNF) has been shown to be the functional RET ligand (21 -24 ) and GDNF mutations have been implicated in the pathogenesis of HSCR (25 -27 ). Therefore point mutations in GDNF which alter GDNF function in terms of RET binding capacity could be involved in the genesis of MEN 2 related tumours.

Recently, we and others have demonstrated that a proportion of familial phaeochromocytoma is allelic with VHL disease. To date, five of six kindreds with a diagnosis of familial phaeochromocytoma only have been shown to have missense VHL gene mutations (28 -30 ). In contrast, somatic RET and VHL gene mutations are infrequent in sporadic phaeochromocytomas (31 -32 ). To further investigate the genetic epidemiology and pathogenesis of phaeochromocytoma, we have (i) analysed patients with familial phaeochromocytoma for germline mutations in RET, VHL and GDNF and (ii) screened for somatic GDNF mutations in sporadic, MEN 2 and VHL phaeochromocytomas. Our results suggest that although germline VHL mutations may manifest as familial phaeochromocytoma, germline mutations in VHL and RET are unlikely to account for all cases of phaeochromocytoma susceptibility. In addition, although germline and somatic GDNF mutations do not appear to have a major role in phaeochromocytoma tumorigenesis, they may modify phaeochromocytoma susceptibility.

RESULTS

Identification of germline VHL gene mutations in familial phaeochromocytoma

SSCP analysis revealed variants in: three of the eight families in group A; one of the two individuals in group B; and none of the six families in group C. Genomic sequencing confirmed a germline VHL missense mutation in each of the four cases with an SSCP bandshift: c695G -> A, R161Q mutation was identified in two unrelated kindreds and a c451A -> G, S80G; and a c712C -> T, R167W in the other two families (Fig. 1 ). To further increase the efficiency of VHL mutation analysis, sequencing analysis of both strands of the coding region was then performed for all cases in Group A (adrenal phaeochromocytoma kindreds) and of the forward strand in the remaining patients (groups B and C). However this did not reveal any further variants.


Figure 1.Polish familial phaeochromocytoma kindred (i) in whom a VHL exon 1 SSCP bandshift (ii) (arrowed) was detected (N, normal; P, patient) and the subsequent ABI sequence (iii) showing a germline VHL A to G transition at nt 451 (arrowed).

To try and exclude linkage to VHL, we performed linkage studies using linked markers (D3S1038 and D3S1317) in five families negative for VHL gene mutations. However, family structures were not optimal and these studies were not informative.

Mutation analysis (SSCP in 28 cases and direct sequencing of the complete coding sequence in 14) of 28 sporadic phaeochromocytomas did not reveal evidence of somatic or germline VHL gene mutations.

Analysis of GDNF

SSCP analysis of GDNF was performed in (i) tumour DNA from 28 sporadic phaeochromocytomas, 12 MEN 2 phaeochromocytomas, and five VHL phaeochromocytomas, (ii) germline DNA from 16 cases of familial phaeochromocytoma (groups A, B and C) described previously and (iii) five cases of familial phaeochromocytoma described previously (28 ,31 ), four of which have a germline VHL mutation. No abnormality was detected in the cases of familial phaeochromocytoma or MEN 2 and VHL associated phaeochromocytoma tumour tissue. However one of 28 sporadic phaeochromocytomas demonstrated an SSCP band shift and direct sequencing revealed a C to T transition at nt 277 (Fig. 2 ) which is predicted to produce a non-conservative change, Arg to Trp, at codon 93. Germline DNA from the same individual demonstrated the same sequence variant. The c277C -> T sequence change results in the abolition of a HinfI restriction site and 104 GDNF chromosomes from normal control individuals were analysed to determine the frequency of this change. None of the 104 chromosomes analysed had evidence of this change. To assess the sensitivity of GDNF SSCP analysis, we sequenced the GDNF coding region in all 16 cases of familial phaeochromocytoma but did not identify any sequence variants.

Analysis of RET

Germline mutations in exons 10 and 11 were seached for in all 16 kindreds with familial phaeochromocytoma and no sequence changes were identified. In addition three cases (two from Group C and one from Group A) were screened for RET mutations in exons 2, 3 and 5-20 and no abnormality detected. All the results for VHL, GDNF and RET are summarized in Table 1 .

DISCUSSION


Figure 2.Sequence variant in germline GDNF of a sporadic phaeochromocytoma. There is a C to T transition at nt 277 (arrowed).

The identification of germline VHL mutations in familial phaeochromocytoma kindreds demonstrates the importance of molecular genetic testing for clinical management. Although none of the kindreds investigated had clinical evidence of VHL disease, three of the four kindreds found to have a VHL gene mutation had a mutation (c695G -> A, R161Q and c712C -> T, R167W) reported previously in classical VHL disease with phaeochromocytoma (3 ,33 ,34 ). Therefore, the identification of these VHL gene mutations enables presymptomatic screening for the onset of VHL disease related tumours. The absence of the other clinical features of VHL disease in these patients may reflect mutation-specific variations in phenotype, variable expression or modifier effects. Allele specific variation in predisposition to phaeochromocytoma has been reported in VHL disease such that missense mutations, most notably at codon 167 (Arg to Trp and Arg to Gln), are more frequent in VHL disease with phaeochromocytoma whereas large deletions, frameshift mutations, and intragenic mutations predicted to produce a truncated protein are less frequent (3 ,33 ,34 ). The identification of novel (i.e. not found in classical VHL families) VHL mutations in familial phaeochromocytoma kindreds suggests that phaeochromocytoma specific mutations do exist. In support of this view is the third mutation we describe, c451A -> G, present in a Polish mother and daughter with bilateral phaeochromocytoma. Further support for this concept comes from our group's previous finding of a novel mutation, V84L, (c463G -> T) in a Welsh kindred (28 ) and from the finding of a missense mutation (c775C -> G, L188V) in two apparently unrelated German families with familial phaeochromocytoma (29 ). These findings suggest that the VHL protein (pVHL) has tissue-specific functions which may be differentially affected by specific missense mutations. Comparison of missense mutations in phaeochromocytoma only families and VHL with phaeochromocytoma kindreds does not, however, demonstrate any clear differences in the sites of mutation. The mutation detection methods used in this study can identify a germline VHL mutation in excess of 80% of VHL families (3 ,33 ). Together with our previous study (28 ), our VHL gene mutation detection rate in familial phaeochromocytoma group A kindreds is 45% (five of 11) and 0% (none of six) in group C patients. Therefore, the involvement of other genes in phaeochromocytoma susceptibility is most likely, particularly in patients with extra-adrenal phaeochromocytoma.

Allele specific variation in predisposition to phaeochromocytoma has also been reported in MEN 2A such that missense mutations at codon 634 are associated with the presence of phaeochromocytoma and hyperparathyroidism (14 ,17 ). The analysis of RET in our familial phaeochromocytoma kindreds failed to reveal any mutations in exons 10 and 11. This may be explained on several counts. Firstly, our analysis was restricted to the regions mutated in MEN 2 and mutations could occur outside this region (although one Group A and two Group C cases without VHL mutations were screened for mutations in exons 2, 3 and 5-20 of RET and no abnormality was detected). In FMTC, several families with a codon 768 (exon 13) mutation have been described (17 ). However gain of function mutations occur at specific sites and the studies we performed should detect mutations in at least 95% of MEN 2 kindreds (17 ) whereas loss of function RET mutations as described in Hirschsprung disease occur throughout the gene (18 -20 ). Extra-adrenal phaeochromocytoma has rarely, if ever, been reported in MEN 2, and it may not be considered surprising that no RET mutations were detected in our group C individuals.

Table 1 Summary of phaeochromocytoma mutation results from the present and previous studies (28,29,31)
Clinical subtype
of familial phaeo		 Germline VHL
mutation detected		 Germline RET
mutation detected		 Germline GDNF
mutation detected
A 6/12 0/8 0/8
B 2/3 0/3 0/2
C 0/6 0/6 0/6
Phaeo tumours

 Somatic VHL
mutation detected		 Somatic RET
mutation detected		 GDNF mutation
mutation detected
Unilateral sporadic phaeo 1/46 1/46 1/28a
MEN 2 phaeo 0/17 0/17 0/12
VHL phaeo 0/5 0/5 0/5
phaeo: phaeochromocytoma.
aThis mutation was subsequently proven germline.
A, kindreds with familial phaeochromocytoma; B, individuals with bilateral phaeochromocytoma; C, individuals with either bilateral phaeochromocytoma or adrenal phaeochromocytoma and a family history of neuroectodermal tumours.

Table 2 . Details of GDNF exon 2 sequencing primers
Position of primer
(nucleotide no.)


Primer sequence
387-408 F: 5' CTTGGGTCTGGGCTATGAAACC 3'
286-262 R: 5' CTGCAGTACCTAAAAATCAGTTCC 3'

The infrequency of somatic VHL and RET mutations in sporadic phaeochromocytomas suggests that additional genes are involved in the genesis of this tumour (31 ). We then proceeded to analyse glial cell line-derived neurotrophic factor (GDNF) as a candidate gene for familial and sporadic phaeochromocytoma. GDNF has been identified recently as a ligand for RET (21 -24 ). According to the proposed model of action, GDNF Receptor-alpha (GDNFR-[alpha]), a novel glycolipid anchored membrane protein, binds GDNF and this complex is subsequently recognised by RET. The formation of a stable complex between these three entities results in tyrosine phosphorylation of RET which then leads to cell signalling. Therefore, by analogy with RET mutations in MEN 2, gain of function mutations in GDNF could predispose to phaeochromocytoma. However, we were unable to identify mutations in GDNF, either germline in cases of familial phaeochromocytoma, or somatic in most sporadic and syndromic phaeochromocytomas. To assess the sensitivity of our SSCP analysis we sequenced GDNF in 16 cases but did not identify any variants not detected by SSCP. Dahia et al. (33 ) have also reported no GDNF mutations in 22 sporadic phaeochromocytomas analysed. Nevertheless, we did identify a GDNF sequence variant (R93W) in the germline of an individual with a sporadic phaeochromocytoma. This variant could represent a pathogenic mutation or a polymorphism. Evidence against a polymorphism is that this non-conservative substitution occurs at a residue which is conserved in all other species (mouse and rat) studied to date. Furthermore, two groups have reported finding the same GDNF R93W substitution in two families with HSCR but not in 376 control alleles (26 ,27 ). To date, four of five HSCR patients reported with a GDNF sequence variant have had an additional aetiology for HSCR (e.g. RET mutation) and it has been proposed that GDNF variants such as the R93W substitution act as modifiers which modulate the disease phenotype by interacting with other major susceptibility loci such as RET. However, Ivanchuk et al. (25 ) reported a de novo GDNF mutation (T154S) in an isolated case of HSCR. Our results suggest that GDNF alleles such as R93W could also function as low-penetrance susceptibility mutations for phaeochromocytoma. The suggestion that a single GDNF mutation may predispose to both phaeochromocytoma and HSCR susceptibility is intriguing. The spectrum of RET mutations in MEN 2 and HSCR individuals differ. However rarely, HSCR and MEN 2 may be found in the same family suggesting a shared susceptibility factor. Our results suggest that additional phaeochromocytoma susceptibility genes remain to be identified. Candidate genes would include GDNFR-[alpha]. Loss of heterozygosity (LOH) studies of phaeochromocytomas from sporadic and syndromic cases have indicated loss of 1p, suggesting that this region may harbour a tumour suppressor gene or genes whose inactivation may be important in the development of this tumour (34 ,35 ).

This study represents the largest molecular genetic investigation into the genetic susceptibility to phaeochromocytoma. We conclude that: in some cases familial phaeochromocytoma is allelic with VHL disease; MEN 2 associated RET mutations do not account for cases of familial phaeochromocytoma; and GDNF does not have a major role in the genetic susceptibility to phaeochromocytoma; however GDNF allelic variants may influence phaeochromocytoma susceptibility. Nevertheless, our results suggest that further susceptibility loci remain to be identified.

MATERIALS AND METHODS

Patients

VHL analysis. All subjects analysed had no clinical evidence or family history of MEN 2, VHL, or NF1. The patients were divided into three groups according to clinical criteria: group A, eight kindreds with familial phaeochromocytoma; group B, two individuals with bilateral phaeochromocytoma; and group C, six individuals with either multiple extra-adrenal phaeochromocytoma or adrenal phaeochromocytoma and a family history of neuroectodermal tumours.
GDNF analysis. Germline GDNF was analysed in patients from the above three groups in whom no germline VHL mutations were detected. In addition, tumour DNA samples from 28 sporadic phaeochromocytomas, 12 MEN 2 phaeochromocytomas and five VHL phaeochromocytomas were screened for somatic mutations in GDNF (Table 2 ).

Molecular analysis

Investigation of germline VHL mutations in familial phaeochromocytoma. The method is as described in Crossey et al. (33 ) but with some modifications. The nucleotide sequence 677-1036 was amplified using one primer pair (annealing temperature 63oC) with the following sequence: F:5' CACACTGCCACATACATGCACTC 3'; and R: 5' TGCCCCTAAACATCACAATGCCTA 3'. Each reaction required 0.8 [mu]M of primer and a `hot' start. The Mg2+ concentration was 1.5 mM and the Taq polymerase `Supertaq'. Primer set 3 required an annealing temperature of 63oC and each fragment was examined initially for point mutations by SSCP analysis.

The Applied Biosystems ABI model 373 automated sequencer was then used to: characterise the nature of the SSCP bandshifts detected; sequence both strands of the VHL coding sequence in adrenal phaeochromocytoma kindreds (group A); and to sequence the forward strand of the VHL coding region in the remaining patients (groups B and C).

The PCR products remaining after SSCP analysis and representing the VHL coding region were purified using Promega WizardTM PCR purification columns. The purified products were ethanol precipitated, redissolved in 4.4 [mu]l H2O and added to 1.6 pmol of primer and 4.0 [mu]l of PrismTM ready reaction Dye DeoxyTM Terminator Cycle Sequencing Kit in a total volume of 10 [mu]l. The reaction mixture was overlaid with mineral oil and cycle sequencing was performed on a Perkin Elmer Cetus Thermal Cycler for 35 cycles: 96oC 30 s, 54oC 30 s, and 60oC 4 min. Dideoxy terminated DNA fragments were ethanol precipitated before analysis using the ABI automated sequencer.

Family linkage studies with microsatellite markers linked to VHL (D3S1038 and D3S1317) were performed when a mutation could not be detected.Analysis of GDNF. Phaeochromocytoma tumour DNA and germline DNA from familial phaeochromocytoma patients was analysed for mutations in GDNF.

636 bp of coding sequence contained in two exons were amplified using the following two sets of primer sequences (F: 5' ATGAAGTTATGGGATGTCGTGGC 3', R: 5' AGTCACTGCTCAGCGCGAAGG 3' and F: 5' AAATATGCCAGGATTATCCTGA 3', R: 5' CAGATACATCCACACCTTTTAGCG 3').

Each fragment was amplified using PCR and analysed for point mutations according to Crossey et al. (33 ) with some minor changes: the SSCP analysis was performed at 4oC and the gels for exon 2 analysis were electrophoresed for 24 h.

The nature of the exon 2 SSCP bandshift detected was characterised using a Thermo Sequenase radiolabeled terminator cycle sequencing kit supplied by Amersham Life Science and appropriate primer sequences (F: 5' CTTGGGTCTGGGCTATGAAACC 3' and R: 5' CTGCAGTACCTAAAAATCAGTT-CC 3').

ACKNOWLEDGEMENTS

ERW is in receipt of a Medical Research Council (MRC) Studentship. CE is a Lawrence and Susan Marx Investigator and is supported by the Markey Charitable Trust and the Charles A Dana Foundation. We thank the Cancer Research Campaign (CRC) for financial support, the patients and families, the many colleagues who referred patients and Carole Sargent for helpful advice and assistance.

REFERENCES

1 Anderson, R.J. and Lynch, H.T. (1993) Familial risk for neurendocrine tumours. Curr. Opinion Oncol., 5, 75-84.

2 Schimke, R. (1990) Multiple endocrine neoplasia: how many syndromes? Am. J. Med. Genet., 37, 375-383. MEDLINE Abstract

3 Maher, E.R., Webster, A.R., Richards, F.M., Green, J.S., Crossey, P.A., Payne, S.J. and Moore, A.T. (1996) Phenotypic expression in von Hippel-Lindau disease: correlations with germlineVHL gene mutations. J. Med. Genet., 33, 328-332. MEDLINE Abstract

4 Riccardi, V.M. (1981) Von Recklinghausen neurofibromatosis. N. Engl. J. Med., 305, 1617-1627. MEDLINE Abstract

5 May, A.G., Moss, A., Gutierrez, O.H., Burday, S.Z. and Campbell, R.G. (1981) Clinical study of phaeochromocytoma. Am. J. Surg., 141, 346-352 MEDLINE Abstract

6 Latif, F., Tory, K., Gnarra, J., Yao, M., Duh, F.M., Orcutt, M.L., Stackhouse, T., Kuzmin, I., Modi, W., Geil, L., Schmidt, L., Zhou, F., LI, H., Wei, M.W., Chen, F., Choyke, P., Walther, M.M., Weng, Y., Duan, S.R., Dean, M., Glavc, D., Richards, F.M., Crossey, P.A., Ferguson-Smith, M.A., LePaslier, D., Chumakov, I., Cohen, D., Chinault, A.C., Maher, E.R., Linehan, W.M., Zbar, B. and Lerman, M.I. (1993) Identification of the von Hippel-Lindau disease tumour suppressor gene. Science, 260, 1317-1320. MEDLINE Abstract

7 Crossey, P.A., Richards, F.M., Foster, K., Green, J.S., Prowse, A., Latif, F., Lerman, M.I., Zbar, B., Affara, N.A., Ferguson-Smith, M.A. and Maher, E.R. (1994) Identification of intragenic mutations in the von Hippel-Lindau disease tumour suppressor gene and correlation with disease phenotype. Hum. Mol. Genet., 3, 1303-1308. MEDLINE Abstract

8 Chen, F., Kishida, T., Yao, M., Hustad, T., Glavac, D., Dean, M., Gnarra J.R., Orcutt, M.L., Duh, F. M., Glenn, G., Green, J., Hsia, E., Lamiell, J., Li, H., Wei, M.H., Schmidt, L., Tory, K., Kuzmin, I., Stackhouse, T., Latif, F., Linehan, W.M., Lerman, M. and Zbar, B. (1995) Germline mutations in the von Hippel-Lindau disease tumour suppressor gene: correlations with phenotype. Hum. Mutat.,5, 66-75. MEDLINE Abstract

9 Mulligan, L.M., Kwok, J.B.J., Healey, C.S. Elsdon, M.J., Eng, C., Gardner, E., Love, D.R., Mole, S.E., Moore, J.K., Papi, L., Ponder, M.A., Telenius, H., Tunnacliffe, A. and Ponder, B.A.J. (1993) Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A. Nature, 363, 458-460. MEDLINE Abstract

10 Donis-Keller, H., Dou, S., Chi, D., Carlson, K.M., Toshima, K., Lairmore, T.C., Howe, J.R., Moley, J.F., Goodfellow, P. and Wells, S.A. (1993) Mutations in the RET proto-oncogene are associated with MEN 2A and FMTC. Hum. Mol. Genet., 2, 851-856. MEDLINE Abstract

11 Carlson, K.M., Dou, S., Chi, D., Scavarda, N., Toshima, K., Jackson, C., Wells, S., Goodfellow, P. and Donis-Keller, H. (1994) Single missense mutation in the tyrosine kinase catalytic domain of the RET proto-oncogene is associated with multiple endocrine neoplasia type 2B. Proc. Natl. Acad. Sci. USA, 91, 1579-1583. MEDLINE Abstract

12 Eng, C., Smith, D.P., Mulligan, L.M., Nagai, M.A., Healey, C.S., Ponder, MA., Gardner, E., Scheumann, G.F.W., Jackson, C.E., Tunnacliffe, A. and Ponder, B.A.J. (1994) Point mutation within the tyrosine kinase domain of the RET proto-oncogene in multiple endocrine neoplasia type 2B and and related sporadic tumours. Hum. Mol. Genet., 3, 237-241. MEDLINE Abstract

13 Hofstra, R.M.W., Landsvater, R.M., Ceccherini, I., Stulp, R.P., Stelwagen, T., Luo, Y., Pasini, B., Höppener, J.W.M., Ploos van Amstel, H.K., Romeo, G., Lips, C.J.M. and Buys, C.H.C.M. (1994) A mutation in the RET proto-oncogene associated with multiple endocrine neoplasia type 2B and sporadic medullary thyroid carcinoma. Nature, 367, 375-376.

14 Mulligan, L.M., Eng, C., Healey, C.S., Clayton, D., Kwok, J.B.J., Gardner, E., Ponder, M.A., Frilling, A., Jackson, C.E., Lehnert, H., Neumann, H.P.H., Thibodeau, S.N. and Ponder, B.A.J. (1994) Specific mutations of the RET proto-oncogene are related to disease phenotype in MEN 2A and FMTC. Nature Genet.,6, 70-74. MEDLINE Abstract

15 Eng, C., Smith, D.P., Mulligan, L.M., Healey, C.S., Zvelbil, M.J., Stonehouse, T.J., Ponder, M.A., Jackson, C.E., Waterfield, M.D. and Ponder, B.A.J. (1995) A novel point mutation on the tyrosine kinase domain of the RET proto-oncogene in sporadic medullary thyroid carcinoma and in a family with FMTC. Oncogene, 10, 509-513. MEDLINE Abstract

16 Bolino, A., Schuffenecker, I., Luo, Y., Seri, M., Silengo, M., Tocco, T., Chabrier, G., Houdent, C., Murat, A., Schlumberger, M., Tourniaire, J., Lenoir, G.M. and Romeo, G. (1995) RET mutations in exons 13 and 14 of FMTC patients. Oncogene, 10, 2415-2419. MEDLINE Abstract

17 Eng, C., Clayton, D., Schuffenecker, I., Lenoir, G., Cote, G., Gagel, R.F., Ploos van Amstel, H.K., Lips, C.J.M., Nishisho, I., Takai, S.I., Marah, D.J., Robinson, B.G., Frank-Raue, K., Xue, F., Noll, W.W., Romei, C., Pacini, F., Fink, M., Niederle, B., Zedenius, J., Nordenskjöld, M., Komminoth, P., Hendy, G.N., Gharib, H., Thibodeau, S.N., Lacroix, A., Frilling, A., Ponder, B.A.J. and Mulligan, L.M. (1996) The relationship between specific RET proto-oncogene mutations and disease phenotype in multiple endocrine neoplasia type 2: International RET Mutation consortium analysis. J. Am. Med. Assoc., 276, 1575-1579.

18 Luo, Y., Barone, V., Seri, M., Bolino, A., Bocciardi, R., Ceccherini, I., Pasini, B., Toco, T., Lerone, M., Cywes, S., Moore, S., Vanderwinden, J.M., Abramowicz, M.J., Kristofferson, U., Larsson, L.T., Silengo, M., Martuciello, G. and Romeo, G. (1994) Heterogeneity and low detection rate of RET mutations in Hirschprung disease. Eur. J. Hum. Genet., 2, 272-280.

19 Angrist, M., Bolk, S., Thiel, B., Puffenberger, E.G., Hofstra, R.M., Buys, C.H.C.M., Cass, D.T. and Chakravarti, A. (1995) Mutation analysis of the RET receptor tyrosine kinase in Hirschprung disease. Hum. Mol. Genet., 4, 821-830. MEDLINE Abstract

20 Attie, T., Pelet, A., Edery P., Eng, C., Mulligan, L.M., Amiel, J., Boutrand, L., Neldjord, C., Nihoulfekete, C., Munnich, A., Ponder, B.A.J. and Lyonnet, S. (1995) Diversity of ret proto-oncogene mutations in familial and sporadic Hirschsprung disease. Hum. Mol. Genet., 4, 1381-1386. MEDLINE Abstract

21 Trupp, M., Arenas, E., Fainzilber, M., Nilsson, A., Sieber, B., Grigoriou, M., Kilkenny, C., Salazar-Grueso, E., Pachnis, V., Arumäe, U., Saarma, M. and Ibárez, C.F. (1996) Functional receptor for GDNF encoded by the c-ret proto-oncogene. Nature, 381, 785-789. MEDLINE Abstract

22 Durbec, P., Marcos-Gutierrez, C.V., Kilkenny, C., Grigoriou, M., Wartiowaara, K., Suvanto, P., Smith, D., Ponder, B., Constanti, F., Saarma, M., Sariola, H. and Pachnis, V. (1996) GDNF signalling through the RET receptor tyrosine kinase. Nature, 381, 789-793. MEDLINE Abstract

23 Treanor, J.J.S., Goodman, L., de Sauvage, F., Stone, D.M., Poulsen, K.T., Beck, C.D., Gray, C., Armani, M.P., Pollock, R.A., Hefti, F., Phillips, H.S., Goddard, A., Moore, M.W., Buj-bello, A., Davies, A.M., Asai, N., Takahashi, M., Vandlen, R., Henderson, C.E. and Rosenthal, A. (1996) Characterization of a multicomponent receptor for GDNF. Nature, 382, 80-83.

24 Jing, S., Wen, D., Yu, Y.,Holst, P.L., Luo, Y., Fang, M., Tamir, R., Antonio, L., Hu, Z., Cupples, R., Louis, J., Hu, S., Altrock, B.W. and Fox, G.M. (1996) GDNF-induced activation of the RET protein tyrosine kinase is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell, 85, 1113-1124. MEDLINE Abstract

25 Ivanchuk, S.M., Myers, S.M., Eng, C. and Mulligan, L.M. (1996) De novo mutation of GDNF, ligand for RET/GDNFR-alpha receptor complex, in Hirschsprung disease. Hum. Mol. Genet., 5, 2023-2026. MEDLINE Abstract

26 Salomon, R., Attié, T, Pelt, A., Bidaud, C., Eng, C., Amiel, J., Sarnacki, S., Goulet, O., Ricour, C., Nihoul-Fékété, C., Munnich, A. and Lyonnet, S. (1996) Germline mutations of the RET ligand GDNF are not sufficient to cause Hirschprung disease. Nature Genet., 14, 345-347. MEDLINE Abstract

27 Angrist, M., Bolk, S., Halushka, M., Lapchak, P.A. and Chakravarti, A. (1996) Germline mutations in glial cell line-derived neurotrophic factor (GDNF) and RET in a Hirschprung disease patient. Nature Genet., 14, 341-343. MEDLINE Abstract

28 Crossey, P.A., Eng, C., Ginalska-Malinowska, M., Lennard, T.W.J., Sampson, J.R., Ponder, B.A.J. and Maher E.R. (1995) Molecular genetic diagnosis of von Hippel-Lindau disease in familial phaeochromocytoma. J. Med. Genet.,32, 885-886. MEDLINE Abstract

29 Neumann, H.P.H., Eng, C., Mulligan, L.M., Glavac, D., Ponder, B.A.J., Maher, E.R., Crossey, P.A. and Brauch, H. (1995) Consequences of direct genetic testing for germline mutations in the clinical management of families with multiple endocrine neoplasia type 2. J. Am. Med Assoc., 274, 1149-51.

30 Gross, D.J., Avishai, N., Meiner, V., Filon, D., Zbar, B. and Abeliovich, S. (1996) Familial phaeochromocytoma associated with a novel mutation in the von Hippel-Lindau gene. J. Clin. Endocrinol. Metab., 81, 147-149. MEDLINE Abstract

31 Eng, C., Crossey, P.A., Mulligan, L.M., Healey, C.S., Houghton, C., Prowse, A., Chew, S.L., Dahia, P.L.M., O'Riordan, J.L.H., Toledo, S.P.A., Smith, D.P., Maher, E.R. and Ponder, B.A.J. (1995b) Mutations in the RET proto-oncogene and the von Hippel-Lindau disease tumour suppressor gene in sporadic and syndromic phaeochromocytomas. J. Med. Genet.,32, 934-937. MEDLINE Abstract

32 Hofstra, R.M.W., Stelwagen, T., Stulp, R.P., de Jong, D., Hulsbeek, M., Kamsteeg, E.J., van den Berg, A., Landsvater, R.M., Vermey, A., Molenaar, W.M., Lips, C.J.M. and Buys, C.H.C.M. (1996) Extensive mutation scanning of RET in sporadic medullary thyroid carcinoma and of RET and VHL in sporadic phaeochromocytomas reveals involvement of these genes in only a minority of cases. J. Clin. Endocrinol. Metab., 81, 2881-2884.

33 Dahia, P.L.M., Toledo, S.P.A., Mulligan, L.M., Maher, E.R., Grossman, A.B. and Eng, C. (1997) Mutation analysis of GDNF, a ligand for the RET/GDFR-alpha receptor complex, in sporadic phaeochromocytomas. Cancer Res. 57, 310-313.

34 Moley, J.F., Brother, M.B., Fong, C. White, P.S., Baylin, S.B., Nelkin, B., Wells, S.A. and Brodeur, G.M. (1992) Consistent association of 1p loss of heterozygosity with pheochromocytomas from patients with multiple endocrine neoplasia type 2 syndromes. Cancer Res., 52, 770-774. MEDLINE Abstract

35 Khosla, S., Patel, V.M., Hay, I.D., Schaid, D.J., Grant, C.S., van Heerden, J.A. and Thibodeau, S.N. (1991) Loss of heterozygosity suggests multiple genetic alterations in pheochromocytomas and medullary thyroid carcinomas. J. Clin. Invest., 87, 1691-1699. MEDLINE Abstract

*To whom correspondence should be addressed at the University of Birmingham. Tel: +44 121 627 2642; Fax: +44 121 627 2618; Email: ermaher{at}hgmp.mrc.ac.uk

-->
This page is maintained by OUP admin. Last updated Tue Jun 10 19:01:42 BST 1997. Part of the OUP Journals World Wide Web service. Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Eur J EndocrinolHome page
P. Gergics, A. Patocs, M. Toth, P. Igaz, N. Szucs, I. Liko, F. Fazakas, I. Szabo, B. Kovacs, E. Glaz, et al.
Germline VHL gene mutations in Hungarian families with von Hippel-Lindau disease and patients with apparently sporadic unilateral pheochromocytomas
Eur. J. Endocrinol., September 1, 2009; 161(3): 495 - 502.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
E. R. Woodward, C. Ricketts, P. Killick, S. Gad, M.R. Morris, F. Kavalier, S. V. Hodgson, S. Giraud, B. Bressac-de Paillerets, C. Chapman, et al.
Familial Non-VHL Clear Cell (Conventional) Renal Cell Carcinoma: Clinical Features, Segregation Analysis, and Mutation Analysis of FLCN
Clin. Cancer Res., September 15, 2008; 14(18): 5925 - 5930.
[Abstract] [Full Text] [PDF]

Home page
 BrainHome page
E. R. Woodward, K. Wall, J. Forsyth, F. Macdonald, and E. R. Maher
VHL mutation analysis in patients with isolated central nervous system haemangioblastoma
Brain, March 1, 2007; 130(3): 836 - 842.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
P. J. Pollard, M. El-Bahrawy, R. Poulsom, G. Elia, P. Killick, G. Kelly, T. Hunt, R. Jeffery, P. Seedhar, J. Barwell, et al.
Expression of HIF-1{alpha}, HIF-2{alpha} (EPAS1), and Their Target Genes in Paraganglioma and Pheochromocytoma with VHL and SDH Mutations
J. Clin. Endocrinol. Metab., November 1, 2006; 91(11): 4593 - 4598.
[Abstract] [Full Text] [PDF]

Home page
 Endocr Relat CancerHome page
E. R Woodward and E. R Maher
Von Hippel-Lindau disease and endocrine tumour susceptibility.
Endocr. Relat. Cancer, June 1, 2006; 13(2): 415 - 425.
[Abstract] [Full Text] [PDF]

Home page
 Br Med BullHome page
E. R. Maher
Genetics of phaeochromocytoma
Br. Med. Bull., June 1, 2006; 79-80(1): 141 - 151.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
A. Blanes, J. J. Sanchez-Carrillo, and S. J. Diaz-Cano
Topographic Molecular Profile of Pheochromocytomas: Role of Somatic Down-Regulation of Mismatch Repair
J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 1150 - 1158.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
J. E. Garber and K. Offit
Hereditary Cancer Predisposition Syndromes
J. Clin. Oncol., January 10, 2005; 23(2): 276 - 292.
[Abstract] [Full Text] [PDF]

Home page
 JNCI J Natl Cancer InstHome page
J. Bryant, J. Farmer, L. J. Kessler, R. R. Townsend, and K. L. Nathanson
Pheochromocytoma: The Expanding Genetic Differential Diagnosis
J Natl Cancer Inst, August 20, 2003; 95(16): 1196 - 1204.
[Abstract] [Full Text] [PDF]

Home page
 Arch SurgHome page
L. Yip, G. J. Cote, S. E. Shapiro, G. D. Ayers, C. E. Herzog, R. V. Sellin, S. I. Sherman, R. F. Gagel, J. E. Lee, and D. B. Evans
Multiple Endocrine Neoplasia Type 2: Evaluation of the Genotype-Phenotype Relationship
Arch Surg, April 1, 2003; 138(4): 409 - 416.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
J C C Rocha, R L A Silva, B B Mendonca, S Marui, A J G Simpson, and A A Camargo
High frequency of novel germline mutations in the VHL gene in the heterogeneous population of Brazil
J. Med. Genet., March 1, 2003; 40(3): e31 - 31.
[Full Text] [PDF]

Home page
 Hum Mol GenetHome page
E. R. Maher and C. Eng
The pressure rises: update on the genetics of phaeochromocytoma
Hum. Mol. Genet., October 1, 2002; 11(20): 2347 - 2354.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
B E Baysal
Hereditary paraganglioma targets diverse paraganglia
J. Med. Genet., September 1, 2002; 39(9): 617 - 622.
[Abstract] [Full Text] [PDF]

Home page
 NEJMHome page
H. P. Neumann, B. Bausch, S. R. McWhinney, B. U. Bender, O. Gimm, G. Franke, J. Schipper, J. Klisch, C. Altehoefer, K. Zerres, et al.
Germ-Line Mutations in Nonsyndromic Pheochromocytoma
N. Engl. J. Med., May 9, 2002; 346(19): 1459 - 1466.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
S. Eketjall and C. F. Ibanez
Functional characterization of mutations in the GDNF gene of patients with Hirschsprung disease
Hum. Mol. Genet., February 1, 2002; 11(3): 325 - 329.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
M. Bahuau, A. Pelet, D. Vidaud, T. Lamireau, B. Le Bail, A. Munnich, M. Vidaud, S. Lyonnet, and D. Lacombe
GDNF as a candidate modifier in a type 1 neurofibromatosis (NF1) enteric phenotype
J. Med. Genet., September 1, 2001; 38(9): 638 - 643.
[Full Text] [PDF]

Home page
 Hum Mol GenetHome page
C. A. Friedrich
Genotype-phenotype correlation in von Hippel-Lindau syndrome
Hum. Mol. Genet., April 1, 2001; 10(7): 763 - 767.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
G. D. STRIZHEVA, T. CARSILLO, W. D. KRUGER, E. J. SULLIVAN, J. H. RYU, and E. P. HENSKE
The Spectrum of Mutations in TSC1 and TSC2 in Women with Tuberous Sclerosis and Lymphangiomyomatosis
Am. J. Respir. Crit. Care Med., January 1, 2001; 163(1): 253 - 258.
[Abstract] [Full Text]

Home page
 Cancer Res.Home page
O. Gimm, M. Armanios, H. Dziema, H. P. H. Neumann, and C. Eng
Somatic and Occult Germ-line Mutations in SDHD, a Mitochondrial Complex II Gene, in Nonfamilial Pheochromocytoma
Cancer Res., December 1, 2000; 60(24): 6822 - 6825.
[Abstract] [Full Text]

Home page
 J. Med. Genet.Home page
F J Hes, S McKee, M J B Taphoorn, P Rehal, R B van der Luijt, R McMahon, J J van der Smagt, D Dow, R A Zewald, J Whittaker, et al.
Cryptic von Hippel-Lindau disease: germline mutations in patients with haemangioblastoma only
J. Med. Genet., December 1, 2000; 37(12): 939 - 943.
[Abstract] [Full Text]

Home page
 Cancer Res.Home page
H. Le Hir, L. G. Colucci-D’Amato, N. Charlet-Berguerand, P.-F. Plouin, X. Bertagna, Vittorio de Franciscis, and C. Thermes
High Levels of Tyrosine Phosphorylated Proto-Ret in Sporadic Pheochromocytomas
Cancer Res., March 1, 2000; 60(5): 1365 - 1370.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (67)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Woodward, E. R.
Right arrow Articles by Maher, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Woodward, E. R.
Right arrow Articles by Maher, E. R.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?