Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (76)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Flint, J.
Right arrow Articles by Louis, E. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Flint, J.
Right arrow Articles by Louis, E. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1305-1314


Sequence comparison of human and yeast telomeres identifies structurally distinct subtelomeric domains
Introduction
Results
   Analysis of the 4p sequence
   Sequence characteristics of distal and proximal subtelomeric sequence
   Comparison between 4p and 16p
   Comparison between 4p, 16p and 22q
   Comparison between yeast and human subtelomeric structure
Discussion
Materials And Methods
   Contig assembly and sequence determination of the 4p and other telomeres
   DNA/RNA sources and analysis
   Data analysis
Acknowledgements
References


Sequence comparison of human and yeast telomeres identifies structurally distinct subtelomeric domains

Sequence comparison of human and yeast telomeres identifies structurally distinct subtelomeric domains J. Flint*, G. P. Bates1, K. Clark, A. Dorman2, D. Willingham2, B. A. Roe2, G. Micklem3, D. R. Higgs and E. J. Louis

Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford OX3 9DS, UK, 1Division of Medical and Molecular Genetics, United Medical and Dental Schools, 8th Floor Guy's Tower, Guy's Hospital, London SE1 9RT, UK, 2Department of Chemistry and Biochemistry, University of Oklahoma, Norman, OK 73019-0370, USA and 3The Sanger Centre, Hinxton Hall, Cambridge CB10 1RQ, UK

Received March 18, 1997; Revised and Accepted May 23, 1997

We have sequenced and compared DNA from the ends of three human chromosomes: 4p, 16p and 22q. In all cases the pro-terminal regions are subdivided by degenerate (TTAGGG)n repeats into distal and proximal sub-domains with entirely different patterns of homology to other chromosome ends. The distal regions contain numerous, short (<2 kb) segments of interrupted homology to many other human telomeric regions. The proximal regions show much longer (~10-40 kb) uninterrupted homology to a few chromosome ends. A comparison of all yeast subtelomeric regions indicates that they too are subdivided by degenerate TTAGGG repeats into distal and proximal sub-domains with similarly different patterns of identity to other non-homologous chromosome ends. Sequence comparisons indicate that the distal and proximal sub-domains do not interact with each other and that they interact quite differently with the corresponding regions on other, non-homologous, chromosomes. These findings suggest that the degenerate TTAGGG repeats identify a previously unrecognized, evolutionarily conserved boundary between remarkably different subtelomeric domains.

INTRODUCTION

Subtelomeric sequences, characterized from a large number of organisms, contain a wide variety of repetitive DNA, ranging from low copy interspersed repeats found on a few chromosome ends, to highly repetitive sequences present in many subtelomeric regions. Tandem repeats are commonly found in many subtelomeric regions and some sequences which are present as a single-copy at one subtelomeric region are also found on many other chromosome ends (reviewed in 1 ,2 ).

Despite the complexity of subtelomeric regions, previous studies have revealed no conserved elements indicative of an important function. Furthermore, naturally occurring mutations in humans show that chromosomes without subtelomeric sequence can be inherited normally (3 ). Similarly, yeast chromosomes devoid of subtelomeric sequence do not appear to be adversely affected (4 ). Although mutation analysis to date has tested function only in limited ways, it suggests that subtelomeric regions may serve no important biological role other than to act as a buffer between functional telomeric repeats and the most distal genes on the chromosome. Thus the prevailing view is that the complex structure of subtelomeric regions simply reflects dispersal of multiple repetitive sequences between chromosomal ends by relatively unconstrained recombination and gene conversion.

The processes that drive the production and maintenance of subtelomeric repeats have been studied in most detail in yeast. Immediately proximal to the yeast telomere sequence (TG1-3) are a variable number of repeats known as Y' elements which fall into two major size classes of 5.2 and 6.7 kb. Frequent homologous recombination and gene conversion events have been documented between Y' elements that can account for the spread and variability of these yeast subtelomeric sequences (5 -7 ). In addition, the presence of a mitochondrial intron in yeast subtelomeric sequence (8 ) and copies of interstitially located genes (9 ,10 ) in the absence of flanking homologous sequences indicates that non-homologous recombination events may be relatively common in subtelomeric regions. Similar processes are thought to explain the distribution of subtelomeric repeats in other organisms (2 ).

However, it is not known whether sequence exchange across the subtelomeric region is random, or whether it is constrained in some way that reflects structural organization. One way to investigate this question is to search for conserved structural features within a single species and through inter-species comparisons. Currently, complete structural information is only available for yeast, in which the only conserved feature found in the 20 telomeres currently analysed is a 475 bp (X) element containing a putative origin of replication (autonomously replicating sequence, ARS) (1 ) and binding sites for two essential proteins (11 ,12 ).

We have searched for conserved structural features in human subtelomeric DNA and have sequenced and characterized 118 kb of the 4p telomere and 40 kb of subtelomeric DNA from 22q. We have previously sequenced 285 kb of the 16p telomere (13 ) and now report comparisons of the sequence organization of the three telomeres. In addition we have analyzed the telomeric regions of the yeast genome sequence to look for conserved features within yeast and between yeast and humans.

RESULTS

Analysis of the 4p sequence

To characterize the 4p subtelomeric region we obtained 118 768 bp of sequence extending from the terminal (TTAGGG) repeats (accession no. Z95704). To compare this sequence with other subtelomeric regions we designed primer pairs that amplify DNA free of known repeats (Alu, L1, MER etc.) across the entire subtelomeric region. Using these primers we analysed DNA from 30 YACs that contain different human telomeres (14 ) and DNA from a somatic cell hybrid panel (UK HGMP resource centre). The results of these two PCR surveys are broadly in agreement: no sequence unique to chromosome 4p is found within 60 kb of the telomere. Combining existing hybridization data (15 ) with the PCR analysis we find that the 4p subtelomeric sequence extends to a region between co-ordinates 58 321 and 60 560 that contains an L1 repeat.

The distribution of matches to other chromosomes across the ~60 kb of 4p subtelomeric sequence, as judged by PCR analysis, is not random (Fig. 1 ). Within the terminal 15 kb of 4p there are matches to 17 different telomeres whereas the more proximal 45 kb matches only chromosome 4q and four acrocentric p arms (13p, 15p, 21p and 22p) (15 ). Each sequenced PCR product from non-homologous chromosomes showed >80% similarity to the corresponding 4p sequence. However, the initial PCR analysis suggested that the matches might be complex. To investigate this further we looked for sequence matches between the 4p telomere and 661 subtelomeric sequences (average size 450 bp) that we have previously compiled from 31 telomeric YACs.


Figure 1.The number of chromosome ends with sequence similarity to human 4p is shown. Each cross on the graph represents the number of chromosome ends from which a PCR product was obtainable or for which hybridization data indicates a match (15). The distance, in kilobases, from the 4p telomere is shown on the x-axis. Proximal to 15 kb from the telomere, there are similarities to 4q, 13p, 15p 21p and 22p only. Beyond 23 kb, matches are to 13p, 15p 21p and 22p only. Beneath the graph the clones of the sequenced contig are shown. All those prefixed lambda are bacteriophages. P6 and P2 are plasmids and B31 is a cosmid.

In agreement with the initial PCR results we found numerous matches to the first 15 kb of 4p: sequences from at least nine other telomeres have similarities >90% to the first 15 kb of 4p. As suspected, the nature of these matches is complex. We found that some of the telomere sequence matches are non-contiguous. For example, a single 700 bp sequence from 13q has three matches on 4p spread over 9 kb as if the sequence from 13q were the result of splicing out two introns from 4p. Other, similar, split matches were seen in the terminal 15 kb of 4p, but, despite their intron/exon like appearance, there were no open reading frames and no consensus splice sites. RT-PCR experiments failed to identify any transcribed sequences. Furthermore there are no direct or inverted repeats and no database matches to LTRs or transposons to account for the pattern of these matches.

These findings show that the homology between the telomeric 15 kb of 4p and many other non-homologous subtelomeric sequences exists as a mosaic of small discontinuous matches. This is in striking contrast to the more centromeric matches between 4p and other chromosomes where similarities are contiguous and extend over tens of kilobases of DNA. To clarify later discussion, we refer to the telomeric 15 kb of 4p as `distal' subtelomeric sequence and the region from 15 to 60 kb as `proximal' subtelomeric sequence.

Sequence characteristics of distal and proximal subtelomeric sequence

We next asked whether any other features might distinguish the distal from the proximal subtelomeric sequence of 4p. We analysed GC content, the frequency of di and tri-nucleotides, CpG islands, the presence of repetitive sequences, and screened DNA and protein databases using BLASTX and BLASTN. The proximal and distal subtelomeric sequence differed in two respects (summarized in Fig. 2 a). First, Alu family repeats are not randomly distributed throughout the sequence; they increase in frequency from 4.2% in the distal telomeric 15 kb to 7.6% in the centromeric subtelomeric sequence and to 10.2% in chromosome unique sequence. Second, distal subtelomeric DNA has a relative enrichment of partially matching ESTs, concentrated between co-ordinates 11 073 and 17 265. However, the genomic sequence contains no ORFs to match the ESTs and RT-PCR analysis failed to detect a transcript in three different tissues examined. By contrast EST matches in the proximal subtelomeric region did correspond to an ORF. The predicted protein includes zinc finger motifs encoded in chromosome unique sequence (see Fig. 2 a and legend).


Figure 2.Sequence organization of the 4p, 16p and yeast telomeres. The scale is in kilobases. A black oval on the left represents the canonical telomere repeats with expressed sequences (black boxes) and ESTs (grey boxes) shown on the black lines. The distribution of Alu repetitive sequences is also shown. `Boundary elements' refers to the internal TTAGGG repeats and putative replication origins. `Telomere matches' refers to sequence matches to our telomere sequence database (shown as grey boxes). (a) The 4p telomere. The 60 kb of continuous sequence match between 4p and 13p, 15p, 21p and 22p is shown as a black line (this includes a 22.5 kb match with 4q). Mosaic matches, indicated by the dotted lines, are found to: 1q, 2p, 2q, 3q, 5q, 6q, 7p, 8p, 8q, 10q, 11q, 12q, 13q, 14q, 15q, 16q, 17q, 18q, 20p and 21q. On 4p, the exons of a zinc finger gene are indicated by black boxes marked ZNF 1. Primers designed from the genomic sequence at 49 358 and 75 874 were used in RT-PCR experiments to generate a product from mRNA from HeLa cells and EBV-transformed B-lymphocytes. The product was cloned, its sequence shown to be identical to genomic and to include zinc finger motifs expressed from an exon in chromosome unique DNA between 72 683 and 77 323 (Accession no. Z96138). A match to the 5' exon of a zinc-finger gene is also found at 114 418-114 556 (marked ZNF 2). However, the genomic sequence provides only a single open reading frame for this putative gene so we were unable to use inter-exonic RT-PCR to confirm its expression. A box marked Wee1-like is probably a pseudo gene as there is no open reading frame co-extensive with the EST matches with Wee1 and RT-PCR analysis revealed no cDNA specific product. (b) Sequence organization of the 16p (allele A) subtelomeric region. Solid lines show uninterrupted matches over 38 kb with 10p, 18p, 9q, Xq and Yq. Mosaic matches (dotted line) with 16p sequence are found on 1p, 2p, 3p, 6p, 8p, 11p, 12p, 13q, 14q, 15q, 16q, 19p, 20p, 21q and 22q. IL9R indicates the exons of an inter-leukin 9 receptor pseudo gene (41). Further details may be found in (13). (c) Sequence organization of the 22q telomere. 40 kb of the cosmid N1G3 are shown (22). Inter-telomere similarities were not assessed by PCR, so sequence matches alone are shown (to 1q, 4p, 4q, 6q, 13q, 16p, 17q, 18p, 19q, 21q). (d) Sequence organization of yeast subtelomeric DNA. As with the human telomeres, a dotted line marks the extent of mosaic matches and a solid line long continuous tracts of significant identity (>90%) between chromosomes. Distal subtelomeric sequence contains no copies or up to four copies of Y' elements (Y'), a junction which is highly variable (J) and a core X element (X). The large black arrow indicates the position of degenerate TTAGGG repeats and a small arrow head the position of an ARS in the core X element.


Figure 3.Sequence alignment of interstitial degenerate telomere repeats in eight human chromosomes. Sequence for the acrocentrics (13p, 14p, 21p and 22p) is from PCR products of monochromosomal hybrids using primers designed from 4p sequence. Sequence from 4q is derived from a YAC containing the 4q telomere. The sequence is oriented in the same direction as Figure 2, i.e. the telomere is at the 5' end of the sequence. In this orientation the canonical telomere repeat is CCCTAA. Note that the similarity between 22q, 16p and the other sequences is restricted to the region containing the repeats.

Finally we looked for features that might mark a boundary between distal and proximal subtelomeric sequences. In particular, given the presence of putative origins of replication in the corresponding regions of yeast subtelomeric sequence, we wanted to know if the same was true for human chromosomes. The sequence of the human origin of replication is unknown, but computer analyses have been used to derive a consensus from previously characterized putative replication origins (16 ). Within the first 60 kb, the only matches to the consensus were at 15 277 and at 19 221 from the telomere (with one mismatch to the consensus) (Table 1 ). We also looked for repeated sequences in the subtelomeric region and found 22 copies of a 6mer between 13 188 and 13 322, which has an overall sequence similarity of 72% to the telomere repeat array (TTAGGG) including a run of three perfect repeats (Fig. 3 ). The internal repeats are in the same orientation as the telomeric sequence and do not have a head to head arrangement; nor are they flanked on the centromeric side by any subtelomeric repeat previously recognized to be immediately adjacent to the telomere of human chromosomes (17 -20 ). This makes it unlikely that they are either the remnant of a fusion of two chromosome ends (21 ) or due to the addition of subtelomeric sequence to a telomere.

Table 1 Matches to putative consensus origin of replication WAWTTDDWWWDHWGWHMAWTT
  Forward match (1 bp mismatch) Reverse match (1 bp mismatch)
 

Distance from telomere sequence Sequence

Distance from telomere sequence Sequence

16p 11 441 aaattttaatgatgtccaaat 12 004 aaatggtatttttttcaaatt
  11 559 caattttatatttgatcattt 21 543 aaatttacattttttcaatca
4p 15 277 aattttttaaaaagaacactt    
22qa 16 378 aattttttttaaagaacactt 32 675 aaaattactttaaaaaaattt
  32 630 aaattataaagtaatacaatt    
aThe 22q telomere is within 5 kb of the end of the sequenced cosmid. The distance given here is the distance from the telomeric end of the cosmid.

Comparison between 4p and 16p

A dot-plot comparison of the 16p and 4p subtelomeric sequence shows only two regions of similarity (data not shown). The most terminal 2400 bp of 4p and the terminal 1130 bp of 16p (allele A) have a similar repeated structure (though previous analyses have shown that this structure does not occur on all 16p alleles). A second region of similarity was found between co-ordinates 9518 and 9914 of 16p, and 13 188 and 13 322 of 4p. Here the 16p sequence contains 58 internal degenerate telomere repeats (TTAGGG) in the same orientation as the telomere, in a similar arrangement to those on 4p (Fig. 3 ). Furthermore, the internal telomere repeats are followed closely by matches to the consensus putative origin of replication (two on one strand, one on the other), between co-ordinates 11 441 and 12 004 (again with one mismatch to the consensus) (Table 1 ).

Remarkably, the internal TTAGGG repeats separate the 16p subtelomeric region into similar distal (first 11 kb) and proximal (11.0-36.8 kb) subtelomeric domains. Using primers from the 16p sequence to analyze telomere YACs and a somatic cell hybrid panel, we found matches to 19 telomeres in the distal subtelomeric sequence with a mosaic distribution, while the proximal subtelomeric sequence contained uninterrupted matches to 9q, 10p, 18p and the pseudo-autosomal region of Xq and Yq. Comparison of 16p sequence with the telomere sequence database revealed matches to five other telomeres in the distal subtelomeric region, one of which was a split match. As with the 4p sequence, distal subtelomeric sequence was characterized by a relative dearth of Alu sequences and a comparative richness of ESTs. No Alu family repeats occur in the distal subtelomeric sequence of 16p, but in the proximal subtelomeric sequence the frequency is 23%. ESTs were concentrated between 4088 and 8026, but none could be shown to be expressed by RT-PCR. These data are summarized in Figure 2 b.


Figure 4.Dot-plot comparison between subtelomeric sequences from the left end of yeast chromosome I (y-axis) and 16p (x-axis). The sequences are oriented so that the telomeres of both chromosomes lie at the top left hand corner of the figure. The dense rectangle in the middle of the figure is the region containing the degenerate interstitial TTAGGG repeats. The scale is in bp.

Comparison between 4p, 16p and 22q

The structural organization of 4p and 16p was compared with that of the 22q telomere. A cosmid that contains subtelomeric sequence from 22q has previously been reported and its telomeric location confirmed by physical mapping (22 ). The 22q terminus is situated <5 kb from the end of this clone which contains 40 kb of subtelomeric DNA. We obtained complete sequence of the cosmid and searched it for ESTs, matches to other telomere sequences and for putative boundary elements. The results are summarized in Figure 2 c.

The 22q subtelomeric region has the same structural organization as 16p and 4p. Again there is a concentration of ESTs and matches to other telomeres in the terminal region followed proximally by internal degenerate TTAGGG repeats. The matches to other chromosomes drops abruptly after the internal TTAGGG repeats: while there are 10 matches to other telomeres distal to the TTAGGG repeats, none are found proximal. Furthermore, as on 16p and 4p, some of the matches to other chromosome ends are split. We have not explored the distribution of matches to other chromosomes by PCR. Preliminary sequence data from cosmids extending from subtelomeric sequence into chromosome unique DNA on 22q (22 ) confirm that internal TTAGGG repeats and matches to other telomeres are restricted to the distal subtelomeric domain.


Figure 5.(a) The number of chromosome ends with sequence similarity to yeast chromosome XV R found in the terminal 22 kb. The locations of distal and proximal subtelomeric sequences and boundary elements (as defined in the text) are shown above the graph. (b) The average percentage sequence divergence relative to the XV R sequence for those ends with sequence similarity.

Again like the 4p and 16p sequence, the 22q subtelomeric sequence contains a match to the consensus putative origin of replication. However rather than lying proximal to the internal repeats (as on 4p and 16p), it is found 1.5 kb distal to the repeats. The match is shown in Table 1 , along with the sequences from 4p and 16p. Note that the 22q and 4p sequences have >95% similarity. All sequences have a single mismatch to the putative consensus. Overall therefore the structural organization of subtelomeric sequence on 22q is the same as 4p and 16p.

A sequence alignment of internal TTAGGG repeats from eight chromosomes is shown in Figure 3 . In addition to sequences from 4p, 16p and 22q, the figure shows sequence obtained by PCR from somatic cell hybrids (chromosomes 13, 15, 21 and 22) and from a 4q YAC. The subtelomeric location of the acrocentric chromosome sequences is inferred from their absence from YACs containing the long arm telomere, although an interstitial location cannot be excluded. As expected, the acrocentric sequences and 4q are >95% identical to 4p. Note that sequences adjacent to the internal TTAGGG repeats (apart from the putative origin of replication) are dissimilar in 22q, 16p and 4p, as shown by dot-plot comparisons.

Comparison between yeast and human subtelomeric structure

To see whether the division of subtelomeric sequences into proximal and distal domains might be a general feature of eukaryotic chromosomes, we examined yeast subtelomeric regions. We performed pairwise comparisons of at least 30 kb of each yeast subtelomeric region and dot-plot comparisons of human and yeast subtelomeric regions. Figure 2 d contains a summary of the conserved features of the yeast subtelomeric region and the extent of matches between chromosome ends. The parallels with human subtelomeric regions are striking.

The yeast telomere consists of TG1-3 repeats. Immediately adjacent, are variable numbers of highly conserved Y' elements that are found at 17 of the 32 ends of the sequenced strain and can account for up to 30 kb of any particular end (23 ). Comparisons between Y' elements on different chromosomes show the same interrupted homologies that we observed in the 4p and 16p distal subtelomeric sequence (6 ). Centromeric to the Y' elements are highly variable short repeats [junction (J) elements in Fig. 2 d], some combination of which is found at most ends. The combination of the Y' elements and junction sequences creates a mosaic of short tracts of homology among all ends. These homologies are analogous to those observed in the human distal subtelomeric region. Y' elements are expressed at meiosis (1 ) and are therefore yeast ESTs which may be equivalent to those found at human telomeres.

Every chromosome end has a core X element centromeric to the Y' and J elements. Within the X element, at its border with the J sequences, is an array of degenerate TTAGGG repeats, the sequence of the vertebrate canonical telomere sequence, rather than to the yeast telomere sequence (TG1-3 repeats). Twenty-nine yeast telomeres contain at least one perfect copy of TTAGGG in the X element. Dot-plot comparisons reveal degenerate arrays in this vicinity at all yeast telomeres. Figure 4 shows a dot-plot comparison between the left end of yeast chromosome 1 and 16p. The repeats are in the same orientation as the actual yeast telomere and are followed proximally by an ARS element. The TTAGGG repeats and ARS element constitute the boundary between yeast distal and proximal subtelomeric sequences.

On the centromeric side of core X there are larger (6-30 kb) contiguous blocks of homology (>90%) shared by fewer ends, usually just two to three. These larger, less dispersed subtelomeric repeats are analogous to the proximal subtelomeric sequence observed in human chromosomes. Thus the general structure of yeast subtelomeric regions closely resembles that of the human subtelomeric sequences.


Figure 6.Organization of subtelomeric sequence. Four regions are shown with the telomeric repeats at the top of the figure. Rearrangements between non-homologous chromosomes occur in the proximal subtelomeric sequence (dotted lines), while sequence exchange of a different form occurs in the distal subtelomeric sequence. The figure shows DNA loops from one chromosome interacting with another (see arrow). Sequence exchange at the base of the loops may explain the interrupted matches found in sequence comparisons. We propose that the internal TTAGGG repeats are part of a barrier to sequence exchange between proximal and distal subtelomeric domains.

DISCUSSION

We have shown that there are conserved structural features between yeast and human subtelomeric regions. In both human and yeast a mosaic pattern of matches to many other chromosomes lies immediately adjacent to a discontinuous region of longer uninterrupted matches to a few chromosome ends. Between these two domains are blocks of degenerate TTAGGG repeats and sequences with homology to putative origins of replication. It is particularly noteworthy that the consensus sequence of vertebrate telomeres (TTAGGG) is present in yeast as a putative boundary between distal and proximal subtelomeric sequences.

Although we have not proven that the structural organization of 16p, 4p and 22q is common to all human chromosome ends, a combination of sequence data and PCR analyses make it likely that this is so. PCR analysis indicates that the structure of 4q, 13p, 15p, 21p and 22p is very similar to 4p and that the structure of 9q, 10p, 18p and XqYq is like that of 16p. Furthermore, complete sequence of the 4q and 10q subtelomeric regions confirms the 4p and 4q similarity and shows that 10q has the same structural features as 4q (Jane Hewitt, personal communication; the 4q sequence is available: DDBJ/EMBL/GenBank accession no. U74496).

The sequence comparisons described here suggest that the distal and proximal sub-domains do not frequently interact with each other and furthermore that they may interact differently with other non homologous chromosomes. The pattern of sequence similarities described in this paper cannot be attributed to random exchange processes for a number of reasons.

First, the consequence of simple recombination homogenization would be that all ends with proximal subtelomeric similarities should also share distal similarities. If the process of sequence exchange simply involved occasional unconstrained swapping of chromosome ends, sequence similarities between chromosomes would be seen as a continuous gradient with the greatest number of shared sequences at the distal ends and fewer at the proximal ends. In fact the number of yeast and human chromosome ends sharing homologies with a specific end is approximately constant up to the putative boundary region, and then drops sharply. Figures 5 a and 1 show the number of yeast ends with similarity to yeast chromosome XV R and the number of human ends with similarity to 4p (as assessed by PCR) plotted as a function of distance from the telomere. 16p and 22q show the same pattern as 4p, with an abrupt fall in the number of matches to other chromosome ends proximal to the internal TTAGGG repeats.

Second, if sequence similarities were a function of a decreasing level of exchange with increasing distance from the telomere, then sequence divergence should reflect this gradient. Remarkably, in yeast, the average sequence divergence actually peaks at the boundary region (the core X element) with a sharp drop to near identity on either side. Figure 5 b shows that there is an average 10.5% divergence for the 31 other ends relative to the XV R X element. On either side the divergence is 0.1%, gradually increasing to 2.5-4% as distance away from X increases. It seems that recombinational homogenization occurs preferentially either side of the boundary region, which itself may be a barrier to such processes.

Third, unconstrained sequence exchange cannot explain the presence of an identical sequence motif (TTAGGG1-3) in yeast and human chromosomes. In yeast the TTAGGG motif is a binding site for TBF1, the function of which is unknown (11 ,24 ). Core X also contains an Abf1p binding site, an essential gene that is involved both in transcriptional regulation and replication (12 ). It is possible that the human subtelomeric region also contains unrecognized protein binding sites. The detection of the putative consensus for an origin of replication is suggestive in this respect.

Fourth, the mechanisms of sequence homogenization appear different on either side of the putative boundary. Interrupted matches are restricted to the distal human sub-telomeric region and are unlike those produced by known mechanisms of sequence homogenization. Indeed nothing similar has been reported in analysis of meiotic recombination hotspots (25 ) nor can retroelements (of either long terminal repeat or poly-A subtypes) explain the pattern of matches observed. While retro-elements may incur 5' and 3' truncations, they are not known to produce split matches of the sort described in the human subtelomeric regions (26 -28 ). Similarly, in yeast, the distribution of many short, interrupted and polymorphic matches (6 ) is inconsistent with the action of a simple homogenization process (23 ).

By contrast, sequence exchange in the proximal region seems to be accounted for by conventional recombination processes as evidenced by well characterized rearrangements in a variety of species including yeast (1 ), human (29 ) and malaria (30 ). The observation of the action of different processes in the two subtelomeric domains argues against the action of random sequence exchange processes.

Therefore, it appears from our comparison of the human (4p, 16p and 22q) sequences with yeast chromosomes that degenerate interstitial TTAGGG sequences and a consensus sequence for putative origins of replication mark a boundary between proximal and distal subtelomeric domains. At present the nature and role, if any, of the boundary are not clear. It is possible that this region sub-compartmentalizes the distal and proximal subtelomeric domains in the nucleus limiting the extent of their interactions with other non-homologous chromosomes, and determining the nature of their interaction via the proteins with which they are sequestered. This hypothesis is supported by preliminary data showing that the X element is a barrier to recombination: deletion of the X element results in increased exchange between the distal and more proximal sequences (F.E. Pryde, T.C. Huckle and E.J. Louis, unpublished data). A model to explain our findings is given in Figure 6 . Further analyses will be necessary to understand the mechanisms underlying the striking compartmentalization of subtelomeric regions from such widely divergent species.

MATERIALS AND METHODS

Contig assembly and sequence determination of the 4p and other telomeres

The 4p telomere has previously been cloned into a YAC (Y88BT) and partially subcloned into bacteriophage vectors ([lambda]A, [lambda]14, [lambda]18 [lambda]N, [lambda]53) (Fig. 1 ) (15 ). The terminal 8 kb were obtained by digesting the total YAC DNA with BAL31, ligating to SmaI digested Sup F plasmid pSD followed by partial digestion with EcoRI, ligation into the lambda bacteriophage vector EMBL3A and suppressor selection on MC1061/p3 (31 ). The library was screened with the pHutel probe (a gift from Dr Sally Cross) and 11 positive clones isolated. Restriction analysis showed that clone 12.3 contained the terminal 8 kb of the YAC which was subcloned into bluescript: P6 (terminal 6kb BamHI fragment) and P2 (adjacent BamHI/EcoRI fragment). PCR analysis showed that P6 and P2 were contiguous. To clone the region between the plasmid P2 and bacteriophage [lambda]A an EMBL3A bacteriophage library constructed from an MboI partial digest of Y88BT was screened with probes from P2 and [lambda]A. The phage 4PTEL1 was thus isolated. A gap between [lambda]N and [lambda]53 was closed by direct sequencing of PCR products from primers designed from the end of each bacteriophage. The sequenced contig also included the cosmid B31 (32 ). All clones were sequenced by an M13-based shotgun strategy as previously described (33 ). The 16p telomere sequence has been described previously (13 ). To obtain sequence from other telomeres, cosmid libraries were constructed from MboI partial digests of 30 YACs containing human telomeres. Cosmid DNA from each YAC was pooled, sonicated and a 1-2 kb fraction cloned into M13. Both ends of ~96 M13 clones were sequenced from each cosmid library. Sequence from the 22q cosmid was also obtained by a random shotgun strategy and is available electronically from http://www.genome.ou.edu. The cosmid DNA was isolated free from Escherichia coli host contamination by the cleared lysate, diatomacious earth-based procedure (34 ) and its sequence was determined at a level of 4.5-fold redundancy via a double-stranded, shotgun-based approach (35 ) using the ABI PRISIM fluorescent-labeled terminators and either forward or reverse universal primers. Sequencing vector regions were removed from the individual sequence reads and the resulting sequences were assembled into contiguous fragments initially using the TED and XGAP programs (36 ) and more recently using the Phred, Phrap, Consed programs (B.Ewing, D.Gordon and P.Green, http://www.genome.washington.edu/UWGC). The individual contigs were joined into a final, unique sequence using custom, synthetic primers and Taq DNA polymerase cycle sequencing with fluorescent terminators.

DNA/RNA sources and analysis

Genomic DNA was extracted from EBV-transformed cell lines by standard procedures. cDNA was prepared from HeLa, fibroblast and EBV-transformed cell lines by RT-PCR as described in (37 ). Northern and Southern blots were performed as described in (38 ). A mono-chromosomal somatic cell hybrid panel was acquired from the UK HGMP resource centre. The sequences of primers and PCR conditions are available from J.Flint (jf{at}worf.molbiol.ox.ac.uk).

Data analysis

After excluding Alu and other repetitive DNA, sequences were screened against dbEST and EMBL with BLASTN, and against a non-redundant compilation of Swissprot, PIR and wormpep (Caenorhabditis elegans genes) with BLASTX. BLAST output was filtered using MSPcrunch (39 ), requiring a minimum of 90% identity for dbEST and EMBL matches. Sequence was viewed from within an ACEDB database. BLASTN/MSPcrunch was also used to identify sequence matches between telomeres. Yeast telomere sequences were obtained during the yeast genome sequencing project and additional sequences for making the subtelomeric contigs from each end were obtained from the ftp site at MIPS (Martinsreid Institute of Protein Sequences). These were compared against each other in pairwise fashion using FASTA from the GCG package (40 ). Significant homologies were then aligned using MegAlign from the DNASTAR(TM) Lasergene software package.

ACKNOWLEDGEMENTS

This work was supported by the Wellcome Trust, the European Union sequencing project and the National Human Genome Research Institute at the NIH. We thank Dr J.Hancock for help in sequence analysis and Rhona Borts for commenting on the manuscript, and David Weatherall for support and encouragement.

REFERENCES

1 Louis,E.J. (1995) The chromosome ends of Saccharomyces cerevisiae. Yeast, 11, 1553-1573.

2 Kipling,D. (1995) The Telomere. Oxford University Press, Oxford.

3 Wilkie,A.O.M., Lamb,J., Harris,P.C., Finney,R.D. and Higgs,D.R. (1990) A truncated chromosome 16 associated with [alpha] thalassaemia is stablised by the addition of telomeric repeats (TTAGGG)n. Nature, 346, 868-871.

4 Murray,A.W. and Szostak,J.W. (1983) Construction of artificial chromosomes in yeast. Nature, 305, 189-193. MEDLINE Abstract

5 Louis,E.J. and Haber,J.E. (1990) The subtelomeric Y' repeat family in Saccharomyces cerevisiae: an experimental system for repeated sequence evolution. Genetics, 124, 533-545.

6 Louis,E.J. and Haber,J.E. (1992) The structure and evolution of subtelomeric Y' repeats in Saccharomyces cerevisiae. Genetics, 131, 559-574.

7 Louis,E.J. and Haber,J.E. (1990) Mitotic recombination among subtelomeric Y' elements in Saccharomyces cerevisiae. Genetics, 124, 547-559.

8 Louis,E. and Haber,J.E. (1991) Evolutionary recent transfer of a group I mitochondrial intron to telomere regions in Saccharomyces cerevesiae. Current Genet., 20, 411-415.

9 Carlson,M., Celenza,J.L. and Eng, F.S. (1985) Evolution of the dispersed SVC gene family of Saccharomyces by rearrangements of chromosome telomeres. Mol. Cell. Biol., 5, 2894-2900.

10 De Steensma,H.Y., De Jonge,P., Kaptein,A. and Kaback,D.B. (1989) Molecular cloning of chromosome 1 DNA from Saccharomyces cerevisiae: localization of a repeated sequence containing an acid phosphatase gene near a telomere of chromosome I and chromosome VIII. Current Genet., 16, 131-137.

11 Liu,Z.P. and Tye,B.K. (1991) A yeast protein that binds to vertebrate telomeres and conserved yeast telomeric junctions. Genes Dev., 5, 49-59. MEDLINE Abstract

12 Brand,A.H., Micklem,G. and Nasmyth,K. (1987) A yeast silencer contains sequences that can promote autonomous plasmid replication and transcriptional activation. Cell, 51, 709-719. MEDLINE Abstract

13 Flint,J., Thomas,K., Micklem,G., Raynham,H., Clark,K., Doggett,N., King,A. and Higgs,D.R. (1997) The relationship between chromosome structure and function at a human telomeric region. Nature Genet., 15, 252-257. MEDLINE Abstract

14 National Institutes of Health, Institute of Molecular Medicine Collaboration, Ning,Y., Roschke,A., Smith,A.C., Macha,M., Precht,K., Riethman,H., Ledbetter,D., Flint,J., Horsley,S., Regan,R., Kearney,K., Knight,S., Kvaloy,K. and Brown,W.R.A. (1996) A complete set of human telomeric probes and their clinical application. Nature Genet., 14, 86-89.

15 Youngman,S., Bates,G., Williams,S., McClatchey,A.I., Baxendale,S., Sedlacek,Z., Altherr,M., Wasmuth,J.J., MacDonald,M.E.,Gusella,J.F., Sheer,D. and Lehrach,H. (1992) The telomeric 60 kb of chromosome arm 4p is homologous to telomeric regions on 13p, 15p, 21p and 22p. Genomics, 14, 350-356. MEDLINE Abstract

16 Dobbs,D.L., Shaiu,W.-L. and Benbow,R.M. (1994) Modular sequence elements associated with origin regions in eukaryotic chromosomal DNA. Nucleic Acids Res., 22, 2479-2489. MEDLINE Abstract

17 Brown,W.R.A., MacKinnon,P.J., Villasant,A., Spurr,N., Buckle,V.J. and Dodson,M.J. (1990) Structure and polymorphism of human telomere-associated DNA. Cell, 63, 119-132.

18 Weber,B., Collins,C., Robbins,C., Magenis,R.E., Delaney,A.D., Gray,J.W. and Hayden,M.R. (1990) Characterization and organization of DNA sequences adjacent to the human telomere associated repeat (TTAGGG)n. Nucleic Acids Res., 18, 3353-3361. MEDLINE Abstract

19 Royle,N.J., Hill,M.C. and Jeffreys,A.J. (1992) Isolation of telomere junction fragments by anchored polymerase chain reaction. Philos. Trans. Roy. Soc., Series B. 247, 57-61.

20 Rouyer, F., de la Chapelle, A. and Weissenbach, J. (1990) An interspersed repeated sequence specific for human subtelomeric regions. EMBO J., 9, 505-514. MEDLINE Abstract

21 Ijdo,J.W., Baldini,A., Ward,D.C., Reeders,S.T. and Wells,R.A. (1991) Origin of human chromosome 2: An ancestral telomere-telomere fusion. Proc. Natl. Acad. Sci. USA, 88, 9051-9055. MEDLINE Abstract

22 Wong,A.C.C., Ning,Y., Flint,J., Clark,K., Dumanski,J.P., Ledbetter,D.H. and McDermid,H.E. (1997) Molecular characterization of a 130-kb terminal microdeletion in a child with mild mental retardation. Am. J. Hum. Genet., 60, 113-120.

23 Louis,E.J., Naumova,E.S., Lee,A., Naumov,G. and Haber,J.E. (1994) The chromosome end in yeast: Its mosaic nature and influence on recombinational dynamics. Genetics, 136, 788-802.

24 Brigati,C., Kurtz,S., Balderes,D., Vidali,G. and Shore,D. (1993) An essential yeast gene encoding a TTAGGG repeat-binding protein. Mol. Cell. Biol., 13, 1306-1314. MEDLINE Abstract

25 Lichten,M. and Goldman,A.S.H. (1995) Meiotic recombination hotspots. Annu. Rev. Genet., 29, 423-444. MEDLINE Abstract

26 Varmus,H., Hughes,S. and Coffin,J. (eds) (1996) Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

27 Gabriel,A., Willems,M., Mules,E.H. and Boeke,J.D. (1996) Replication infidelity during a single cycle of Ty1 retrotransposition. Proc. Natl. Acad. Sci. USA, 93, 7767-7771. MEDLINE Abstract

28 Moran,J.V., Holmes,S.E., Naas,T.P., DeBerardinis,R.J., Boeke,J.D. and Kazazian,H.H. (1996) High frequency retrotransposition in cultured mammalian cells. Cell, 87, 917-927. MEDLINE Abstract

29 Wilkie,A.O.M., Higgs,D.R., Rack,K.A., Buckle,V.J., Spurr,N.K., Fischel-Ghodsian,N., Ceccherini,I., Brown,W.R.A. and Harris,P.C. (1991) Stable length polymorphism of up to 260 kb at the tip of the short arm of human chromosome 16. Cell, 64, 595-606.

30 Corcoran,J.C., Thompson,J.K., Walliker,D. and Kemp,D.J. (1988) Homolgous recombination with subtelomeric repeat sequences generates chromosome size polymorphisms in Plasmodium falciparum. Cell, 53, 807-813.

31 Pohl,T.M., Zimmer,M., MacDonald,M.E., Smith,B., Bucan,M., Poustka,A., Volinia,S., Searle,S., Zehetner,G., Wasmuth,J.J., Gusella,J., Lehrach, H. and Frischauf,A.-M. (1988) Construction of a NotI linking library and isolation of new markers close to the Huntington's disease gene. Nucleic Acids Res., 16, 9185-9198.

32 Bates,G.P., MacDonald,M.E., Baxendale,S., Youngman,S., Lin,C., Whaley,W.L.,Wasmuth,J.J., Gusella,J.F. and Lehrach,H. (1991) Defined physical limits of the Huntington disease gene candidate region. Am. J. Hum. Genet., 49, 7-16. MEDLINE Abstract

33 Wilson,R., Ainscough,R., Anderson,K., Baynes,C., Berks,M., Bonfield,J., Burton,J., Connell,M., Copsey,T., Cooper,J., Coulson,A., Craxton,M., Dear,S., Du,Z., Durbin,R., Favello,A., Fraser,A., Fulton,L., Gardner,A., Green,P., Hawkins,T., Hillier,L., Jier,M., Johnston,L., Jones,M., Kershaw,J., Kirsten,J., Laisster,N., Latrelle,P., Lightning,J., Lloyd,C., Mortimore,B., O'Callaghan,M., Parsons,J., Percy,C., Rifken,L., Roopra,A., Saunders,D., R., S., Sims,M., Smaldon,N., Smith,A., Smith,M., Sonnhammer,E., Staden,R., Sulston,J., Thierry-Mieg,J., Thomas, K., Vaudin,M., Vaughan,K., Waterston,R., Watson, A., Weinstock,L., Wilkinson-Sproat,J. and Wohidman,P. (1994) 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature, 368, 32-36. MEDLINE Abstract

34 Pan,H.Q., Wang,Y.P., Chissoe,S.L., Bodenteich,A., Wang,Z., Iyer,K., Clifton,S.W., Crabtree, J.S. and Roe,B.A. (1994) The complete nucleotide sequences of the pSacBII P1 cloning vector and three cosmid cloning vectors: pTCF, svPHEP, and LAWRIST16. Genet. Anal. Techniq. Appl., 11, 181-186.

35 Bodenteich,A., Chissoe,S., Wang,Y.F. and Roe,B.A. (1994) In Adams,M.D., Fields,C. and Venter,J.C. (eds) Automated DNA Sequencing and Analysis Techniques. Academic Press, London. pp. 42-50.

36 Dear,S. and Staden,R. (1991) A sequence assembly and editing program for efficient management of large scale DNA sequencing projects. Nucleic Acids Res., 19, 3907-3911. MEDLINE Abstract

37 Brown,C.J., Flenniken,A.M., Williams,B.R.G. and Willard,H.F. (1990) X chromosome inactivation of the human TIMP gene. Nucleic Acids Res., 18, 4191-4195. MEDLINE Abstract

38 Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

39 Sonnhammer,E. and Durbin,R. (1994) An expert system for processing sequence homology data. Proc. Int. Soc. Mol. Biol., 94, 363-368.

40 Genetics Computer Group (1994) Program Manual for the Wisconsin Package, Version 8., 575 Science Drive, Madison, USA 53711, Wisconsin.

41 Kermouni,A., Van Roost,E., Arden,K.C., Vermeesch,J.R., Weiss,S., Godelaine,D., Flint,J., Lurquin,C., Szikora,J.P., Higgs,D.R. et al. (1995) The IL-9 receptor gene (IL9R): genomic structure, chromosomal localization in the pseudoautosomal region of the long arm of the sex chromosomes, and identification of IL9R pseudogenes at 9qter, 10pter, 16pter, and 18pter. Genomics, 29, 371-382. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +44 1865 222631; Fax: +44 1865 222500; Email: jf@worf.molbiol.ox.ac.uk

-->
This page is maintained by OUP admin. Last updated Tue Jul 15 11:13:42 BST 1997. Part of the OUP Journals World Wide Web service. Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GeneticsHome page
M. E. Marvin, C. D. Griffin, D. E. Eyre, D. B. H. Barton, and E. J. Louis
In Saccharomyces cerevisiae, yKu and Subtelomeric Core X Sequences Repress Homologous Recombination Near Telomeres as Part of the Same Pathway
Genetics, October 1, 2009; 183(2): 441 - 451.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. A. Yatsenko, E. K. Brundage, E. K. Roney, S. W. Cheung, A. C. Chinault, and J. R. Lupski
Molecular mechanisms for subtelomeric rearrangements associated with the 9q34.3 microdeletion syndrome
Hum. Mol. Genet., June 1, 2009; 18(11): 1924 - 1936.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. A. Anderson, Y. S. Song, and C. H. Langley
Molecular Population Genetics of Drosophila Subtelomeric DNA
Genetics, January 1, 2008; 178(1): 477 - 487.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Rehmeyer, W. Li, M. Kusaba, Y.-S. Kim, D. Brown, C. Staben, R. Dean, and M. Farman
Organization of chromosome ends in the rice blast fungus, Magnaporthe oryzae
Nucleic Acids Res., October 18, 2006; 34(17): 4685 - 4701.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
H.-F. Kuo, K. M. Olsen, and E. J. Richards
Natural Variation in a Subtelomeric Region of Arabidopsis: Implications for the Genomic Dynamics of a Chromosome End
Genetics, May 1, 2006; 173(1): 401 - 417.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
H. Riethman, A. Ambrosini, C. Castaneda, J. Finklestein, X.-L. Hu, U. Mudunuri, S. Paul, and J. Wei
Mapping and Initial Analysis of Human Subtelomeric Sequence Assemblies
Genome Res., January 1, 2004; 14(1): 18 - 28.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
W. Yu, B. C. Ballif, C. D. Kashork, H. A. Heilstedt, L. A. Howard, W.-W. Cai, L. D. White, W. Liu, A. L. Beaudet, B. A. Bejjani, et al.
Development of a comparative genomic hybridization microarray and demonstration of its utility with 25 well-characterized 1p36 deletions
Hum. Mol. Genet., September 1, 2003; 12(17): 2145 - 2152.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. E. Lowell, A. I. Roughton, V. Lundblad, and L. Pillus
Telomerase-Independent Proliferation Is Influenced by Cell Type in Saccharomyces cerevisiae
Genetics, July 1, 2003; 164(3): 909 - 921.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Y. Ning, J.-f. Xu, Y. Li, L. Chavez, H. C. Riethman, P. M. Lansdorp, and N.-p. Weng
Telomere length and the expression of natural telomeric genes in human fibroblasts
Hum. Mol. Genet., June 1, 2003; 12(11): 1329 - 1336.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
H. RIETHMAN, A. AMBROSINI, C. CASTANEDA, J.M. FINKLESTEIN, X.-L. HU, S. PAUL, and J. WEI
Human Subtelomeric DNA
Cold Spring Harb Symp Quant Biol, January 1, 2003; 68(0): 39 - 48.
[Abstract] [PDF]


Home page
Genome ResHome page
H. Der-Sarkissian, G. Vergnaud, Y.-M. Borde, G. Thomas, and J.-A. Londono-Vallejo
Segmental Polymorphisms in the Proterminal Regions of a Subset of Human Chromosomes
Genome Res., November 1, 2002; 12(11): 1673 - 1678.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. Linardopoulou, H. C. Mefford, O. Nguyen, C. Friedman, G. van den Engh, D. G. Farwell, M. Coltrera, and B. J. Trask
Transcriptional activity of multiple copies of a subtelomerically located olfactory receptor gene that is polymorphic in number and location
Hum. Mol. Genet., October 1, 2001; 10(21): 2373 - 2383.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. A. Londono-Vallejo, H. DerSarkissian, L. Cazes, and G. Thomas
Differences in telomere length between homologous chromosomes in humans
Nucleic Acids Res., August 1, 2001; 29(15): 3164 - 3171.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
P. G.M. v. Overveld, R. J.F.L. Lemmers, G. Deidda, L. Sandkuijl, G. W. Padberg, R. R. Frants, and S. M. van der Maarel
Interchromosomal repeat array interactions between chromosomes 4 and 10: a model for subtelomeric plasticity
Hum. Mol. Genet., November 1, 2000; 9(19): 2879 - 2884.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S. J L Knight and J. Flint
Perfect endings: a review of subtelomeric probes and their use in clinical diagnosis
J. Med. Genet., June 1, 2000; 37(6): 401 - 409.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Ofir, A. C. C. Wong, H. E. McDermid, K. L. Skorecki, and S. Selig
Position effect of human telomeric repeats on replication timing
PNAS, September 28, 1999; 96(20): 11434 - 11439.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Coleman, D. M. Baird, and N. J. Royle
The plasticity of human telomeres demonstrated by a hypervariable telomere repeat array that is located on some copies of 16p and 16q
Hum. Mol. Genet., September 1, 1999; 8(9): 1637 - 1646.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
C. M. Lese, J. A. Fantes, H. C. Riethman, and D. H. Ledbetter
Characterization of Physical Gap Sizes at Human Telomeres
Genome Res., September 1, 1999; 9(9): 888 - 894.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. J. Britten
Precise sequence complementarity between yeast chromosome ends and two classes of just-subtelomeric sequences
PNAS, May 26, 1998; 95(11): 5906 - 5912.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. A. Henning, N. Moskowitz, M. A. Ashlock, and P. P. Liu
Humanizing the yeast telomerase template
PNAS, May 12, 1998; 95(10): 5667 - 5671.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
H. Riethman
Closing in on Telomeric Closure
Genome Res., September 1, 1997; 7(9): 853 - 855.
[Full Text] [PDF]


Home page
Genome ResHome page
M. Rosenberg, L. Hui, J. Ma, H. C. Nusbaum, K. Clark, L. Robinson, L. Dziadzio, P. M. Swain, T. Keith, T. J. Hudson, et al.
Characterization of Short Tandem Repeats from Thirty-One Human Telomeres
Genome Res., September 1, 1997; 7(9): 917 - 923.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (76)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Flint, J.
Right arrow Articles by Louis, E. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Flint, J.
Right arrow Articles by Louis, E. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?