Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (59)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Watnick, T. J.
Right arrow Articles by Germino, G. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watnick, T. J.
Right arrow Articles by Germino, G. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1473-1481


An unusual pattern of mutation in the duplicated portion of PKD1 is revealed by use of a novel strategy for mutation detection
Introduction
Results
Discussion
Materials And Methods
   Patient recruitment
   Long-range PCR
   Heteroduplex analysis
   Southern blots
Acknowledgements
References


An unusual pattern of mutation in the duplicated portion of PKD1 is revealed by use of a novel strategy for mutation detection

An unusual pattern of mutation in the duplicated portion of PKD1 is revealed by use of a novel strategy for mutation detection Terry J. Watnick1, Klaus B. Piontek1, Teresa M. Cordal2, Horst Weber3, Michael A. Gandolph1, Feng Qian1, Xose M. Lens2, Hartmut P. H. Neumann3 and Gregory G. Germino1,*

1Department of Medicine, Division of Nephrology, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA, 2Servicio de Nefroloxia, Hospital Xeral de Galicia Clinico Universitario, Santiago de Compostela, 15705, Spain and 3Medizinische Klinik, Albert-Ludwigs-Universitat, Freiburg, D-7800, Germany

Received March 25, 1997; Revised and Accepted June 13, 1997

The gene for the most common and severe form of autosomal dominant polycystic kidney disease, PKD1, encodes a 14 kb mRNA that is predicted to result in an integral membrane protein of 4302 amino acids. The major challenge faced by researchers attempting to complete mutation analysis of the PKD1 gene has been the presence of several homologous loci also located on chromosome 16. Because the sequence of PKD1 and its homologs is nearly identical in the 5' region of the gene, most traditional approaches to mutation analysis cannot distinguish sequence variants occurring uniquely in PKD1. Therefore, only a small number of mutations have been identified to date and these have all been found in the 3', unique portion of the gene. In order to begin analysis of the duplicated region of PKD1, we have devised a novel strategy that depends on long-range PCR and a single gene-specific primer from the unique region of the gene to amplify a PKD1-specific template that spans exons 23-34. This 10 kb template, amplified from genomic DNA, can be employed for mutation analysis using a wide variety of sequence-based approaches. We have used our long-range PCR strategy to begin screening for sequence variants with heteroduplex analysis, and several affected individuals were discovered to have clusters of base pair substitutions in exons 23 and 25. In two patients, these changes, identified in exon 23, would be predicted to result in multiple amino acid substitutions in a short stretch of the protein. This clustering of base pair substitutions is unusual and suggests that mutation may result from unique structural features of the PKD1 gene.

INTRODUCTION

Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common inherited disorders in humans, with an incidence of 1:1000. The disease is characterized by the progressive replacement of renal parenchyma by gradually enlarging cysts. Approximately 50% of affected individuals develop renal failure and these patients comprise ~4-5% of the dialysis population in the United States. Although most affected individuals come to medical attention because of renal disease, ADPKD is a systemic condition with a number of other associated manifestations, including hepatic cysts, cerebral aneurysms and cardiac valvular abnormalities (1 ).

The gene for the most common and severe form of ADPKD, PKD1, extends over ~50 kb of genomic DNA and contains 46 exons that encode a 14 kb mRNA (Fig. 1 ) (2 -5 ). Polycystin, the PKD1 gene product, is predicted to be an integral membrane protein of 4302 amino acids that is thought to be involved in cell-cell or cell-matrix interactions. Despite intense screening by many groups, only a small number of mutations have been reported (2 ,6 -12 ), and little is known concerning how different mutations within the gene might play a role in generating observed differences in clinical profile.


Figure 1.The genomic structure of the PKD1 gene is depicted, including its 46 exons, unique protein domains and an unusual ~2.5 kb polypyrimidine tract in intron 21. Approximately 70% of the gene is duplicated in several copies elsewhere on chromosome 16 (stippled box). The relative position of primers used to amplify PKD1-specific templates (3'LR) is shown, along with the location of other PCR products (EJ2) and probes (pL1-4) used (see text). The black rectangle in intron 21 represents the 2.5 kb polypyrimidine tract.

The largest obstacle faced by researchers in completing this genetic analysis for PKD1 has been distinguishingit from a family of homologs that map elsewhere on chromosome 16 (2 ,13 ). Approximately 70% of this gene, beginning with its 5' end, is duplicated in at least three other loci located more proximally on chromosome 16 (Fig. 1 ). The sequence identity is >95% in the region of similarity. Consequently, almost all of the reported mutations since the gene's identification in 1994 have been clustered in the single copy region of the gene which is amenable to study (2 ,6 -12 ). Some authors have estimated that ~85% of mutations in PKD1 may be point mutations in the 5' duplicated region of the gene (8 ). This area of the gene is predicted to encode the large extracellular amino-terminus which includes two leucine-rich repeats, domains with homology to c-type lectin and LDL-A among others. Each structural unit may have a unique role in regulating cell-cell or cell-matrix interactions and, therefore, it is conceivable that mutations in particular domains could result in distinct phenotypes. Any approach that is developed for comprehensive mutation detection in this region of the gene, however, will require locus-specific reagents that will distinguish PKD1 from its homologs.

We have developed a strategy that employs long-range PCR of genomic DNA to study exons that lie in the duplicated region of PKD1. The approach uses one PKD1 gene-specific primer as an anchor, in combination with a primer from the duplicated portion of the gene, to amplify a 10 kb template that includes exons 23-34. We have used a series of control reactions to demonstrate that the template is PKD1-specific and that it can be used to amplify nested, gene-specific fragments for mutation analysis if diluted appropriately. Our method is easy, reproducible and requires only one long-range reaction to analyze all of the exons within the template. Using this strategy, we have begun screening affected individuals and have identified several novel sequence variants in exons 23-25.

RESULTS

The duplicated portion of PKD1 begins with exon 1 and ends in the vicinity of a BamHI restriction site at genomic position 44 621 (accession No. L39891) in intron 34 (Fig. 1 , stippled box) (2 ,5 ). We initially searched for locus-specific sequences that could be used to design primer pairs for each PKD1 exon. This strategy was unsuccessful because we could not find a sufficient number of locus-specific primer pairs (data not shown). As an alternative approach, we reasoned that one could utilize long-range PCR methods to generate locus-specific templates using a single PKD1-specific primer in combination with a suitably designed primer from the duplicated portion of the gene. We tested this strategy using a primer complementary to sequence in the 3' single copy segment of the gene with primers positioned at various 5' locations. Attempts to amplify fragments >10 kb were unsuccessful due to the very long polypyrimidine tracts located in introns 21 and 22. However, robust amplification could be achieved using a primer positioned in intron 22 (TWF1) in combination with either KG8R25 or KG8R5 (Fig. 1 ). KG8R25 is positioned ~2700 bp 3' of the BamHI restriction site while KG8R5 is located in exon 38. Products of ~10 kb spanning exons 23-34 or 23-38 (3'LR) were generated using genomic DNA as template. Genomic DNA prepared using phenol-chloroform extraction did not yield a PCR product as reliably as did DNA prepared using other protocols.

Two cell lines were used to demonstrate the specificity of the long-range PCR reaction (Fig. 2 ). The radiation hybrid, 145.19, contains a small (~3 Mb) segment of chromosome 16p13.3 which includes PKD1 but lacks the homologs (2 ,14 ). The rodent-human somatic cell hybrid, N23HA, contains most of chromosome 16 including the homologs, but lacks 16p13.3 (2 ,15 ). 3'LR (TWF1-KG8R25) can be amplified from genomic DNA of 145.19 and from total human genomic DNA but not from N23HA. Several control reactions were performed to confirm that the selective amplification of 3'LR was not due to problems with the N23HA template. The addition of an equal quantity of N23HA to genomic DNA did not inhibit amplification of 3'LR (data not shown). The same preparation of N23HA, however, could be used successfully as template for other long-range PCR products (>7 kb, data not shown).


Figure 2. 3'LR is PKD1-specific. It can be amplified from genomic DNAof an unaffected individual (lane 1) and 145.19 (lane 2) but not from the cell line N23HA (lane 3). Lane M contains the 1 kb ladder (Gibco). The 3'LR, that is 9662 bp in length, is migrating with the largest size markers that are not well resolved under these conditions.

The PKD1-specific templates can be used for any genome-based mutation screening strategy. In one application, PKD1-specific templates can be used to screen for small intragenic deletions, insertions or mutations that alter restriction sites or to resolve polymorphisms detected in the duplicated region of PKD1. Figure 3 A illustrates one example. It shows a Southern blot of PstI-digested genomic DNA of fiveaffected individuals and one unaffected control sample probed with a radiolabeled cDNA fragment of PKD1 (pL1-4). This fragment spans exons 26-28 and thus is included within 3'LR (Fig. 1 ). Differences are evident but it cannot be determined if the PKD1 locus is the source of the observed variability. Figure 3 B shows the PstI restriction pattern of 3'LR generated from the same individuals that had variability in Figure 3 A. Using this method, no differences are detected. A Southern blot of this digest, probed with pL1-4, also failed to detect the original polymorphic bands (data not shown). Clearly the differences detected by pL1-4 in the original genomic Southern are due to sequence variation involving the homologous loci.


Figure 3. PKD1-specific templates can be used to resolve polymorphisms in the duplicated region of the gene detected by Southern blot analysis. (A) Southern blot of PstI-digested genomic DNA from five ADPKD patients (lanes 2-6) and one unaffected control (lane 1) probed with a 5'-radiolabeled cDNA fragment, pL1-4 (Fig. 1). Differences are evident in lanes 3-6. (B) Ethidium bromide-stained agarose gel of 3'LR products digested with PstI. The products in lanes 3-6 were amplified using the same DNA samples as used for lanes 3-6 of (A) as template. Samples from an unaffected (lane 1) and affected individual (lane 2) which showed no variability with pL1-4 by Southern blot analysis were included as controls. The restriction pattern was identical for all samples. A Southern blot of this digest probed with pL1-4 also failed to detect the original polymorphic bands (data not shown). Arrows identify the ~2.0 kb PstI fragment detected by pL1-4 at the PKD1 locus. Size markers are denoted by M [[lambda] HindIII, 1.0 kb ladder (Gibco)].

The 3'LR can also be used readily as template in methods that scan for single or oligo base pair changes, such as single strand conformation or heteroduplex analysis. One must take special precautions, however, to avoid co-amplification of fragments from the duplicated loci, since small amounts of total genomic DNA (containing both PKD1 and its homologs) from the original PCR mix contaminate the 3'LR product. The problem of genomic contamination can easily be overcome by diluting the 3'LR products to >= 1:10-4 prior to their use as templates for PCR. This degree of dilution provides an adequate amount of 3'LR template for nested PCR of exons contained within it but no longer contains a sufficient quantity of genomic DNA to support amplification of other fragments. Figure 4 presents illustrative examples. Exons 24 and 25 can be amplified robustly when greatly diluted aliquots of 3'LR are used as template, but not when another, similarly diluted long-range PKD1-specific PCR product that includes exons 2-15 (5'LR) is used (Fig. 4 A). Figure 4 B shows that there is insufficient genomic contamination of the 3'LR product at dilutions >1:10-3 to support detectable amplification of EJ2, a genomic fragment from intron 1 (Fig. 1 ). This control has been repeated for at least five different templates (data not shown).


Figure 4.Diluted 3'LR template provides specific amplification of nested products. (A) Exons 24 and 25 can be amplified easily from 3'LR even after dilution to 10-4 (lanes 6 and 12) or 10-5 (lanes 5 and 11). No products were visible in ethidium bromide-stained gels when another long-range product (5'LR) that includes exons 2-15 was diluted to the same degree (10-4 in lanes 4 and 10; 10-5 in lanes 3 and 9). Lanes 2 and 8 are water controls, and lanes 1, 7 and 13 are marker lanes. (B) EJ2, which is in intron 1 and not nested within the 3'LR product, cannot be amplified from 3'LR when diluted to 10-4 (lane 2) or 10-5 (lane 1). Lesser dilutions of 10-1 (lane 5), 10-2 (lane 4) and 10-3 (lane 3) have a sufficient amount of genomic DNA contamination remaining to support EJ2 amplification. Lane 6 shows the PCR product amplified from genomic DNA. Lane 7 is a marker lane.

We amplified 3'LR from the genomic DNA of ~80 affected individuals and 50 normal controls, and have used the samples diluted 1:10-5 as templates for mutation analysis. Primer pairs were designed flanking each exon except exon 23, whose length necessitated the design of two sets of primer pairs that could be used to amplify overlapping fragments. Table 1 presents the sequences and summarizes the optimal PCR conditions for each primer pair. All 80 samples have been screened for mutations in exons 23-26 using heteroduplex analysis. A subset has also been screened for mutations in exons 27-34.

A number of interesting sequence variants, clustered primarily in exons 23 and 25, have been identified and are summarized in Table 2 . We were unable to obtain enough samples from family members to show co-segregation of all variants. Nonetheless, screening of >100 normal chromosomes failed to detect any of the variants listed in Table 2 , except for one polymorphism in exon 25 (discussed below).

Family material was available for samples JHU273 and XT30. Figure 5 shows the segregation of heteroduplex patterns in exons 23 and 25 in the pedigree of a chromosome 16-linked family, JHU273 (16 ). The polymorphism in exon 23 segregates with the disease phenotype (Fig. 5 B) while that in exon 25 does not (Fig. 5 C). Sequence analysis revealed that the heteroduplex pattern in exon 23 is due to five isolated base pair changes clustered in a small segment (Fig. 6 ). This unusual pattern was confirmed by sequence analysis of two affected individuals as well as by restriction analysis of DNA samples from all available members of the pedigree (Fig. 7 ). The extensive nature of these changes, their segregation with the disease phenotype and their absence in normal individuals strongly suggest that this cluster constitutes the germline PKD1 mutation in this family. It is of note that the affected individual, JHU086, was found to have a similar pattern of clustered base pair substitutions even though the two families are not known to be related (Table 2 ). The family of JHU086 is of German ethnic origin whereas JHU273 is American and has a mix of ethnic backgrounds. A distant genetic relationship between the two families cannot be excluded, however, since one branch of the JHU273 family originated from Germany in 1803. If the individuals are related, each would have independently acquired another unique base pair change substitution superimposed on the set of four changes common to both.

Table 1 Primer sequences for PKD1 exons 23-34
Exon

Primers

Frament
size (bp)
Annealing
temperature (oC)
Extension
time (s)
23a

TWF1 5'CTGCACTGACCTCACGCATGT3'
23R1 5'GCCAAAGGGAAAGGGATTGGA3'
377

62

30

23b

23F2 5'CCGCGGAGCCTGCTGTGCTAT3'
23R2 5'TGCCACGGGCCTGAAAGCATA3'
631

56

45

24

24F 5'TATGCTTTCAGGCCCGTGGCA3'
24R 5'AGAGCCCATACCCGGTCCAGTCC3'
382

62

30

25

25F 5'GGACTGGACCGGGTATGGGCTCT3'
25R 5'CACCCAGGCCCTCCTCGACTC3'
392

62

30

26

26F 5'CTGGGTGGGCTCGGCTCTATC3'
26R 5'TGGTAGCGATGCTCACGTCACTT3'
553

65

45

27

27F 5'CAGGCCAAAGCTGAGATGACTTG3'
27R 5'AGAGGCGCAGGAGGGAGGTC3'
339

62

30

28

28F 5'CCCTCTGCCCCCGCATTG3'
28R 5'GGAGAGCCAGATGTGCTTGTCAA3'
380

62

30

29

29F 5'GGTGCTGGCCGCGAGTAAGG3'
29R 5'CCGTGCTGTGTGGAGGAGAG3'
414

62

30

30

30F 5'CCTCTTCCTGCCCAGCCCTTC3'
30R 5'CTTCCCGAGCAGCCTTTGGTG3'
318

62

30

31

31F 5'GTCCCATATATCCAGCATTCT3'
31R 5'ACAGTGTCTTGAGTCCAAGC3'
330

56

30

32

32F 5'GCCTTGGCGCAGCTTGGACT3'
32R 5'ACACCCAGCAAGGACACGCA3'
185

65

20

33

33F 5'GGTGTGCGGGCTGCGTGT3'
33R 5'CTCGGCAAGGACCTGCTGGAT3'
459

62

30

34

34F 5'GAGAGGAGGGGGCTCTGAAG3'
34R 5'AAAAACCCGCCCATAATTTC3'
475

62

30


Table 2 Summary of PKD1 variants
Sample Exon Sequence Amino acid Comment
JHU273 23 T8446G no change A, B
    T8490C M2760T  
    G8493C R2761P  
    T8502C M2764T  
    T8688C I2826T  
JHU086 23 T8446G no change B
    T8490C M2760T  
    G8493C R2761P  
    C8498G L2763V  
    T8502C M2764T  
JHU114 23 G8583A R2791Q B
JHU187 24 T9124C no change  
  intron 24 A38,794G intronic  
JHU273 25 G9406C no change C, D
    T9407C F3064L  
XT30 25 G9233C V3008L A, B
A: segregates with disease; B: not seen in normals; C: does not segregate with disease; D: heteroduplex pattern seen in normals


Figure 5. The segregation of heteroduplex patterns in exons 23 (B) and 25 (C) for the family of JHU273 (A) are depicted. The proband, JHU273, is denoted by an arrow (#6). All family members, regardless of sex, are represented by triangles, with solid triangles indicating affected members of the pedigree. Question marks indicate persons whose clinical status is unknown.


Figure 6. The heteroduplex pattern in exon 23a of JHU273 is due to five isolated base pair changes (Table 2) clustered in a small segment of exon 23. The sequence alignment of a portion of the normal (bottom, blue) and mutant alleles (top, black) is shown. The base pair differences are indicated in red along with the corresponding four amino acid changes. These changes create one restriction site (BstUI, blue arrow) and destroy two (FspIand MslI, green arrow). One change neither created nor destroyed a restriction site. Identical sequence changes were found in amplified products derived from one other affected family member (#2) and confirmed in the remaining affected members of the pedigree by restriction analysis.


Figure 7. The JHU273 exon 23 sequence variants segregate with disease in the JHU273 pedigree. Exon 23a was amplified from 3'LR of each family member as described in Materials and Methods and digested with the three restriction enzymes that distinguish the normal and mutant alleles. The lane assignments correspond to those used in Figure 6. BstUI (top panel) creates two new fragments of 101 and 65 bp in each affected family member (lanes 2 and 6-9). Both FspIand MslI are predicted to cleave the amplified 377 bp fragment of the normal allele once. The mutant allele which lacks the sites is predicted not to cleave with either enzyme. As the lower panels demonstrate, the 377 bp fragment of unaffected family members (lanes 1 and 3-5) is cleaved to completion while the amplified segment of affected individuals is not. A small amount of full-length product is still detectable in the normal samples, even after prolonged incubation with FspI, because of the lower efficiency of FspI. A similar pattern was observed using cloned DNA (data not shown). The shadow band seen in lane 7 of the middle panel is an artifact.

The polymorphism in exon 25 in pedigree JHU273 was discovered to be due to two adjacent base pair substitutions that involve two codons. One of the changes does not alter an amino acid, while the other results in an amino acid substitution of phenylalanine by leucine. Approximately 25% of unrelated, unaffected individuals were also found to have the exon 25 polymorphism. A unique heteroduplex pattern in exon 25 was detected in one affected individual (XT30), however, and this pattern was shared by an affected brother, daughter and niece (data not shown). The sequence variant responsible for the novel pattern was determined to be a single base pair change that results in an amino acid substitution of valine by leucine (Table 2 ). This pattern was also absent in 100 normal chromosomes. Although this change segregates with the disease phenotype and is not seen in normal chromosomes, it is a conservative substitution which may not disrupt the protein structure.

Three other differences also were observed. The mutation in JHU114 results in a non-conservative substitution of arginine for glutamine. This variant was not present in samples from 50 normal controls nor in any of the samples from other affected individuals. JHU187 was discovered to have two unique sequence differences. The first is a silent nucleotide substitution in exon 24 while the second alters a single nucleotide in intron 24 that does not disrupt the consensus donor splice site. It is not possible presently to exclude an effect of this variant on RNA processing. It is important to note that the heteroduplex pattern observed in this individual was not detected in >130 other individuals. All sequence variants have been registered with the International PKD Mutation Registry (http://medoc.gdb.org/pkd/).

DISCUSSION

Genetic analysis of PKD1 has been hampered by the existence of at least three highly homologous loci on chromosome 16 that are also transcribed. Relatively few mutations have been identified since the gene's discovery, and almost all have been located in the 3', single copy region of the gene. In this report, we describe a novel strategy for mutation analysis in the duplicated region of PKD1. This method relies on the use of one PKD1-specific primer as an anchor in combination with a primer from the duplicated portion of the gene to amplify an ~10 kb segment containing exons 23-34. We have used rigorous controls to demonstrate that this template is locus-specific and can be used for nested PCR of smaller fragments after appropriate dilution. These fragments can be analyzed using heteroduplex analysis or any of the other PCR-based methods used for mutation detection.

Other groups of investigators have used the protein truncation test (PTT) (17 ,18 ) to scan for mutations in the duplicated region of PKD1. While the PTT can be used to scan relatively large fragments rapidly for protein-terminating variants, it is incapable of identifying important missense mutations. Another limitation is that its use is restricted to the study of either RNA templates or large exons such as exon 15 in PKD1 (~3 kb). Our approach has several advantages. Amplification with our set of primers (TWF1 and KG8R25) and conditions works reliably when DNA is prepared from blood or tissue using one of many commercially available kits (avoiding the use of phenol-chloroform extraction). Another advantage is that small quantities of source material are sufficient for generating templates. One PCR reaction requires <300 ng of genomic DNA and provides sufficient material for all subsequent studies, since the final reaction is diluted to at least 1:10-5 prior to use. The method can be amended easily for use in evaluating RNA samples prepared from blood or other tissues and, unlike PTT, should be broadly applicable to other areas of PKD1 since it requires few locus-specific primers. Finally, our approach can also be used to screen for all types of sequence variants.

We have used our long-range genomic PCR strategy successfully to study exons within the duplicated region and have discovered an unusual pattern of mutation in exon 23 of two patients affected with ADPKD. These data are notable in light of our recent discovery that renal cysts in ADPKD are clonal and have acquired mutations of the previously normal allele (16 ). Our data suggest that the majority of renal cysts arise as a result of independent mutations, implying a high rate of somatic mutation. The frequency with which `second hits' occur in PKD1 appears to be greater than that observed in other tumor suppressor genes responsible for renal tumors. These two sets of observations suggest that a new mechanism of mutation may be involved in the pathogenesis of PKD1.

We postulate that unusual features of the PKD1 structure may be responsible for its mutability (3 ,16 ,19 ). PKD1 has three long polypyrimidine tracts within introns 1, 21 and 22, the longest of which is 2.5 kb (intron 21). The tract in intron 21 is the longest polypyrimidine tract sequenced to date, and contains 23 mirror repeats with stem lengths of at least 10 nucleotides (19 ). The mirror repeats are likely to form H-DNA structures composed of a triple helix conformation under appropriate conditions. Wang et al. recently have shown that triplex structures can promote localized mutagenesis in cultured cells (20 ). The authors discovered that triplex formation mediated through triplex-forming oligonucleotides caused a 10-fold increase in mutation frequency in a cell culture model system. The mutations were observed in a gradient around the site of triple helix formation and included single base pair substitutions, small deletions and multiple simultaneous point mutations. While the majority of variants that we discovered in exons near the polypyrimidine tracts were single base pair changes, two individuals had similar but non-identical sets of clustered base pair changes in exon 23that result in multiple amino acid substitutions in a short stretch of the protein. The 2 bp normal variant in exon 25 may have arisen via a similar mechanism. This unusual pattern of clustered multiple base pair substitutions is consistent with that associated with triple helix formation and may implicate this novel mechanism of mutation in the molecular pathogenesis of PKD1.

It should be noted that the distance between the largest polypyrimidine tract in intron 21 of PKD1 and the mutations in exon 23 is much larger than in the report of Wang et al. There are several important differences between their study and ours, however, which might explain the discrepancy. First, it is possible that the polypyrimidine tract in intron 22 also forms triplex structures. This could account for the increased mutability of the immediately adjacent exon. Second, the triplex-forming site in the small reporter gene (supFG1)used by Wang et al. is very near its 3' end while in PKD1 the CT element is centrally located within a 50 kb primary transcript. It is unknown whether this difference would influence the range of sites at risk for mutation via this mechanism. Moreover, the assay used by Wang et al. only detected mutations that resulted in a visible phenotype by altering supFG1 function. The authors note in their discussion that mutations involving sequences outside of the supFG1 gene would have been missed. Finally, one might imagine that a 2.5 kb element that is ~100 times larger than that used in this artificial system might have a more severe effect because of its tremendous potential for multiple sites of triplex formation. It is impossible to predict a priori how these differences in gene structure would influence outcome.

The remarkable similarity between the mutations discovered in JHU273 and JHU086 is surprising given the relative infrequency of this pattern in the population studied (2/80). While it may be explained by common ancestry, an alternative explanation is that the mutations had arisen independently via the triplex-mediated transcription-coupled repair mechanism described above. Wang et al. found that mutations in their system were not completely random and, in fact, certain patterns recurred multiple times. This might explain why the entire set of mutations seen in JHU273 and JHU086 was not identical. An alternative explanation for these observations could be that the sets of mutations arose by gene conversion events between PKD1 and its homologs. It is possible that the polypyrimidine tracts in introns 21 and 22 (which are present in at least some of the homologous loci, unpublished data) may play a role in promoting this process.

Exons 23 and 25 are predicted to encode portions of polycystin with extensive homology to the receptor for egg jelly (REJ) in the sperm of the sea urchin (21 ). This receptor functions during fertilization by binding to glycoproteins in the egg jelly and then inducing the sperm acrosome reaction, an ion channel-regulated event. Analysis of the amino acid sequence of this REJ-like domain in the primitive vertebrate Fugu rubripes shows >75% sequence conservation with human PKD1, suggesting that this region of polycystin may be functionally important (22 ). Variants of PKD1 may become pathogenic by disrupting an interaction between polycystin and its ligand.

Finally, our results highlight what we believe will be another important aspect of mutation detection in PKD1. We have detected a number of sequence variants that appear to segregate with the disease phenotype and are not detected in unaffected individuals, yet are predicted to result in conservative amino acid substitutions such as the leucine to valine change in Family 30. Other investigators have reported similar findings (8 ,12 ). Lacking a functional assay, it is difficult to establish with certainty the pathogenicity of such sequence variants. We predict, given both the size and inherent mutability of the gene, that the affected chromosome in a given family may harbor a number of `private' variants that are not responsible for the disease phenotype. Investigators seeking to establish genotype-phenotype correlations or perform genetic testing must use the information cautiously until confirmatory functional studies are possible. It will be interesting to determine whether normal variants have any role in modifying disease expression.

MATERIALS AND METHODS

Patient recruitment

Affected individuals were recruited from dialysis centers and nephrology clinics. The diagnosis of ADPKD was established using standard criteria (23 ,24 ). Family members of probands were recruited to participate after receiving permission from the donors. Blood samples were obtained after receiving informed consent and in accordance with institutional guidelines.

Long-range PCR

DNA was isolated from whole blood using the Puregene kit (Gentra) and the manufacturer's protocol. Genomic DNA (300 ng) was used as template for amplification of an ~10 kb product (3'LR) using primers TWF1 (5'-CTGCACTGACCTCACGCATGT-3', genomic position 37 678-37 698) and KG8R25 (5'-GTTGCAGCCAAGCCCATGTTA-3', genomic position 47 320-47 340) or KG8R5 (5'-GCGCTTTGCAGACGGTAGGCG-3', genomic position 48 579-48 599). For the cell lines, 145.19 and N23HA, 400 ng of genomic DNA, prepared using the Puregene kit, was used as template. PCR was performed as follows: denaturation at 94oC for 3 min 15 s, 35 cycles of 94oC for 15 s and 68oC for 10 min and a final extension of 72oC for 10 min. The total PCR volume was 50 [mu]l using 4U of rTth DNA polymerase, XL (Cetus, Perkin Elmer) and a final MgCl2 concentration of 1.1 mM. A hot start protocol recommended by the manufacturer was also used so that the rTth DNA polymerase, XL was added at 80oC. Products of the long-range PCR reaction were run on a 1% agarose gel to confirm that the reaction was successful prior to proceeding to the next step.

The specificity of 3'LR products was evaluated by testing for the presence of EJ2. This 143 bp fragment is located in intron 1 and is amplified using primers FQF4 (5'-TCGTCATGCGGAATCCTGACTCTG-3') and FQR5 (5'-TTCCAAACCCCTGCTATGCACATC-3'). PCR was performed using the same conditions as were used for exon 23 (Table 1 ).

Heteroduplex analysis

The long-range template 3'LR was diluted serially to 1:10-5 and used for all subsequent PCR reactions. Two [mu]l of diluted template was used as template for amplification of each exon, using conditions summarized in Table 1 . The total PCR volume was 30 [mu]l using 2 U of Taq DNApolymerase (Boehringer Mannheim), 0.2 [mu]l of dCTP and a final MgCl2concentration of 1.5 mM. Fragment exon 23A was digested with XmaI (Boehringer Mannheim) using the manufacturer's recommended conditions prior to heteroduplex analysis, yielding two fragments of 284 and 347 bp.

Heteroduplex analysis was performed using Hydrolink Mutation Detection Enhancement gels (MDE, AT Biochem) following the manufacturer's protocol. Urea was added to the gel to a final concentration of 15% to minimize band broadening. The radiolabeled PCR products were denatured initially by heating at 95oC for 5 min and then allowed to cool to room temperature gradually over 1-2 h before loading. Gels were run at 700 V for 14-16 h, dried and placed on X-Omat XAR film (Kodak) at room temperature and/or on a Phosphoimager cassette (Molecular Dynamics). All novel heteroduplex patterns were confirmed using a second template prepared from the same individual. Exons harboring variants were cloned into pCRII (TA Cloning Kit, Invitrogen) prior to sequencing. In order to distinguish clones containing the normal allele from the novel allele, mixing studies were performed as previously described (16 ). At least two independent clones containing the mutant allele were sequenced using an ABI automated sequencer and standard protocols. When possible, sequence differences were confirmed by restriction analysis of nested products derived from two independent 3'LR templates using enzymes whose recognition sites were altered by the changes.

Southern blots

Fifteen [mu]l of 3'LR or 5 [mu]g of genomic DNA were digested in a total volume of 30 [mu]l with 2 U of PstI. The products were run on a 1% agarose gel and transferred using standard techniques to a nylon membrane (Nytran, Schleicher and Schuell). pL1-4 is a cDNA clone whose insert was amplified from first strand cDNA derived from lymphoblast RNA using primers NKG10F4 (5'-CCTCACAGGAGCCGACAG-3') and NKG9R1 (5'-CGATGACGTGCTGCAGGAACC-3'). The insert was labeled with dCTP using Rediprime (Amersham) and hybridized to filters at 65oC. Filters were washed twice with 1* SSC, 1% SDS and twice with 0.1* SSC, 1% SDS at 65oC. Blots were then placed on X-Omat XAR film (Kodak) at -80oC and/or on a Phosphoimager cassette at room temperature (Molecular Dynamics).

ACKNOWLEDGEMENTS

We are grateful to all ADPKD family members for their invaluable participation. We thank the PKRF Foundation for its support of the International PKD Mutation Registry and Ms Sidney McGaughey for her assistance in the preparation of the manuscript. This work was supported by grants from the NIH (T.W. DK09055; G.G.G. DK48006). G.G.G. is the Irving Blum Scholar of the Johns Hopkins University School of Medicine.

REFERENCES

1 Gabow, P. A. (1993) Autosomal dominant polycystic kidney disease. N. Engl. J. Med., 329, 332-342.

2 The European Polycystic Kidney Disease Consortium. (1994) The polycystic kidney disease gene encodes a 14 kb transcript and lies within a duplicated region on chromosome 16. Cell, 77, 881-894.

3 The American PKD1 Consortium (1995) Analysis of the genomic sequence for the autosomal dominant polycystic kidney disease (PKD1) gene predicts the presence of a leucine-rich repeat. Hum. Mol .Genet., 4, 575-582.

4 The International Polycystic Kidney Disease Consortium (1995) Polycystic kidney disease: the complete structure of the PKD1 gene and its protein. Cell, 81, 289-298.

5 Hughes, J., Ward, C. J., Peral, B., Aspinwall, R., Clark, K., San Millán, J. L., Gamble, V. and Harris, P. C. (1995) The polycystic kidney disease 1 (PKD1) gene encodes a novel protein with multiple cell recognition domains. Nature Genet.,10, 151-160. MEDLINE Abstract

6 Peral, B., Ong, A.C.M., San Millán, J.L., Gamble, V., Rees, L. and Harris, P.C. (1996) A stable, nonsense mutation associated with a case of infantile onset polycystic kidney disease 1 (PKD1). Hum. Mol. Genet., 5, 539-542. MEDLINE Abstract

7 Peral, B., Gamble, V., San Millán, J.L., Strong, C., Sloane-Stanley, J., Moreno, F. and Harris, P.C. (1995) Splicing mutations of the polycystic kidney disease 1 (PKD1) gene induced by intronic deletion. Hum. Mol. Genet., 4, 569-574. MEDLINE Abstract

8 Peral, B., San Millán, J.L., Ong, A.C., Gamble, V., Ward, C.J., Strong, C. and Harris, P.C. (1996) Screening the 3' region of the polycystic kidney disease 1 (PKD1) gene reveals six novel mutations. Am. J. Hum. Genet., 58, 86-96. MEDLINE Abstract

9 Brook-Carter, P.T., Peral, B., Ward, C.J., Thompson, P., Hughes, J., Maheshwar, M.M., Nellist, M., Gamble, V., Harris, P.C. and Sampson, J.R. (1994) Deletion of the TSC2 and PKD1 genes associated with severe infantile polycystic kidney disease-a contiguous gene syndrome. Nature Genet., 8, 328-332. MEDLINE Abstract

10 Turco, A.E., Rossetti, S., Bresin, E., Corra, S., Gammaro, L., Maschio, G. and Pignatti, P.F. (1995) A novel nonsense mutation in the PKD1 gene (C3817T) is associated with autosomal dominant polycystic kidney disease (ADPKD) in a large three-generation Italian family. Hum. Mol. Genet.,4, 1331-1335. MEDLINE Abstract

11 Neophytou, P., Constantinides, R., Lazarou, A., Pierides, A. and Deltas, C.C. (1996) Detection of a novel nonsense mutation and an intragenic polymorphism in the PKD1 gene of a Cypriot family with autosomal dominant polycystic kidney disease. Hum. Genet., 98, 437-442. MEDLINE Abstract

12 Rossetti, S., Bresin, E., Restagno, G., Carbonara, A., Corra, S., Deprisco, O., Pignatti, P.F. and Turco, A.E. (1996) Autosomal dominant polycystic kidney disease (ADPKD) in an Italian family carrying a novel nonsense mutation and two missense changes in exons 44 and 45 of the PKD1 gene. Am. J. Med. Genet., 65, 155-159. MEDLINE Abstract

13 Germino G.G., Weinstat-Saslow, D., Himmelbauer, H., Gillespie, G.A.J., Somlo, S., Wirth, B., Barton, N., Harris, K.L., Frischauf, A.-M. and Reeders, S.T. (1992) The gene for autosomal dominant polycystic kidney disease lies in a 750 kb CpG-rich region. Genomics, 13, 144-151. MEDLINE Abstract

14 Ceccherini, I., Persici, P., Pezzolo, A., Rocchi, M., Breuning, M.H., Himmelbauer, H., Frischauf, A.-M., Hyland V.J., Sutherland, G.R., Germino, G.G., Reeders, S.T., Cox, D.R. and Romeo, G. (1992) Construction of a fine structure map of chromosome 16 by using radiation hybrids. Proc. Natl Acad. Sci., USA, 89, 104-108. MEDLINE Abstract

15 Germino, G.G., Barton, N.J., Lamb, J., Higgs, D.R., Harris, P., Scherer, G., Nakamura, Y. and Reeders S.T. (1990) Identification of a locus which shows no genetic recombination with the autosomal dominant polycystic kidney disease gene on chromosome 16. Am. J. Hum. Genet., 46, 925-933. MEDLINE Abstract

16 Qian, F., Watnick, T.J., Onuchic, L.F. and Germino, G.G. (1996) The molecular basis of focal cyst formation in human autosomal dominant polycystic kidney disease type 1. Cell, 87, 979-987. MEDLINE Abstract

17 Roest, P.A., Roberts, R.G., Sugino, S. van Ommen, G.J. and den Dunnen, J.T. (1993) Protein truncation test (PTT) for rapid detection of translation-terminating mutations. Hum. Mol. Genet., 2, 1719-1721. MEDLINE Abstract

18 Roelfsema, J., Peters, D.J.M., Spruit, L. and Breuning, M.H. (1996) Mutation detection in the repeated part of the polycystic kidney disease 1 (PKD1) gene by the protein truncation test. J. Am. Soc. Nephrol., 7, 1605 (abstract).

19 Van Raay, T.J., Burn, T.C., Connors, T.D., Petry, L.R., Germino, G.G., Klinger, K.W. and Landes, G.M. (1996) A 2.5 kb polypyrimidine tract in the PKD1 gene contains at least 23 H-DNA-forming sequences. Microb. Comp. Genet., 1, 317-327.

20 Wang, G., Seidman, M.M., and Glazer P.M. (1996) Mutagenesis in mammalian cells induced by triple helix formation and transcription-coupled repair. Science, 271, 802-805. MEDLINE Abstract

21 Moy, G.W., Mendoza, L.M., Schulz, J.R., Swanson, W.J., Glabe, C.G. and Vacquier, V.D. (1996) The sea urchin sperm receptor for egg jelly is a modular protein with extensive homology to the human polycystic kidney disease protein, PKD1. J. Cell Biol.,133, 809-817. MEDLINE Abstract

22 Sandford, R.N, Sgotto, B., Hughes, J., Harris, P.C. and Lockwood, M.C. (1996) Comparative analysis of the PKD1 gene and its predicted protein, polycystin. J. Am. Soc. Nephrol., 7, 1621 (abstract).

23 Bear, J.C., McManamon, P., Morgan, J., Payne, R.H., Lewis, H., Gault, M.H. and Churchill, D.N. (1984) Age at clinical onset and at ultrasonographic detection of adult polycystic kidney disease-data for genetic counseling. Am. J. Med. Genet., 18, 45-53. MEDLINE Abstract

24 Bear, J.C., Parfrey, P.S., Morgan, J.M., Martin, C.J. and Cramer, B.C. (1992) Autosomal dominant polycystic kidney disease: new information for genetic counseling. Am. J. Med. Genet., 43, 548-553. MEDLINE Abstract


Top

*To whom correspondence should be addressed. Tel: +1 410 614 1650; Fax: +1 410 955 0485; Email: ggermino@welchlink.welch.jhu.edu

-->
This page is maintained by OUP admin. Last updated Wed Aug 13 15:52:16 BST 1997. Part of the OUP Journals World Wide Web service. Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Biol EvolHome page
O. Symmons, A. Varadi, and T. Aranyi
How Segmental Duplications Shape Our Genome: Recent Evolution of ABCC6 and PKD1 Mendelian Disease Genes
Mol. Biol. Evol., December 1, 2008; 25(12): 2601 - 2613.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. Rossetti, M. B. Consugar, A. B. Chapman, V. E. Torres, L. M. Guay-Woodford, J. J. Grantham, W. M. Bennett, C. M. Meyers, D. L. Walker, K. Bae, et al.
Comprehensive Molecular Diagnostics in Autosomal Dominant Polycystic Kidney Disease
J. Am. Soc. Nephrol., July 1, 2007; 18(7): 2143 - 2160.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
L. A. Lyons, D. S. Biller, C. A. Erdman, M. J. Lipinski, A. E. Young, B. A. Roe, B. Qin, and R. A. Grahn
Feline Polycystic Kidney Disease Mutation Identified in PKD1
J. Am. Soc. Nephrol., October 1, 2004; 15(10): 2548 - 2555.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Qian, A. Boletta, A. K. Bhunia, H. Xu, L. Liu, A. K. Ahrabi, T. J. Watnick, F. Zhou, and G. G. Germino
Cleavage of polycystin-1 requires the receptor for egg jelly domain and is disrupted by human autosomal-dominant polycystic kidney disease 1-associated mutations
PNAS, December 24, 2002; 99(26): 16981 - 16986.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
B. PHAKDEEKITCHAROEN, T. J. WATNICK, and G. G. GERMINO
Mutation Analysis of the Entire Replicated Portion of PKD1 Using Genomic DNA Samples
J. Am. Soc. Nephrol., May 1, 2001; 12(5): 955 - 963.
[Abstract] [Full Text]


Home page
J. Med. Genet.Home page
S L DABORA, A A NIETO, D FRANZ, S JOZWIAK, A VAN DEN OUWELAND, and D J KWIATKOWSKI
Characterisation of six large deletions in TSC2 identified using long range PCR suggests diverse mechanisms including Alu mediated recombination
J. Med. Genet., November 1, 2000; 37(11): 877 - 883.
[Full Text]


Home page
Nephrol Dial TransplantHome page
D. M. Iglesias, D. Telleria, M. Viribay, M. Herrera, V. A. Bernath, A. R. Kornblihtt, R. S. Martin, and J. L. S. Millan
A novel frameshift mutation (2436insT) produces an immediate stop codon in the autosomal dominant polycystic kidney disease 2 (PKD2) gene
Nephrol. Dial. Transplant., April 1, 2000; 15(4): 477 - 480.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
P. C. Harris
Autosomal dominant polycystickidney disease: clues to pathogenesis
Hum. Mol. Genet., September 1, 1999; 8(10): 1861 - 1866.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Bacolla, A. Jaworski, T. D. Connors, and R. D. Wells
PKD1 Unusual DNA Conformations Are Recognized by Nucleotide Excision Repair
J. Biol. Chem., May 18, 2001; 276(21): 18597 - 18604.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (59)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Watnick, T. J.
Right arrow Articles by Germino, G. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watnick, T. J.
Right arrow Articles by Germino, G. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?