Visual pigment gene structure and expression in human retinae
Visual pigment gene structure and expression in human retinaeTomohiko Yamaguchi, Arno G. Motulsky and Samir S. Deeb*
Departments of Medicine and Genetics, University of Washington, Seattle, WA 98195, USA
Received February 14, 1997;Revised and Accepted April 10, 1997
We determined the genotypes of the X-chromosome-linked red/green color vision genes by a novel PCR/SSCP-based method and assessed expression by mRNA analysis in retinae of 51 unselected post mortem eye specimens from Caucasian males of unknown color vision status. All individuals had a single red (long-wave) pigment gene and one or more (an average of two) green (middle-wave) pigment genes. Four males had 5'green-red3' hybrid genes in addition to normal red and green pigment genes. These findings are consistent with earlier studies on human visual pigment gene structure using Southern blotting and with a recent study using pulsed-field electrophoresis. We interpret claims of much larger numbers of red, green and green-red hybrid genes to be technical artifacts. The ratio of expressed red to green pigment retinal mRNA varied widely (1-10 with a mode of 4) and was not correlated with that of red to green pigment genes. In one individual with a green-red hybrid gene in addition to normal red and green pigment genes, the normal red pigment gene and the hybrid gene were both expressed, but the normal green gene was not. This person presumably had deuteranomalous color vision. Two with green-red hybrid genes expressed the normal red and green pigment genes, but not the hybrid genes. These two individuals presumably had normal color vision. We interpret the failure to express their green-red hybrid genes to be caused by their location at a more distal position in the visual pigment gene array.
Human color vision is initiated by the absorption of light by three classes of cone photoreceptors, the short-wave or blue-, middle-wave or green- and long-wave or red-sensitive cones that have overlapping spectral sensitivity curves with wavelengths of maximum absorption at ~420, 530 and 560 nm, respectively (1 -5 ).
The red and green pigment genes are arranged in a head-to-tail tandem array on the long arm of the X-chromosome (Xq28) (6 -8 ). In individuals with normal color vision, the red pigment gene is located 5' of one or more green pigment genes. The most common number of green pigment genes in an array was shown to be two (with a range of 1-5) in the Caucasian population (9 ,10 ), but the frequency distribution varies among males of different ethnic origin (11 ,12 ). Each repeat unit in the array is comprised of a pigment gene (15 kb) of six exons and of 24 kb of intergenic sequences. The red and green pigment gene repeats are 98% identical at the DNA sequence level (including introns and 3'-flanking sequences), and the different green pigment genes are 99.9% identical (6 ).
Individuals with normal color vision can match the color of a test light of any wavelength composition by mixing the right proportions of three primaries (red, green and blue), and their color vision is therefore referred to as trichromatic. Individuals who lack functional red or green cones are known as protanopes or deuteranopes, respectively. They are able to match the color of a test light by mixing two primaries only and therefore have dichromatic color vision. Dichromacy occurs in ~1-2% of Caucasian males.
A milder form of defective color vision is anomalous trichromacy which occurs in ~5% of Caucasian males. Although anomalous trichromats are believed to have three classes of photoreceptors, one of these classes has anomalous spectral sensitivity. Protanomalous males have normal blue and green cones but anomalous red cones with a spectral sensitivity that is significantly shifted towards that of the green cone. Deuteranomalous individuals have normal blue and red cones together with anomalous green cones (13 ) with a spectral sensitivity that is significantly shifted towards that of the red cone.
The various common (8% of Caucasian males) red-green color vision defects are associated with complete loss of green photopigments or with the formation of red-green or green-red hybrid pigments with shifted absorption maxima. Unequal homologous recombination explains both the loss of pigment genes and the formation of hybrid pigment genes (9 ).
5'Red-green3' and 5'green-red3' hybrid genes were first discovered among individuals with protan and deutan color vision defects, respectively (9 ,12 ). 5'Red-green3' hybrid pigments are green-like and the 5'green-red3' hybrid pigments are red-like in their wavelength of maximum absorption (3 -5 ). We also observed that a small fraction (4-8% of unselected Caucasian males) with normal color vision had, in addition to normal red and green pigment genes, 5'green-red3' hybrid genes (10 ,12 ). To explain the lack of correspondence between genotype (green-red hybrid genes) and color vision phenotype, we hypothesized that not all opsin genes in an array are expressed in a sufficient number of retinal cones to influence color vision. We suggested that in deuteranomalous individuals the red and green-red hybrid but not the normal green pigment genes were expressed. In contrast, individuals with normal color vision who carried normal red and green pigment genes as well as green-red hybrid genes did not express the hybrid genes (12 ,14 ).
More recently, Neitz and Nietz claimed a much larger number of green pigment genes in many individuals (15 ) and reported the frequent finding of more than one red pigment gene per array (15 ). However, in a later publication (16 ), they referred to the additional red pigment genes as green-red hybrid genes and suggested that such hybrid genes occurred in almost 50% of the population.
To re-examine these problems of structure and function, we devised a novel method to assess the number of red and green pigment genes, as well as of various visual pigment hybrid genes. We then studied expression of these visual pigment genes in post mortem retinae by mRNA analysis. This approach allowed us to determine directly the ratio of expressed red to green pigment genes and whether green-red hybrid genes were expressed or not. Our findings are consistent with the interpretation that only expressed green-red hybrid genes cause deuteranomaly.
A novel method for determining genomic structure. We developed a rapid and reliable method for the determination of the structure of the X-chromosome-linked visual pigment gene arrays. This method was applied to arrays of 51 unselected Caucasian male post mortem retinae to study the relationship of gene structure to the patterns of retinal expression of these genes by quantitative mRNA analysis. The strategy used in determining genomic structure is depicted in Figure 1 A. Competitive PCR, using primers that completely match the sequence of both red and green pigment gene sequences, was used to amplify segments from the proximal promoter. The ratio of green to red promoter fragments amplified from genomic DNA of males was used to calculate the total number of genes in an array. Competitive PCR of red and green exon 4 sequences was then used to detect hybrid genes in which the fusion occurred 5' of exon 4. Such amplified sequences were separated electrophoretically (based on a few differences in nucleotide sequence) on a single-strand conformation polymorphism (SSCP) gel and quantified by phosphorimage analysis. Hybrid genes with fusion in intron 4 were detected by amplification with gene-specific primers (Table 1 and Fig. 1 A) followed by electrophoresis on agarose gels as previously described (12 ). Autoradiographs of SSCP gels showing red and green DNA fragments amplified from the promoter and exon 4 are shown in Figure 1 B and C, respectively.
. Sequence and location of oligodeoxynucleotide primers
I.D. no.
Position and Sequence (5' -> 3')
Location
80
(-190) *CCAGCAAATCCCTCTGAGCCG
Promoter
81
(41) GGCTATGGAAAGCCCTGTCCC
Promoter
55
(286) *AGAAGCTGCGCCACCCGCT
Exon 2
24B
(449) ACACAGGGAGACGGTGTAGC
Exon 2
30
(621) *TACTGGCCCCACGGCCTGAAG
Exon 4
2B
(785) CGCTCGGATGGCCAGCCACAC
Exon 4
7G
(730) ACCCCACTCAGCATCATCGT
Exon 4
7R
(730) ATCCCACTCGCTATCATCAT
Exon 4
3C
(786) GTGGCAAAGCAGCAGAAAGAG
Exon 5
78
(922) *TTGGCAGCAGCAAAGCATGCG
Exon 5
8G
(878) GAAGCAGAATGCCAGGACC
Exon 5
8R
(878) GACGCAGTACGCAAAGAT
Exon 5
The asterisk (*) indicates the primer in each pair that was 5' end-labeled prior to use in PCR amplification.
Number of red and green pigment genes per array. Earlier studies indicated the presence of a single red pigment gene and one or more green pigment genes per X chromosome (6 -9 ). The position of the red pigment gene at the 5' edge of the array, abutting single copy DNA sequence, explains lack of variation in its copy number. Therefore, in a single X chromosome, only one copy of the red pigment gene promoter should exist, while one or more copies of the green pigment gene promoter (depending upon the number of green pigment genes) may be found. Band density ratios corresponding to the green and red pigment gene promoters plus one equals the total number of genes in the array, i.e. a ratio of 2:1 would indicate a total number of three genes.
In order to compare the results obtained by the PCR/SSCP method with those determined by Southern blot analysis earlier (9 ), we selected 20 individuals for whom we had determined the ratio of green to red pigment genes by Southern blot analysis (10 ,11 ) and subjected their DNA to PCR/SSCP analysis of the promoter region. The plot (Fig. 1 D) of the results obtained by these two methods shows excellent correspondence for green to red pigment gene ratios up to 4.
The ratios of green to red promoter segments of X chromosomes from 51 unselected Caucasian male eyes are given in Table 2 (those who did not carry hybrid genes) and Table 3 (those who carried hybrid genes). The structures of gene arrays predicted from these ratios are shown in Figure 2 . Fifteen individuals (29.4%) had one red pigment and one green pigment gene, 26 (51.0%) had one red and two green pigment genes and five (9.8%) had one red and three or more green pigment genes. The frequency distribution of the total number of genes per array was similar to that reported previously for unselected Caucasian males using Southern blot analysis (6 ,10 ). Frequency of individuals with hybrid pigment genes. Hybrid genes in which the fusion occurred in intron 4 were detected by PCR amplification using green- or red-specific primers in exons 4 and 5 (Fig. 1 A). Hybrids in which the fusion occurred 5' of exon 4 were detected by competitive PCR amplification of red and green exon 4 followed by SSCP analysis and band intensity comparisons.
Ratios of green to red sequences in human genomic DNA and in retinal mRNA for individuals with no hybrid pigment genes
I.D. number
G/R promoter
G/R exon 4 genomic DNA
R/G exon 4 mRNA
2507
1.92 (0.08) ~2
2.28 (0.60) ~2
4.63 (1.52) ~5
2534
1.13 (0.02) ~1
1.30 (0.38) ~1
3.25 (0.04) ~3
2759
1.97 (0.12) ~2
1.77 (0.42) ~2
3.47 (0.99) ~3
2760
1.95 (0.16) ~2
1.96 (0.55) ~2
3.52 (0.55) ~4
2791
1.70 (0.13) ~2
1.93 (0.12) ~2
3.88 (0.70) ~4
2792
1.99 (0.01) ~2
1.87 (0.07) ~2
7.42 (2.08) ~7
2817
0.93 (0.02) ~1
1.05 (0.08) ~1
4.14 (0.22) ~4
2832
0.95 (0.07) ~1
1.53 (0.40) ~1
3.77 (0.98) ~4
2836
1.82 (0.03) ~2
1.93 (0.07) ~2
1.68 (1.13) ~2
2871
1.16 (0.06) ~1
1.06 (0.05) ~1
10.41 (1.70) ~10
2970
1.11 (0.08) ~1
1.02 (0.02) ~1
4.08 (1.18) ~4
2996
1.81 (0.02) ~2
2.02 (0.13) ~2
5.22 (0.60) ~5
3011
1.53 (0.11) ~1
1.12 (0.06) ~1
6.85 (2.56) ~7
3022
0.93 (0.08) ~1
1.10 (0.03) ~1
3.83 (0.34) ~4
3024
0.89 (0.01) ~1
1.12 (0.03) ~1
3.96 (0.52) ~4
3041
1.82 (0.00) ~2
1.98 (0.06) ~2
4.68 (1.65) ~5
3042
4.48 (0.21) ~4
2.61 (0.87) ~3
1.23 (0.19) ~1
3043
1.94 (0.03) ~2
1.94 (0.42) ~2
4.25 (0.92) ~4
3049
2.14 (0.02) ~2
1.88 (0.18) ~2
2.73 (1.04) ~3
3050
1.88 (0.11) ~2
2.18 (0.37) ~2
2.63 (0.37) ~3
3051
4.10 (0.03) ~4
4.15 (1.96) ~4
3.80 (0.56) ~4
3056
2.07 (0.14) ~2
1.86 (0.10) ~2
4.96 (0.70) ~5
3062
2.15 (0.05) ~2
1.89 (0.08) ~2
3.58 (1.42) ~4
3063
0.98 (0.04) ~1
0.98 (0.03) ~1
4.26 (0.21) ~4
3064
1.95 (0.21) ~2
1.89 (0.12) ~2
2.72 (1.01) ~3
3068
1.94 (0.07) ~2
1.87 (0.07) ~2
4.38 (1.02) ~4
3069
3.89 (0.01) ~4
5.15 (0.38) ~5
3.12 (0.45) ~3
3076
2.77 (0.25) ~3
2.79 (0.20) ~3
2.88 (0.61) ~3
3077
1.93 (0.11) ~2
1.91 (0.45) ~2
3.32 (1.04) ~3
3078
0.95 (0.03) ~1
1.01 (0.12) ~1
3.44 (0.09) ~3
3079
0.97 (0.02) ~1
1.02 (0.08) ~1
4.21 (0.61) ~4
3098
2.05 (0.33) ~2
1.97 (0.14) ~2
5.16 (0.48) ~5
3099
1.22 (0.27) ~1
1.07 (0.08) ~1
3.44 (0.37) ~3
3100
1.05 (0.08) ~1
1.09 (0.09) ~1
8.26 (0.95) ~8
3103
1.07 (0.06) ~1
1.04 (0.04) ~1
3.52 (0.65) ~4
3106
1.86 (0.02) ~2
1.96 (0.07) ~2
5.46 (1.07) ~5
3120
1.89 (0.01) ~2
2.00 (0.15) ~2
5.91 (0.77) ~6
3401
1.18 (0.06) ~1
1.15 (0.07) ~1
4.86 (0.84) ~5
3402
1.91 (0.04) ~2
1.98 (0.16) ~2
4.26 (0.68) ~4
3403
1.92 (0.06) ~2
1.99 (0.29) ~2
7.28 (1.59) ~7
3406
1.95 (0.03) ~2
1.94 (0.18) ~2
4.01 (1.31) ~4
3411
2.01 (0.04) ~2
1.82 (0.04) ~2
3.12 (0.90) ~3
3417
1.96 (0.01) ~2
1.92 (0.14) ~2
2.47 (0.52) ~2
3443
1.85 (0.13) ~2
2.05 (0.04) ~2
2.01 (0.72) ~2
3445
1.66 (0.09) ~2
2.31 (0.45) ~2
4.15 (1.03) ~4
3447
1.01 (0.04) ~1
1.16 (0.06) ~1
6.58 (3.15) ~7
3448
1.06 (0.04) ~1
1.09 (0.04) ~1
12.73 (8.36) ~13
3457
2.27 (0.07) ~2
2.47 (0.22) ~2
2.3 (0.14) ~2
3463
3.18 (0.33) ~3
3.16 (0.25) ~3
3.2 (0.37) ~3
Numbers represent means (standard error) of three independent determinations with the values rounded to the nearest whole number. Green to red (G/R) ratios for the promoter and exon 4 were determined using total genomic DNA as template. Red to green (R/G) mRNA ratios for exon 4 were determined using reverse-transcribed total retinal RNA as template.
Hybrid genes in which the points of fusion occurred 5' of exon 4 were detected by determining the ratio of green to red exon 4 genomic sequences and comparing it with that for the promoter segments. If the gene array is comprised of normal red and green pigment genes and no hybrid genes, then the green to red ratio of the amplified promoter segments would be the same as that of fragments amplified from exon 4. Inequality in these ratios would indicate the presence of green/red hybrid genes in the array. For example, a green:red ratio of 2:1 for the promoter and a ratio of 1:2 for exon 4 would indicate the presence of a 5' green-red 3' hybrid gene (fusion 5' of exon 4), in addition to one normal red and one normal green pigment genes (subject A in Fig. 2 and Table 3 ).
Expression of normal pigment genes. Total cellular RNA was prepared from whole retinae of 51 male eye donors and analyzed for the ratio of red to green exon 4 mRNA sequences by reverse transcription, followed by competitive PCR amplification and electrophoretic separation of red- from green-specific exon 4 DNA strands (SSCP) as described in Materials and Methods. A standardization curve relating expected and observed ratios of red to green exon 4 sequences was constructed by including purified DNA templates that contained artificial mixtures of known ratios of red to green exon 4 sequences in the PCR mixture. An autoradiograph of the SSCP gel and a plot of the standard curve are shown in Figure 3 A and B. This assay gave a linear response over a wide range of red to green ratios (0.2-10). Exon 4 was chosen for this assay since it contains the least number of nucleotide differences (three of 165) between red and green sequences so that differences in amplification rate based solely on sequence differences would be minimized. Furthermore, the amplified DNA strands derived from red and green exon 4 sequences can be separated easily by conformational differences on SSCP. Analysis of exon 5 by this method is complicated by the presence of a common polymorphism in codon 283 (CCA/CCC) of the green pigment gene. The red:green pigment mRNA ratios (not corrected using a standard curve) determined using exon 5 on eight eye specimens were on average 14% higher than those determined using exon 4 (data not shown).
An autoradiograph of an SSCP gel showing single strands of exon 4 of the red and green pigment genes in 14 males is shown in Figure 4 A. The red:green exon 4 mRNA ratios in retinae of the 46 (out of 51) male eye donors without hybrid genes are given in Table 2 and the frequency distribution is shown in Figure 4 B. There was wide variation in this ratio. The red pigment gene, which is located closest to the locus control region (LCR) of the pigment genes (see Fig. 6 ), was expressed at higher levels (on average 4-fold) than the green pigment gene in 45 of 46 subjects. Furthermore, this ratio was only moderately and inversely correlated (r = 0.351) to the ratio of green to red pigment genes in the arrays of these individuals (Fig. 4 C). There was no statistically significant difference (t-test) between the means of red:green mRNA ratios of the groups who had one or two green pigment genes.Expression of hybrid pigment genes. Among three eye donors (of a total of 51) who carried 5'green-red3' hybrid genes in addition to normal green and red pigment genes (subjects A, B and C in Fig. 2 and Table 3 A), we investigated whether the normal green or the 5'green-red3' hybrid genes were expressed. Failure of expression of the hybrid gene may provide an explanation for the association of normal color vision with the presence of 5'green-red3' hybrid genes.
Ratios of green to red sequences in human genomic DNA and in retinal mRNA for subjects A-E (see Fig. 2) who carried hybrid genes
Subject
I.D. number
Promoter
Exon 2
Exon 4
Exon 5
A. Green/red ratios in genomic DNA
A
3263
2.04 (0.04) ~2
1.99 (0.22) ~2
0.54 (0.02) ~0.5
0.49 (0.06)~0.5
B
3023
1.92 (0.12) ~2
1.79 (0.24) ~2
1.96 (0.08) ~2
0.44 (0.05)~0.5
C
3061
1.85 (0.16) ~2
1.84 (0.15) ~2
1.97 (0.15) ~2
0.46 (0.03)~0.5
D
3119
1.52 (0.63) ~2
1.22 (0.02) ~1
green only
0.63 (0.03) ~1
E
2858
2.72 (0.01) ~3
2.86 (0.12) ~3
green only
1.82 (0.19) ~2
B. Red/green mRNA ratios in whole retinae
Subject
I.D. number
Exon 2
Exon 4
Exon 5
A
3263
9.35 (1.47) ~9
red only
red only
B
3023
4.38 (0.46) ~4
5.08 (1.10) ~5
4.15 (0.46) ~4
C
3061
4.98 (1.22) ~5
4.00 (1.02) ~4
4.37 (0.46) ~4
D
3119
5.18 (0.32) ~5
green only
7.77 (0.95) ~8
E
2858
3.57 (0.29) ~4
green only
4.12 (0.54) ~4
Numbers represent means (standard error) of three independent determinations and the values rounded to the nearest whole number.
Exons 2, 4 and 5 of the red and green pigment genes and of the corresponding retinal RNA from subjects A, B and C were subjected to competitive PCR/SSCP analysis as described in Materials and Methods. The results (Fig. 5 A) showed that the retinae of all three subjects contained mRNA sequences corresponding to exons 2, 4 and 5 of the red pigment gene in ratios shown in Table 3 B. Donor A expressed red and green exon 2 but only red exons 4 and 5, indicating that he expressed the normal red and green-red hybrid genes but not the normal green pigment gene of his array. Donors B and C expressed both red and green exons 2, 4 and 5, indicating that they expressed both the normal red and green pigment genes of their arrays (B and C gave the same results and only that of B is shown in Fig. 5 A). However, this experiment could not rule out expression of their green-red hybrid in addition to the normal red and green pigment genes.
We therefore examined directly whether the green-red hybrid genes of subjects B and C, together with their normal red and green pigment genes, are expressed in their retinae. Primers 7G [specific for green exon 4 sequence (12 )] and 78 (matches both red and green exon 5 sequences) (Table 1 , Fig. 1 A) were used to amplify competitively a segment extending from exon 4 to exon 5 sequences that are transcribed from either the normal green or the green-red hybrid pigment genes. SSCP analysis of the RT-PCR products obtained from retinal mRNA of donors A and B, as well as from donors who had normal red and green but no hybrid genes, is shown in Figure 5 B. RNA from donor E served as a positive control since he expressed green exon 4-red exon 5 hybrid RNA from his proximal red pigment gene with the green exon 4. No red-green hybrid mRNA sequences were detected using competitive PCR amplification in retinal RNA of donors B and C.
The above results suggest that the red and hybrid but not the green pigment gene were expressed in subject A, whereas the red and the normal green, but not the hybrid, genes were expressed in subjects B and C. Therefore, we infer that donor A had deuteranomalous color vision whereas donors B and C had normal color vision.
The lack of expression of the green pigment gene of donor A and of the green-red hybrid genes of donors B and C in their retinae is unlikely to be due to the presence of inactivating mutations, since the sequence of the proximal 230 bp of the promoter as well as of all coding sequences were found to be normal, as determined by SSCP analysis (data not shown).
Subject E also had a G4/R5 hybrid gene in addition to a R3/G4/R5 hybrid and two normal green pigment genes, but he was not informative regarding hybrid gene expression since mRNA corresponding to exons 4 and 5 of his two hybrid genes would be indistinguishable. This subject expressed a G4/R5 hybrid mRNA (but not a red exon 4 mRNA) as well as a normal green pigment mRNA (Fig. 5 B, Table 3 B). Subject D, who had a R3/G4/R5 in addition to a normal green pigment gene, also expressed a G4/R5 hybrid mRNA (from his hybrid red pigment gene) as well as a normal green pigment mRNA (Table 3 B).
We have developed a rapid and reliable SSCP-based method for determining the structure of the X-chromosome-linked red and green color vision genes. Using this method, we determined the numbers and structure of red and green pigment genes in 51 unselected Caucasian male eye donors. The results show that the great majority of males have arrays with one red pigment gene and an average of two green pigment genes and rarely more than three green pigment genes. The number and gross structure of gene arrays was very similar to those previously reported (9 ,10 ) for unselected Caucasian males (combined total of 152) as determined by Southern blot analysis. The frequency distribution of the total number of genes in an array determined by the PCR/SSCP method was also similar to that observed in 67 unselected males using the direct method of pulsed field gel electrophoresis (17 ). All these results are unlike those reported by Neitz and Neitz who claimed a much larger number of pigment genes per array (15 ,16 ). These authors determined the structure of red/green gene arrays of 27 Caucasian color-normal males using PCR to amplify corresponding segments of the red and green pigment genes, followed by digestion with restriction enzymes that distinguish red from green sequences. They reported that more than half of these 27 males have arrays that contained a total number of four or more genes. It is unlikely that this discrepancy is due to the small size of the sample they studied, since individuals with six or more genes are extremely rare in the general Caucasian population. Artifacts related to their PCR method used to estimate the ratio of green to red gene promoter sequences may explain both the unusually large numbers of genes per array and the high proportion of arrays with hybrid genes. It appears that the promoter ratio for most of their individuals who carried more than three genes per array was overestimated by a factor of two. This misinterpretation is suggested by the high proportion (12/15) of such individuals with an even number of genes.
We observed that four of 51 subjects had 5'green-red hybrid genes in addition to normal red and green pigment genes. This type of hybrid gene is typically found in deuteranomalous individuals (9 ,12 ,18 ), but occasionally among individuals with normal color vision (12 ). Again, these results are at odds with those of Neitz and Neitz (15 ) who reported that more than half of the 27 color-normal males carried two or more red pigment genes. However, these additional red pigment genes were referred to as 5'green-red3' hybrid genes in a subsequent report on the gene arrays of the same individuals (16 ). The hybrid genes in their study occurred only in males with four or more genes per array. This interpretation could have also resulted from overestimation of the green to red promoter ratio relative to that of exon 5 in those subjects who are presumed to carry more than three genes per array.
The ratio of red to green mRNA transcripts observed in extracts of whole retinae varied widely among males, with a modal value of four. This ratio may reflect a higher number of red cones in the normal retina. However, variation in the level of expression of these genes among individual cones may also contribute to the observed mRNA ratios. A number of investigators, using psychophysical techniques, have observed wide individual variations in the red to green cone ratio with a modal value of ~2 (19 -22 ). A narrower range of ratios (1.46-2.36) was observed by Cicerone and Nerger (23 ). All these studies used small and centrally located test fields. The observed ratios were therefore representative of the foveal region. Microspectrophotometric measurements on seven eyes of individuals with normal color vision gave an average red to green cone ratio in the foveal region of 1.39 (1 ). One explanation for the discrepancy between our results on cone ratios derived from mRNA analysis and the foveal ratio of ~2 may be that this ratio is higher in the peripheral retina than in the fovea. Since only ~10% of cones are located in the fovea, the ratios we obtained from whole retinal mRNA represent largely extrafoveal cones. There is evidence to suggest that the ratio of red to green cones, as determined by retinal mRNA analysis, is higher (4:1 vs 2:1) in the peripheral than in the central retina (24 ). On the other hand, estimates of red to green cone ratios (average of 2 with a range of 0.67-9.0) obtained on 16 subjects with normal color vision by flicker photometric electroretinography (ERG) were similar using either small or very large test fields (25 ) and suggest that the red to green ratio does not change significantly throughout the retina. More studies will be necessary to resolve the differences between results of mRNA analysis and ERG.
Our results which indicate that not all genes of the array are expressed in the retina are consistent with our earlier findings in which differential expression of green pigment genes in the retina was observed. In these studies, we took advantage of a common synonymous polymorphism (C/A) in exon 5 of the red pigment gene to address this question (14 ). Analysis in 22 male eye donors (14 ) who had two or more green pigment genes in their genomic DNA showed clearly that, whenever the two alleles of exon 5 were present in genomic DNA, only one was represented in retinal mRNA in sufficient quantities to be detected by competitive PCR amplification.
The model illustrated in Figure 6 was proposed (14 ) to explain such selective expression in the retina. An LCR, located between 3.1 and 3.7 kb 5' of the red pigment gene transcription initiation site, was shown to be required for cone photoreceptor-specific expression of both red and green pigment genes (26 ,27 ). The LCR was postulated to regulate expression of the opsin genes of the array in a distance-dependent manner (14 ). Thus, if the LCR forms a stable transcriptionally active complex with the red opsin gene promoter, a red-sensitive cone will result. If the LCR forms a stable complex with the proximal green pigment gene promoter instead, a green-sensitive cone is formed. Transcriptionally active complexes between the LCR and promoters of pigment genes located downstream of the two proximal pigment genes are less likely. We therefore suggest that only the two most proximal pigment genes of an array are expressed in sufficient cones to influence color vision as measured anomaloscopically. Based on this model, if a male subject has a normal red, normal green and a green-red hybrid gene, deuteranomaly would result only if the green-red hybrid gene occupies the proximal position and is expressed preferentially over the normal green opsin gene.
R3/G4/R5 hybrid genes would be expected to encode a red-sensitive pigment with an absorption maxima shifted by 2-3 nm towards the green (3 -5 ). Two of the amino acid residues (positions 230 and 233) that contribute to spectral tuning of the red and green visual pigments are located in exon 4. The normal red pigment gene has Ile and Ala while the green pigment gene has Thr and Ser at these two position, respectively. We previously observed two males who had R3/G4/R5 hybrid genes in addition to normal green pigment genes (28 ). Although these two subjects had normal color vision as determined by anomaloscopy, they required more red light in the mixture of red and green lights to match the standard yellow light than did individuals with normal red pigment genes (28 ).
Human retinal tissue and blood samples were collected from 51 unselected post mortem male Caucasian donors from between 4 and 8 h after death. These specimens were obtained through the Lions Eye Bank of the University of Washington, Seattle. DNA was prepared from peripheral blood leukocytes and total cellular RNA was prepared from whole retinae as previously described (14 ). The anterior part (including the lens) was removed from the enucleated eyes and the retinae were peeled off and either immediately used for extracting RNA or stored at -70oC.
DNA fragments derived from the red and green pigment gene promoters (from -190 to +41 with respect to the transcription start site) were amplified competitively by PCR using genomic DNA as template and primers (#80 and 81) that completely matched both red and green gene sequences (Table 1 and Fig. 2 ). One of the primers (#80) was radiolabeled with 32P at its 5' end, which resulted in tagging of the sense strands of the red and green amplified products. The labeling reaction for primers contained, in a total volume of 15 [mu]l, 15 pmol of deoxyoligonucleotide, 90 [mu]Ci of [[gamma]-32P]ATP (New England Nuclear; sp. act. 3000 Ci/mmol), 15 U of bacteriophage T4 polynucleotide kinase and kinase buffer (Bethesda Research Laboratories). The reaction mixture was incubated at 37oC for 45 min and then at 70oC for 15 min. The labeled oligonucleotide was purified on a G-25 spin column (Pharmacia) according to the manufacturer's protocol. Typically, the oligonucleotide primer was labeled to a specific activity of 1*106 c.p.m./pmol, diluted with cold oligonucleotide to a specific activity of 5*104 c.p.m./pmol and the concentration adjusted to 5 [mu]M for use in PCR amplification.
The amplification reaction contained, in a total volume of 10 [mu]l, 100 ng of genomic DNA, 0.5 U of Taq polymerase, amplification buffer (Perkin-Elmer), 200 [mu]M (each) dNTPs, 0.5 [mu]M of each primer (one of which is labeled) and 10% glycerol. An initial denaturation at 96oC for 5 min was followed by 26 cycles of amplification at 94oC for 30 s and extension at 64oC for 1 min and a final 4 min of extension.
The PCR-amplified segments were denatured and the single strands of the red and green gene promoter segments, which differ in sequence at a few positions, were separated from each other by electrophoresis (5-6 h at a gel temperature of 35oC) on a 6% non-denaturing polyacrylamide gel (SSCP, 29 ). The radioactivity in the DNA strands derived from the red and green gene promoters was determined by PhosphorImage analysis.
Detection of green/red hybrid genes with fusion points in intron 4 was performed using primers in exon 4 and 5 that are specific for either red or green pigment gene sequences (#7G, 7R, and 8G and 8R in Table 1 and Fig. 2 ) according to the procedure described in detail elsewhere (12 ).
Detection of hybrid genes with fusion points 5' of exon 4 was done by competitively amplifying exon 4 of red and green pigment genes followed by SSCP analysis. The amplification primers for exon 4 (#30 and 2B) are shown in Table 1 and Figure 1 A. The amplification reaction mixtures and conditions were the same as for amplification of promoter sequences except that no glycerol was included. The conditions for SSCP analysis were the same as for the promoter segment except that the gel temperature for exon 4 was 28oC. The red:green ratios for the promoter and exon 4 segments were compared. Inequality in these ratios indicated the presence of hybrid genes with fusion points 5' of exon 4.Nomenclature of hybrid genes. The hybrid pigment genes are referred to here by the abbreviations originally used by Merbs and Nathans (3 ) to indicate the origin of various exons. For example, a G4/R5 gene is a hybrid in which exons 1-4 are derived from the green pigment gene and exons 5 and 6 are derived from the red pigment gene (point of fusion in intron 4). A G2-3/R4/G5 is a hybrid in which only exon 4 of a red pigment gene is substituted with that of a green pigment gene. The designation G2-3 is used since exon 3 of the red pigment gene is indistinguishable from that of a green pigment gene due to the existence of several shared polymorphisms (30 ).
Total cellular RNA was prepared from whole retinae of 51 male eye donors, reverse transcribed into cDNA and used as template in PCR amplification and SSCP analysis essentially as described (30 ). Exons 2, 4 and 5 of the red and corresponding green sequences were amplified competitively in 25 cycles using the primers shown in Figure 1 A and Table 1 , with one of each set primers radiolabeled at its 5' end with 32P as described above. The amplification and SSCP conditions for exons 2 and 5 were the same as described above for the promoter, except for the omission of glycerol. As in genomic DNA analysis, one member of the pair of primers was end labeled in order to radiolabel only one of the DNA strands of the red and green exons and reduce the complexity of autoradiographs. The choice of 25 cycles of amplification was based on assays of DNA mixtures that contained known ratios of red to green transcripts derived from exon 4. Exon 4 fragments were amplified from genomic DNA of individuals who have only red or green exon 4 genomic DNA sequences, purified by electrophoresis on agarose gels and their concentrations determined. Aliquots were then mixed with a 100-fold excess of yeast DNA and used as templates in RT-PCR/SSCP analysis.
Detection of mRNA transcripts containing green-red hybrid sequences with fusion points in intron 4 (G4/R5 hybrids) and of transcripts derived from normal green pigment genes was done by competitive amplification (after reverse transcription) using primers #7G (specific for green exon 4) and #78 (identical in sequence to both red and green exon 5) (Table 1 and Fig. 5 B). Primer #78 was end labeled with 32P and the amplification conditions were the same as for exon 4. The amplified fragments (derived both from green-red hybrid and normal green pigment genes) were subjected to SSCP analysis for 5 h at a gel temperature of 33oC. The radioactivity in bands corresponding to hybrid and normal DNA segments was quantitated by phosphor image analysis.
Screening by SSCP for sequence variants in the coding regions of the red and green pigment genes as well as direct sequencing of PCR products have been described in detail elsewhere (30 ). The proximal promoter sequences were amplified using primers 1 and 2 (Table 1 ) followed by SSCP analysis under the conditions used above to determine the ratio of red to green promoter sequences.
We thank the Lions Eye bank of the University of Washington for supplying the specimens and Lori Iwasaki for the preparation of DNA. Part of this work was presented at the XIII International Conference on Color Vision Deficiencies in Pau, France, and appeared in the proceedings of this conference: C.R. Cavonius, Editor. Kluwer Academic Publishers, Doerdrecht, 1997, pp. 21-31. This work was supported by NIH Grant EY08395.
1 Dartnall, H.J.A., Bowmaker, J.K. and Mollon, J.D. (1993) Human visual pigments: microspectrophotometric results from the eyes of seven persons. Proc. R. Soc .Lond, Ser B, 220, 115-130.
2 Smith, V.C. and Pokorny, J. (1975) Spectral sensitivity of the cone photopigments between 400 and 500 nm. Vision Res., 15, 161-171.MEDLINE Abstract
3 Merbs, S.L. and Nathans, J. (1992) Absorption spectra of the hybrid pigments responsible for anomalous color vision. Science, 258, 464-466.MEDLINE Abstract
4 Merbs, S.L. and Nathans, J. (1992) Absorption spectra of human cone pigments. Nature, 356, 433-435.MEDLINE Abstract
5 Asenjo, A.B., Rim, J. and Oprian, D.D. (1994) Molecular determinants of human red/green color discrimination. Neuron, 12, 1131-1138.MEDLINE Abstract
6 Nathans, J., Thomas, D. and Hogness, D.S. (1986) Molecular genetics of human color vision: the genes encoding blue, green and red pigments. Science, 232, 193-202.MEDLINE Abstract
7 Vollrath, D., Nathans, J. and Davis R.W. (1988) Tandem array of human visual pigment genes at Xq28. Science, 240, 1669-1672.MEDLINE Abstract
8 Feil, R., Aubourg, P., Heilig, R. and Mandel, J.L. (1990) A 195-Kb cosmid walk encompassing the human Xq28 color vision pigment genes. Genomics, 6, 367-373.MEDLINE Abstract
9 Nathans, J., Piantanida, T.P., Eddy, R.L., Shows, T.B. and Hogness, D.S. (1986) Molecular genetics of inherited variation in human color vision. Science, 232, 203-210.MEDLINE Abstract
10 Drummond-Borg, M., Deeb, S.S. and Motulsky, A.G. (1989) Molecular patterns of X chromosome-linked color vision genes among 134 men of European ancestry. Proc. Natl Acad. Sci. USA, 86, 983-987.MEDLINE Abstract
11 Jorgensen, A.L., Deeb, S. and Motulsky, A.G. (1990) Molecular genetics of X chromosome-linked color vision among populations of African and Japanese ancestry: high frequency of a shortened red pigment gene among Afro-Americans. Proc. Natl Acad. Sci. USA, 87, 6512-6516.MEDLINE Abstract
12 Deeb, S.S., Lindsey, D.T., Hibiya, Y., Sanocki, E., Winderickx, J., Teller, D.Y. and Motulsky, A.G. (1992) Genotype-phenotype relationships in human red/green color vision defects: molecular and psychophysical studies. Am. J. Hum. Genet., 51, 687-700.MEDLINE Abstract
13 Pokorny J., Smith V.C. and Verriest G (1979) Congenital color defects. In Pokorny, J., Smith, V.C., Verriest, G. and Pinckers, A.J.L.G. (eds), Congenital and Acquired Color Vision Defects. Grune and Stratton, New York, p. 183.
14 Winderickx, J., Battisti, L., Motulsky, A.G. and Deeb, S.S. (1992) Selective expression of the human X-linked green pigment genes. Proc. Natl Acad. Sci. USA, 89, 9710-9714.MEDLINE Abstract
15 Neitz, M. and Neitz, J. (1995) Numbers and ratios of visual pigment genes for normal red-green color vision. Science, 267, 1013-1016.MEDLINE Abstract
16 Neitz, M., Neitz, J. and Grishok, A. (1995) Polymorphism in the number of genes encoding long-wavelength-sensitive cone pigments among males with normal color vision. Vision Res., 35, 2395-2407MEDLINE Abstract
17 Macke, J.P. and Nathans, J. (1997) Individual variation in the size of the human red and green visual pigment gene array. Invest. Ophthalmol. Vis. Sci., 38, in press.
18 Neitz, M., Neitz, J. and Kainz, P.M. (1996) Visual pigment gene structure and the severity of color vision defects. Science, 274, 801-804.
19 de Vries, H.L. (1947) The heredity of the relative numbers of red and green receptors in the human eye. Genetica, 24, 199-212.
20 Rushton, W.A.H. and Baker, H.D. (1964) Red/green sensitivity in normal vision. Vision Res., 4, 75-85.
22 Wesner, M.F., Pokorny,J., Shevell, S.K. and Smith, V.C. (1991) Foveal cone detection statistics in color normals and dichromats. Vision Res., 31, 1021-1037.MEDLINE Abstract
23 Cicerone, CM and Nerger, J.L. (1989) The relative numbers of long-wavelength-sensitive and middle-wavelength-sensitive cones in the human fovea centralis. Vision Res., 19, 115-128.
24 Neitz, M., Hagstrom, S.A., Kainz, P.M. and Neitz, J. (1996) L and M cone gene expression in the human retina: relationship with gene order and retinal eccentricity. Invest. Ophthalmol. Vis. Sci., 37, S448.
25 Jacobs, J. and Neitz, J. (1993) Electrophysiological estimates of individual variation in the L/M cone ratio. In Drum, B. (ed.), Color Vision Deficiencies XI. Proceedings of the International Symposium on Color Vision Deficiencies, Sydney, Kluwer, pp. 107-112.
26 Nathans, J., Maumenee, I.H., Zrenner, E., Sadowski, B., Sharpe, L.T., Lewis, R.A. et al. (1993) Genetic heterogeneity among blue-cone monochromats. Am.J. Hum. Genet., 53, 987-1000.
27 Wang, Y., Macke, J.P., Merbs, S.L., Zack, D., Klaunberg, B., Bennet, J., Gearhart, J. and Nathans, J. (1992) A locus control region adjacent to the human red and green visual pigment genes. Neuron, 9, 429-440.MEDLINE Abstract
28 Winderickx, J. Lindsey, D.T., Sanocki, E., Teller, D.Y., Motulsky, A.G. and Deeb, S.S. (1992) A Ser/Ala polymorphism in the red photopigment underlies variation in colour matching among coulor-normal individuals. Nature, 356, 431-433.MEDLINE Abstract
29 Orita, M., Suzuki, Y., Sekiyu, T. and Hayashi, K. (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics, 5, 874-879.MEDLINE Abstract
30 Winderickx, J., Battisti, L., Hibiya, Y., Motulsky, A.G. and Deeb, S.S. (1993) Haplotype diversity in the human red and green opsin genes: evidence for frequent sequence exchange in exon 3. Hum. Mol. Genet., 2, 1413-1421.MEDLINE Abstract
*To whom correspondence should be addressed. Tel: +1 206 543 1706; Fax: +1 206 543 0754; Email: deeb{at}genetics.washington.edu
-->
This page is maintained by OUP admin. Last updated Tue Jun 10 19:01:42 BST 1997. Part of the OUP Journals World Wide Web service.
Copyright
Oxford University Press, 1996