Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (46)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Xu, C. F.
Right arrow Articles by Solomon, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, C. F.
Right arrow Articles by Solomon, E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1057-1062


Isolation and characterisation of the NBR2 gene which lies head to head with the human BRCA1 gene
Introduction
Results
Isolation of NBR2cDNA clones
   Expression of the NBR2 gene
   Genomic structure of the NBR2 gene
   Evolutionary conservation of the NBR2 gene
Discussion
Materials And Methods
   YAC12H4-selected cDNA sublibrary
   Marathon cDNA amplification
   DNA sequence analysis
   Northern analysis
   Cross-species DNA hybridisation
   SSCP analysis
   Acknowledgements
References


Isolation and characterisation of the NBR2 gene which lies head to head with the human BRCA1 gene

Isolation and characterisation of the NBR2 gene which lies head to head with the human BRCA1 gene Chun-Fang Xu1,2,*, Melissa A. Brown1,2, Hans Nicolai1,2, Julie A. Chambers1,2, Beatrice L. Griffiths1,2 and Ellen Solomon1,2

1Somatic Cell Genetics Laboratory, Imperial Cancer Research Fund, 44 Lincoln's Inn Fields, London WC2A 3PX, UK and 2Division of Medical and Molecular Genetics, UMDS, 8th Floor, Guy's Tower, Guy's Hospital, London SE1 9RT, UK

Received January 8, 1997; Revised and Accepted April 14, 1997

To study the regulation of BRCA1 gene expression and the potential importance of dysregulation of this gene in breast and ovarian cancer, we have examined the 5' region of the human BRCA1 gene in detail. We have identified a new gene, NBR2, which is partially related to the NBR1 gene (formerly known as 1A1-3B and mapping directly adjacent to the pseudo-BRCA1 gene) and which lies head to head with the BRCA1 gene. The physical distance between the transcription start sites of the NBR2 and BRCA1 genes is 218 bp, suggesting that regulation of the expression of both genes may be co-ordinated through a bi-directional promoter. The NBR2 gene contains five exons spanning a genomic region of ~30 kb between the BRCA1 and pseudo-BRCA1 genes. Northern analysis showed that the NBR2 gene is expressed in all the tissues examined. The NBR2 cDNA contains an open reading frame of 112 amino acids and is predicted to encode a protein of ~12 kDa. Single-strand conformation polymorphism (SSCP) analysis of the NBR2 gene failed to identify any mutations in either breast or ovarian cancer, suggesting that if the NBR2 gene is involved in the development of these cancers, other mechanisms for tumorigenesis may exist. Hybridisation of NBR2 probes to zoo blots showed that the NBR2 gene is present in human and other primates. No hybridisation to DNA from other species was observed, suggesting that genomic elements controlling BRCA1 expression may differ between species.

INTRODUCTION

It is estimated that ~45% of the families with breast cancer and almost all of the families with both breast and ovarian cancer are accounted for by defects in the breast cancer susceptibility gene BRCA1. Since its isolation in 1994 (1 ), intensive analysis for mutations in this gene has been carried out world-wide and, so far, >100 distinct germline mutations, scattered over the entire coding region of the BRCA1 gene, have been identified (2 ). However, unlike other tumour suppressor genes where both germline and somatic mutations have been found, no somatic mutations in breast cancer and only a handful of somatic mutations in ovarian cancer have so far been identified (3 -5 ). This suggests that either BRCA1 is not involved in the development of sporadic cancer, or that alternative inactivating mechanisms, other than mutation in the coding region, may be important. It is conceivable that such disruption of BRCA1 function could occur both at the transcriptional and the post-transcriptional levels, by mechanisms such as promoter mutation, DNA hypermethylation, alternative splicing or antisense blocking of RNA splicing or translation. In the process of examining such alternative mechanisms, we have been studying the 5' region of the BRCA1 gene and have previously reported identification of the transcription start sites for both the BRCA1 and the NBR1 genes (6 -7 ). We have also shown that the genomic region housing the 5' ends of these genes is duplicated, with a partial copy of the genomic region containing exons 1A, 1B and 2 of the BRCA1 gene lying head to head with the NBR1 gene, while a partial copy of the NBR1 gene, containing exons 1A, 1B and 3, resides <300 bp distal to the transcription start site of the BRCA1 gene (8 ). In this study, we show that this partial copy of the 5' end of the NBR1 gene is, in fact, part of a new gene named NBR2 (Next to BRCA1 gene 2), which is situated in the genomic region between the BRCA1 and pseudo-BRCA1 genes and lies head to head with the BRCA1 gene.

RESULTS

Isolation of NBR2cDNA clones

We had found previously that the duplicated genomic fragment containing partial copies of exons 1A and 1B of the NBR1 gene resides in the 5'-flanking region of the BRCA1 gene (8 ). To determine whether these exons were expressed, we used a probe generated from exon 1A of the NBR1 gene to screen a human breast cDNA sublibrary selected with YAC12H4. Four positives were identified, all with an insert of ~600 bp. Sequence analysis showed the four subclones were identical to one another, and subclone 15g2e1 was studied further. The first 164 bp of 15g2e1 sequence was 91% identical with exon 1A of the NBR1 gene (7 ), and the next 54 bp was 96% identical with exon 3 of the NBR1 gene, while no significant homology was identified between the remaining sequences. However, a 100% match was found between 15g2e1 and the genomic sequence at the 5' end of the BRCA1 gene (GenBank accession no. U37574) (6 ) over a stretch of 161 bp, suggesting a new gene might be present in this region. We therefore designated it NBR2.

Table 1 Oligonucleotide sequences used in PCR, marathon amplification and SSCP analysis
Name Position Sequence
PR1 Exon 3 5'-GGACACCGCTGCTGAGGTCCTTGC-3'
G8 Exon 4 5'-GCAGAGCTGGAGCTCGATCATGC-3'
CA8 Exon 2 5'-AAAATAAAATACCTGGATGAGG-3'
G5 Exon 4 5'-AAATGAACAGCCAGATGAAG-3'
1F 5' Flanking 5'-TCACAGTAATTGCTGTACGA-3'
1R Intron 1 5'-TTCCGCAACGCATGCTGGAA-3'
2F Intron 1 5'-TCTGAACACCTAGCAATAAGT-3'
2R Intron 2 5'-CTTCTATGTACATTATAACCT-3'
3F Intron 2 5'-TGTTCTCCTAATATTCCTTAC-3'
3R Intron 3 5'-TCCTGAGTAGCTTGGACTACA-3'
4F Intron 3 5'-CATTCATTTCACCCCTTTCTG-3'
4R Intron 4 5'-TACCACTGGCTTTCAGGCTAC-3'
5F1 Intron 4 5'-TATAAGTGAGAACGTGTGGTG-3'
5R1 Exon 5 5'-CTTCCAACCATAGTTAGGTAT-3'
5F2 Exon 5 5'-CATGATAGGAGCGTCCTTTGT-3'
5R2 Exon 5 5'-GGATACAAATGAACAGCCAGA-3'
5F3 Exon 5 5'-GCCGGGAGGATGGTGCACCCC-3'
5R3 3' Flanking 5'-ACAGGACCGCCCTCACGTCAG-3'
PR1 and G8 are NBR2-specific Marathon amplification primers. CA8 and G5 are primers used to generate NBR2 cDNA probes. The rest of the primers are used in SSCP analysis.

Table 2 Exon-intron organisation of the NBR2 gene
Exon no. Exon size (bp) 5' Intron sequence 3' Intron sequence
1 161 gaattctacctgagtttgcc GTaaatataagtaataagg
2 63 aatgtgtatttcttttgtAG GTaaagtatattatgggtct
3 266 tttcacccctttctgtgcAG GTaaagtagcctgaaagcca
4 468 gttttctgttcctttcttAG GTatcctttaaaatatcctt
5 386 ctttaatataagaaaataAG gggaaaaggggagcaaaggg


Figure 1. (a) Diagram showing the composite NBR2 cDNA generated from 15g2e1, p8 and Marathon RACE products M11-16, M14-18 and M14-19. The locations of introns were indicated by inverted triangles. Both 3' RACE products m14-18 and m14-19 contain poly(A) tails and potential polyadenylation signals at 20-30 nucleotides upstream from the poly(A) tails. The dotted line at the end of the m14-18 clone represents the divergence from the m14-19 clone. The positions and directions of the 5' (PR1) and 3' (G8) RACE primers are indicated by horizontal arrows. (b) Predicted amino acid sequence for NBR2 from the composite cDNA sequence.

To obtain the full-length cDNA for the NBR2 gene, we initially screened a commercial placenta cDNA library (Stratagene) with 15g2e1 as a probe. Two positives (p8 and p5) were isolated which were identical. Sequence analysis showed that p8 overlapped with 15g2e1 (Fig. 1 ) and extended further towards the 3' end. To map the precise 5' and 3' ends of the NBR2 gene, we subsequently performed Marathon RACE amplification using poly(A)+ RNA from mammary gland. PR1 and G8 were used as the 5' and 3' gene-specific RACE primers respectively (Fig. 1 , Table 1 ), and products corresponding to ~0.5 and 0.3-0.5 kb respectively were seen (data not shown). These products were subcloned and sequenced. The 5' RACE product (m11-16) did not extend further than that of 15g2e1, while two populations of the 3' RACE products (m14-18, m14-19), diverging at the 3' end, extended beyond the p8 sequence (Fig. 1 ). The complete NBR2 cDNA sequence is 1344 bp (Genbank accession No. U88573) excluding the poly(A) tail. The shorter sequence, produced by the alternative usage of a polyadenylation signal, is 1007 bp. Both cDNA sequences are predicted to encode a protein of 112 amino acids with an estimated mol. wt of 12.4 kDa, with no apparent homology to other proteins in the database.


Figure 2. Expression analysis of the NBR2 gene on an MTN Northern blot (Clontech). An NBR2 cDNA probe (exons 2-4) was hybridised according to the manufacturer's instructions. 1 (spleen), 2 (thymus), 3 (prostate), 4 (testis), 5 (ovary), 6 (small intestine), 7 (colon), 8 (peripheral blood leukocyte).


Figure 3. Schematic diagram of the genomic region between the BRCA1 and NBR1 genes adapted from Brown et al. (8). Arrows represent the direction of transcription, and boxes represent exons. E, EcoRI; P, PstI; H, HindIII. The sizes (kb) of the restriction enzyme-digested fragments are indicated above PAC103014. This diagram is not drawn to scale.

Expression of the NBR2 gene

Northern analysis with a probe derived from the p8 clone (exons 2-4 of NBR2) detected several transcripts (Fig. 2 ). These include mRNAs ranging in size between 1.5 and 2.5 kb, which from the RACE results above and from RT-PCR experiments (data not shown) are the products of alternative intragenic splicing of the NBR2 gene; a weak band of ~4.4 kb in most tissues and a band of ~4 kb in testis, both of which are due to cross-hybridisation with the NBR1 gene (7 ); and several larger bands which we believe to be transcribed from pseudo-copies of the NBR2 gene (data not shown).


Genomic structure of the NBR2 gene

We have previously constructed a cosmid and PAC contig covering the BRCA1 and NBR1 region (8 -10 ). To map the physical position of the NBR2 gene, probes from the 5' and 3' ends of the NBR2 cDNA were generated and hybridised to filters containing PAC103014, and cosmids A11100, D06121 and B09174 (8 ) (Fig. 3 ). The results confirmed that the NBR2 gene lies between the BRCA1 and pseudo-BRCA1 genes, spanning ~30 kb of genomic DNA. Further sequence analysis of cosmid D06121 revealed that NBR2 is transcribed in the opposite direction from BRCA1 and consists of five exons, with the last exon being alternatively used (Fig. 3 , Table 2 ). The GT-AG pairs which are essential for correct splicing were found at all the intron-exon junctions (Table 2 ). The transcription start site of the NBR2 gene is separated from that of the BRCA1 gene by 218 bp, suggesting that the intergenic region may function as a bi-directional promoter.

Evolutionary conservation of the NBR2 gene

To look for conservation of the NBR2 gene across species, probes from the NBR2 cDNA were hybridised to zoo blots (Fig. 4 ). Under the conditions used, hybridisation signals were detected in primates but not in other species, including mouse. This is consistent with previous mapping studies of the BRCA1 region in mouse, which showed that the BRCA1 gene is not duplicated and that it lies directly adjacent to the NBR1 gene (11 ). These results suggest that the NBR2 is of recent origin.ab


Figure 4. Zoo blots showing hybridisation of an exon 2-4 probe from the NBR2 cDNA, to EcoRI-digested genomic DNA fragments from various species. (a) Hybridisation to genomic DNA from a variety of species, washed to a stringency of 1* SSC at 65oC. (b) Hybridisation of the same probe to genomic DNA from primates, washed to a stringency of 0.5* SSC at 65oC.
Mutational analysis of the NBR2 gene in breast and ovarian cancer patients

To examine the possible role that the NBR2 gene plays in the development of breast and ovarian cancer, SSCP analysis was performed with primers spanning each of the exons (Table 1 ) on 50 breast and 50 ovarian tumours. No mutations were identified, suggesting that mutational inactivation of the NBR2 gene is not a common phenomenon in the development of breast or ovarian tumours.

DISCUSSION

We have isolated a new gene NBR2 residing in the genomic region between the breast cancer susceptibility gene BRCA1 (1 ) and NBR1 (7 ). The close proximity of the NBR2 gene to the BRCA1 gene and the potential shared use of an intergenic promoter region raises the possibility that regulation of the expression of these genes may be co-ordinated, or that the proteins encoded by these genes may be involved in the same biochemical pathway. Examples of such divergently transcribed genes include the Wilm's tumour genes WT1/Wit-1 (12 ), the ataxia telangiectasia genes ATM/E14 (13 ), the collagen genes [alpha]1/[alpha]2 (14 ) and TAP1/LMP2 genes (15 ).

BRCA1 is a tumour suppressor gene and yet functionally disrupting mutations are rarely found in sporadic cancers. This raises the possibility that other mechanisms, such as dysregulated expression of the BRCA1 gene, are important in the development of sporadic cancer, and indeed reduced levels of BRCA1 transcripts have been detected in breast tumours (16 ). In an attempt to elucidate the regulation of BRCA1 gene expression, we have analysed the cis-control elements in the promoter region of the BRCA1 gene. Our results have shown that the BRCA1 gene is under complex regulation: firstly, its transcription is under the control of dual promoters generating two distinct transcripts differing by the alternative use of the first exons (6 ) and, secondly, one of these promoters is shared with the NBR2 gene and is bi-directional (manuscript in preparation). The 218 bp intergenic sequence contains no TATA box, but there are other cis-elements that can bind transcription factors and function either uni-directionally or bi-directionally. Thus, the BRCA1 and NBR2 genes may be co-regulated in a spatial and temporal manner, depending on the relative abundance of specific transcription factors and, therefore, when the balance between the expression of the two genes is disrupted, abnormal cell growth and differentiation may occur.

Our data show that the emergence of the NBR2 gene in the BRCA1 neighbourhood is a recent evolutionary event, which probably occurred after the mammalian radiation into different orders ~80-100 million years ago. Due to the absence of the NBR2 gene in species other than primates, the chromatin structure and immediate cis-control elements in the BRCA1 promoter are likely to be significantly different across species. Indeed, sequence comparison between the 5'-flanking region of the human and mouse BRCA1 gene has revealed that only a CCAAT box and an SP1-binding site were conserved between the two species and that other potential binding sites for transcription factors, such as PEA3 and AP1 present in the human BRCA1 promoter (6 ), are absent in the mouse (11 ). Thus, it is very conceivable that the temporal and spatial tissue-specific expression and therefore possibly the function of the BRCA1 gene may be significantly different between the two species. The significance of newly acquired genomic sequence in the control of gene expression in primates has been observed previously in other genes. In particular, it has been very elegantly demonstrated in the apo E-CI-CI'gene cluster, where in the human the 5' end of the recently evolved apo CI'gene controls the tissue-specific expression pattern not only for apo CI but also for the more distantly located apo E (17 ,18 ), suggesting that in mouse without the apo CI'gene the tissue expression pattern of these genes are unlikely to be the same.

Differences in the regulation of human and mouse BRCA1 have implications for the interpretation of animal model experiments and suggest that caution should be exercised when inference of BRCA1 function in humans is made based on experiments performed using mice. Indeed, different phenotypes were observed between a naturally occurring human BRCA1 `knockout' and several experimentally engineered mice knockouts. In the former, the individual is developmentally normal and had breast cancer in her early thirties (19 ) while in the latter the BRCA1-deleted (-/-) mice are embryonic lethal with no evidence of tumour development in heterozygous mice (+/-) up to 1 year of age (20 -22 ). Therefore, when a murine model is used to study the function of a human gene, it must be remembered, as Kinzler and Vogelstein (23 ) recently put it, that human and mice `are not the same beasts'.

MATERIALS AND METHODS

YAC12H4-selected cDNA sublibrary

YAC clone 12H4 (9 ) was used in the construction of a cDNA sublibrary by hybrid selection (24 ) using a commercially available human breast cDNA library (Clontech). The sublibrary was enriched during two rounds of enrichment-amplification and cloned with EcoRI-XbaI into pBluescript. Approximately 800 clones were obtained and picked into microtitre plates and spotted on filters.

Marathon cDNA amplification

Marathon cDNA amplification was performed following the manufacturer's protocol (Clontech) using 1 [mu]g of poly(A)+ RNA from mammary gland (Clontech) as template. PR1 and G8 (Table 1 ) were used as NBR2 gene-specific primers, in combination with the AP1 primer (provided in the kit), for the 5' and 3' RACE long distance PCR respectively (Boehringer- Mannheim expandT long template PCR system). The PCR products were separated on an agarose gel, purified using a Geneclean II kit (BIO 101), and subsequently cloned into the pGEMT vector (Promega). Upon transformation, white colonies were picked and cultured in 500 [mu]l of L-Broth/Amp for 1 h. Fifty [mu]l of the culture were boiled for 10 min and 1 [mu]l of the supernatant was used as template in PCR screening, with T7 and SP6 primers. The PCR products were column purified (Pharmacia Biotech, MicrospinTM S-400HR) and subjected to automatic sequencing.

DNA sequence analysis

Plasmid and cosmid DNA was purified with QIAGEN columns, while PCR products were purified with a MicrospinT S-400HR column (Pharmacia Biotech). Sequencing was performed using a Taq DyeDeoxy Terminator Cycle Sequencing Kit (ABI), and analysed on an ABI 373A sequencer. Sequence analysis was carried out using the GCG programme.

Northern analysis

Northern analysis was performed as described previously (11 ). Briefly, poly(A)+ RNA from different tissues [on commercially available MTN blots (Clontech)] were hybridised with an [[alpha]-32P]dCTP-labelled probe generated by PCR using CA8 and G5 primers (Table 1 ) from the NBR2 gene, at 42oC for 18-24 h. Filters were washed twice in 2* SSC, 0.05% SDS at room temperature for 20 min and then twice in 0.1* SSC, 0.1% SDS at 50oC for 20 min.

Cross-species DNA hybridisation

Zoo blots were prepared as described before (11 ), and hybridised with the above-described NBR2 probe in 5* SSPE, 5* Denhardt's solution, 0.5% SDS, and 0.01% yeast RNA. Filters were washed to either 1* SSC or 0.5* SSC at 65oC for 15 min and exposed to X-ray film for 1-4 days.

SSCP analysis

Single strand conformation polymorphism (SSCP) analysis was performed as previously described (25 ). Briefly, PCR was performed on genomic DNA with intron-based primers (Table 1 ) flanking each of the exons with [[alpha]-32P]dCTP. Amplified PCR products were diluted 1:4 with loading buffer, denatured at 95oC for 5 min and separated on an MDE gel (J. T. Baker Inc.) for 12-16 h at room temperature. After electrophoresis, the gel was dried and exposed to X-ray film at -70oC overnight.

Acknowledgements

This work is supported by the Imperial Cancer Research Fund.

REFERENCES

1 Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P.A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennet, L.M., Ding, W., Bell, R., Rosenthal, J., Hussey, C., Tran, T., McClure, M., Frye, C., Hattier, T., Phelps, R., Haugen-Strano, A., Katcher, H., Yakumo, K., Gholami, Z., Shaffer, D., Sone, S., Bayer, S., Wray, C., Bogden, R., Dayananth, P., Ward, J., Tonin, P., Narod, S., Bristow, P.K., Norris, F.H., Helvering, L., Morrison, P., Rosteck, P., Lai, M., Barrett, J.C., Lewis, C., Neuhausen, S., Cannon-Albright, L., Goldgar, D., Wiseman, R., Kamb, A. and Skolnick, M.H. (1994) A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science, 266, 66-71. MEDLINE Abstract

2 Xu, C.-F. and Solomon, E. (1996) BRCA1 mutations in human cancer. Semin. Cancer Biol., 7, 33-40.

3 Futreal, P.A., Liu, Q., Shattuck-Eidens, D., Cochran, C., Harshman, K., Tavigian, S., Bennett, L.M., Haugen-Strano, A., Swensen, J., Miki, Y., Eddington, K., McClure, M., Frye, C., Weaver-Feldhaus, J., Ding, W., Gholami, Z., Soderkvist, P., Terry, L., Jhanwar, S., Berchuck, A., Iglehart, J.D., Marks, J., Ballinger, D.G., Barrett, J.C., Skolnick, M.H., Kamb, A. and Wiseman, R. (1994) BRCA1 mutations in primary breast and ovarian carcinomas. Science,266, 120-122. MEDLINE Abstract

4 Hosking, L., Trowsdale, J., Nicolai, H., Solomon, E., Foulkes, W., Stamp, G., Signer, E. and Jeffreys, A. (1995) A somatic BRCA1 mutation in an ovarian tumor. Nature Genet., 9, 343-344. MEDLINE Abstract

5 Merajver, S.D., Pham, T.M., Caduff, R.F., Chen, M., Poy, E.L., Cooney, K.A., Weber, B.L., Collins, F.S., Johnston, C. and Frank, T.S. (1995) Somatic mutations in the BRCA1 gene in sporadic ovarian-tumors. Nature Genet., 9, 439-443. MEDLINE Abstract

6 Xu, C.-F., Brown, M.A., Chambers, J.A., Griffiths, B., Nicolai, H. and Solomon, E. (1995) Distinct transcription start sites generate two forms of BRCA1 mRNA. Hum. Mol. Genet., 4, 2259-2264.

7 Campbell, I.G., Nicolai, H.M., Foulkes, W.D., Senger, G., Stamp, G.W., Allan, G., Boyer, C., Jones, K., Bast, R.C., Solomon, E., Trowsdale, J. and Black, D.M. (1994) A novel gene encoding a b-box protein within the BRCA1 region at 17q21.1. Hum. Mol. Genet., 3, 589-594. MEDLINE Abstract

8 Brown, M.A., Xu, C.F., Nicolai, H., Griffiths, B., Chambers, J.A., Black, D. and Solomon, E. (1996) The 5' end of the BRCA1 gene lies within a duplicated region of human-chromosome 17q21. Oncogene,12, 2507-2513. MEDLINE Abstract

9 Jones, KA., Black, D.M., Brown, M.A., Griffiths, B.L., Nicolai, H.M., Chambers, J.A., Bonjardim, M., Xu, C.-F., Boyd, M., McFarlane, R., Korn, B., Poustka, A., North, M.A., Schalkwyk, L., Lehrach, H. and Solomon, E. (1994) The detailed characterisation of a 400kb cosmid walk in the BRCA1 region: identification and localisation of 10 genes including a dual-specificity phosphatase. Hum. Mol. Genet., 3, 1927-1934. MEDLINE Abstract

10 Brown, M.A., Jones, K.A., Nicolai, H., Bonjardim, M., Black, D., McFarlane, R., de Jong, P., Quirk, J.P., Lehrach, H. and Solomon, E. (1995) Physical mapping, cloning and identification of genes within a 500kb region containing BRCA1. Proc. Natl Acad. Sci. USA,92, 4362-4366. MEDLINE Abstract

11 Chambers, J.A. and Solomon, E. (1996) Isolation of the murine NBR1 gene adjacent to the murine BRCA1 gene. Genomics, 38, 305-313. MEDLINE Abstract

12 Malik, K.T.A., Wallace, J.I., Ivins, S.M. and Brown, K.W. (1995) Identification of an antisense wt1 promoter in intron-1-implications for wt1 gene-regulation. Oncogene, 11, 1589-1595.

13 Byrd, P.J., Cooper, P.R., Stankovic, T., Kullar, H.S., Watts, G.D.J., Robinson, P.J., Taylor, A.M.R. (1996) A gene transcribed from the bidirectional ATM promoter coding for a serine rich protein: amino acid sequence, structure and expression studies. Hum. Mol. Genet., 5, 1785-1791. MEDLINE Abstract

14 Heikkila, P., Soininen, R. and Tryggvason, K. (1993) Directional regulatory activity of cis-acting elements in the bidirectional alpha 1(IV) and alpha 2(IV) collagen gene promoter. J. Biol. Chem., 268, 24677-24682. MEDLINE Abstract

15 Wright, K.L., White, L.C., Kelly, A., Beck, S., Trowsdale, J. and Ting, J.P. (1995) Coordinate regulation of the human TAP1 and LMP2 genes from a shared bidirectional promoter. J. Exp. Med.,181, 1459-1471. MEDLINE Abstract

16 Thompson, M.E., Jensen, R.A., Obermiller, P.S., Page, D.L. and Holt, J.T. (1995) Decreased expression of BRCA1 accelerates growth and is often present during sporadic breast-cancer progression. Nature Genet.,9, 444-450. MEDLINE Abstract

17 Simonet, W.S., Bucay, N., Pitas, R.E., Lauer, S.J. and Taylor, J.M. (1991) Multiple tissue-specific elements control the apolipoprotein E/C-I gene locus in transgenic mice. J. Biol. Chem., 266, 8651-8654. MEDLINE Abstract

18 Raisonnier, A. (1991) Duplication of the apolipoprotein C-I gene occurred about forty million years ago. J. Mol. Evol., 32, 211-219. MEDLINE Abstract

19 Boyd, M., Harris, F., McFarlane, R., Davidson, H.R. and Black, D.M. (1995) A human BRCA1 gene knockout. Nature, 375, 541-542. MEDLINE Abstract

20 Liu, C.Y., Fleskennikitin, A., Li, S., Zeng, Y.Y. and Lee, W.H. (1996) Inactivation of the mouse BRCA1 gene leads to failure in the morphogenesis of the egg cylinder in early postimplantation development. Genes Dev., 10, 1835-1843. MEDLINE Abstract

21 Gowen, L.C., Johnson, B.L., Latour, A.M., Sulik, K.K. and Koller, B.H. (1996) BRCA1 deficiency results in early embryonic lethality characterized by neuroepithelial abnormalities. Nature Genet., 12, 191-194. MEDLINE Abstract

22 Hakem, R., Delapompa, J.L., Sirard, C., Mo, R., Woo, M., Hakem, A., Wakeham, A., Potter, J., Reitmair, A., Billia, F., Firpo, E., Hui, C.C., Roberts, J., Rossant, J. and Mak, T.W. (1996) The tumor-suppressor gene BRCA1 is required for embryonic cellular proliferation in the mouse. Cell,85, 1009-1023. MEDLINE Abstract

23 Kinzler, K.W. and Vogelstein, B. (1996) What's mice got to do with it? Nature, 382, 672. MEDLINE Abstract

24 Korn, B., Sedlacek, Z., Manca, A., Kioschis, P., Konecki, D., Lehrach, H. and Poustka, A. (1992) A strategy for the selection of transcribed sequences in the Xq28 region. Hum. Mol. Genet., 1, 235-242. MEDLINE Abstract

25 Xu, C.-F., Chambers, J.A., Nicolai, H., Brown, M., Hugerat, Y., Mohammed, S., Hodgson, S., Bishop, T. and Solomon, E. (1997) Mutations of the BRCA1 gene in eight breast/ovarian cancer families. Genes, Chromosomes and Cancer, 18, 102-110.


*To whom correspondence should be addressed. Tel: +44 171 955 5000 ext. 5581; Fax: +44 171 955 4644; Email: xu@icrf.icnet.uk

-->
This page is maintained by OUP admin. Last updated Tue Jun 10 19:01:42 BST 1997. Part of the OUP Journals World Wide Web service. Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
J. Shu, J. Jelinek, H. Chang, L. Shen, T. Qin, W. Chung, Y. Oki, and J.-P. J. Issa
Silencing of bidirectional promoters by DNA methylation in tumorigenesis.
Cancer Res., May 15, 2006; 66(10): 5077 - 5084.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
E. Auriol, L.-M. Billard, F. Magdinier, and R. Dante
Specific binding of the methyl binding domain protein 2 at the BRCA1-NBR2 locus
Nucleic Acids Res., July 28, 2005; 33(13): 4243 - 4254.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. M. Pittman, A. J. Myers, J. Duckworth, L. Bryden, M. Hanson, P. Abou-Sleiman, N. W. Wood, J. Hardy, A. Lees, and R. de Silva
The structure of the tau haplotype in controls and in progressive supranuclear palsy
Hum. Mol. Genet., June 15, 2004; 13(12): 1267 - 1274.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S Gad, M Klinger, V Caux-Moncoutier, S Pages-Berhouet, M Gauthier-Villars, I Coupier, A Bensimon, A Aurias, and D Stoppa-Lyonnet
Bar code screening on combed DNA for large rearrangements of the BRCA1 and BRCA2 genes in French breast cancer families
J. Med. Genet., November 1, 2002; 39(11): 817 - 821.
[Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. D. Braastad, M. Leguia, and E. A. Hendrickson
Ku86 autoantigen related protein-1 transcription initiates from a CpG island and is induced by p53 through a nearby p53 response element
Nucleic Acids Res., April 15, 2002; 30(8): 1713 - 1724.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. Huang, M. Jokela, J. Tuusa, S. Skog, K. Poikonen, and J. E. Syvaoja
E2F mediates induction of the Sp1-controlled promoter of the human DNA polymerase {{epsilon}} B-subunit gene POLE2
Nucleic Acids Res., July 1, 2001; 29(13): 2810 - 2821.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S. Gad, M. T Scheuner, S. Pages-Berhouet, V. Caux-Moncoutier, A. Bensimon, A. Aurias, M. Pinto, and D. Stoppa-Lyonnet
Identification of a large rearrangement of the BRCA1 gene using colour bar code on combed DNA in an American breast/ovarian cancer family previously studied by direct sequencing
J. Med. Genet., June 1, 2001; 38(6): 388 - 392.
[Full Text]


Home page
CarcinogenesisHome page
J. C. Rice, H. Ozcelik, P. Maxeiner, I. Andrulis, and B. W. Futscher
Methylation of the BRCA1 promoter is associated with decreased BRCA1 mRNA levels in clinical breast cancer specimens
Carcinogenesis, September 1, 2000; 21(9): 1761 - 1765.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
F. MAGDINIER, L.-M. BILLARD, G. WITTMANN, L. FRAPPART, M. BENCHAÏB, G. M. LENOIR, J. F. GUÉRIN, and R. DANTE
Regional methylation of the 5' end CpG island of BRCA1 is associated with reduced gene expression in human somatic cells
FASEB J, August 1, 2000; 14(11): 1585 - 1594.
[Abstract] [Full Text]


Home page
CarcinogenesisHome page
T. Bianco, G. Chenevix-Trench, D. C.A. Walsh, J. E. Cooper, and A. Dobrovic
Tumour-specific distribution of BRCA1 promoter region methylation supports a pathogenetic role in breast and ovarian cancer
Carcinogenesis, February 1, 2000; 21(2): 147 - 151.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T.-C. Suen and P. E. Goss
Transcription of BRCA1 Is Dependent on the Formation of a Specific Protein-DNA Complex on the Minimal BRCA1 Bi-directional Promoter
J. Biol. Chem., October 29, 1999; 274(44): 31297 - 31304.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Puget, D. Stoppa-Lyonnet, O. M. Sinilnikova, S. Pages, H. T. Lynch, G. M. Lenoir, and S. Mazoyer
Screening for Germ-Line Rearrangements and Regulatory Mutations in BRCA1 Led to the Identification of Four New Deletions
Cancer Res., January 1, 1999; 59(2): 455 - 461.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. M. Schulte and A. Wellstein
Structure and Phylogenetic Analysis of an Endogenous Retrovirus Inserted into the Human Growth Factor Gene Pleiotrophin
J. Virol., July 1, 1998; 72(7): 6065 - 6072.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-F. Xu, J. A. Chambers, and E. Solomon
Complex Regulation of the BRCA1 Gene
J. Biol. Chem., August 22, 1997; 272(34): 20994 - 20997.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (46)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Xu, C. F.
Right arrow Articles by Solomon, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, C. F.
Right arrow Articles by Solomon, E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?