Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Knoll, A.
Right arrow Articles by Rosenthal, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knoll, A.
Right arrow Articles by Rosenthal, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1527-1534


Human renin binding protein: complete genomic sequence and association of an intronic T/C polymorphism with the prorenin level in males
Introduction
Results
   Sequence of the human RnBP gene
   Search for RnBP gene mutations by direct sequencing
   Population screening for the T61C polymorphism and association study
   RT-PCR
Discussion
Material And Methods
   Cosmid sequencing
   Computer analysis
   Search for RnBP mutations by genomic sequencing
   Screening by AluI restriction
   RT-PCR
   Biochemical measurements
   Subjects screened for mutations in the RnBP gene
   Population screened for the intronic T61C polymorphism
   Statistical analyses
Acknowledgements
Abbreviation
References


Human renin binding protein: complete genomic sequence and association of an intronic T/C polymorphism with the prorenin level in males

Human renin binding protein: complete genomic sequence and association of an intronic T/C polymorphism with the prorenin level in males Antje Knöll1,3, Heribert Schunkert2, Kathrin Reichwald3, A.H. Jan Danser4, David Bauer3, Matthias Platzer3, Günter Stein5 and André Rosenthal3,*

Departments of 1Pathology and 2Internal Medicine, University of Regensburg, D-93042 Regensburg, Germany, 3Department of Genome Analysis, Institute of Molecular Biotechnology, Beutenbergstrasse 11, D-07745 Jena, Germany, 4Department of Pharmacology, Erasmus University, 3015 GE Rotterdam, The Netherlands and 5Department of Internal Medicine, University of Jena, D-07740 Jena, Germany

Recieved April 7, 1997; Revised and Accepted June 3, 1997

The role of renin binding protein (RnBP) in human (patho)physiology, despite its biochemical characterization, is as yet unclear. RnBP has been shown to bind and inactivate renin, a key player of the blood pressure regulating renin-angiotensin system. This renders the RnBP gene a promising candidate gene in human hypertension. Herein, a molecular genetic approach was employed to investigate if RnBP might affect renin, prorenin and/or blood pressure levels. Sequencing of the human Xq28 chromosomal region provided the precise chromosomal location and full genomic sequence of the RnBP gene. All 11 exons, adjacent intronic splice sites and the promoter region were sequenced in 20 patients with essential hypertension of early onset and possible X-linked inheritance and in four normotensive individuals. The only variant found was a single base exchange polymorphism 61 base pairs upstream of the intron 6/exon 7 boundary (T61C). Several cardiovascular parameters, the renin, and prorenin levels and the T61C allele status were determined in 505 Caucasian individuals. Male individuals without medication who were hemizygous for the C allele were characterized by lower prorenin levels (196 +- 15 versus 256 +- 12 mU/l, P = 0.05) and a significantly higher renin/prorenin ratio (10.7 +- 1.5 versus 7.7 +- 0.3%, P = 0.002), whereas no variations in circulating renin, blood pressure, heart rate and left ventricular mass index were associated with the C allele. No significant association was observed in women. The data do not exclude a role of RnBP in essential hypertension. The complete genomic structure of the RnBP gene, including the identified repetitive sequence elements, provides an essential tool for further studies of the RnBP gene in hypertensive patients with a different genetic background.

INTRODUCTION

Hypertension is one of the most common multifactorial diseases, affecting 15-20% of the human population (2 ), and represents a complex trait which may encompass multiple syndromes with both hereditary and environmental determinants (reviewed in 3 ,4 ). Based on the results of twin studies, adoption studies and statistical analyses of blood pressure in various pedigrees, it has been estimated that 20-60% of the population variability in blood pressure is genetically determined (5 ). Blood pressure values are distributed unimodally in the general population, suggesting that several genes are involved in the development of essential hypertension, i.e. hypertension without obvious cause. The identification of these genes is a challenge that is met by the advances of molecular genetics. One approach is the identification and testing of candidate genes which, based on their physiological actions, may contribute to a specific phenotype. Investigation of the genes that constitute the renin-angiotensin system appeared to be particularly promising, because of the central role of this system in the regulation of blood pressure. An association between molecular variants of the angiotensinogen gene and hypertension was reported initially in 1992 (6 ) and subsequently has been corroborated by a number of investigations (7 ,8 ). In addition, a variant of the angiotensin converting enzyme gene was found to be over-represented in patients with myocardial infarction (9 -11 ) and to increase the risk of premature death in families with hypertension (12 ), albeit a direct effect on blood pressure was not observed (13 -15 ). With regard to renin, most studies reported a lack of genetic linkage between intragenic restriction length polymorphisms (RFLPs) and arterial hypertension (16 -18 ).

Renin binding protein (RnBP) might be an important regulator within the renin-angiotensin system (18 ). RnBP was first isolated and subsequently cloned by Takahashi et al. (19 ). Recently, RnBP has been characterized in pigs as an N-acyl-D-glucosamine 2-epimerase, an enzyme involved in the synthesis of N-acetylneuraminic acid (20 ). Recombinant RnBP injected into the circulation inactivates renin, a crucial component of the renin-angiotensin system. Sequestration of circulating renin by exogenous RnBP also results in a substantial drop in blood pressure. However, RnBP is an intracellular protein and is not detectable in plasma in vivo. Thus, in contrast to its documented biochemical effects, at present it is unclear whether RnBP is involved in in vivo regulation of renin levels. Such an interaction, either within the tissue or in the circulation, might have the potential to affect blood pressure levels and thus the manifestation of arterial hypertension. Therefore, RnBP is a promising candidate gene for hypertension.


Figure 1. Genomic structure of the RnBP gene.

Table 1 . Genomic structure of the RnBP gene
Exon/intron Exon length Exon positiona Intron length
no. (bp) From To (bp)
1 23 -191 -169 165
2 110 -3 107 153
3 76 261 336 109
4 76 446 521 176
5 173 698 870 466
6 225 1337 1561 823
7 82 2385 2466 296
8 176 2763 2938 1244
9 132 4183 4314 4525
10 88 8840 8927 84
11 135 9012 9146  
aPosition 1 refers to the ATG start codon of the RnBP gene (corresponding to position 97 351 in database entry U52112).

Although the RnBP cDNA and the exon/intron boundaries have been published before (19 ), the complete sequences have not yet been established for all introns. The RnBP gene is located in the q28 region of the human X chromosome proximal to the host cell factor 1 (HCF1) gene (21 -25 ). Given this location, we hypothesized that the RnBP gene might be associated with arterial hypertension, since epidemiological surveys revealed that in males hypertension occurs more frequently and at an earlier age (26 ,27 ). While sequencing the Xq28 region on a large scale basis, we determined the complete sequence of the gene and its genomic structure. Based on the intronic sequences we designed primers and sequenced all RnBP exons and flanking intronic regions in 20 patients selected for early onset essential hypertension and possible X-linked inheritance and in four normotensive individuals. We identified one common polymorphism in intron 6 of the RnBP gene. This variant was tested for association with blood pressure and renin and prorenin levels, as well as other cardiovascular parameters, in 505 individuals.

RESULTS

Sequence of the human RnBP gene

During the course of a large scale sequencing project in the human Xq28 chromosomal region (Platzer et al., unpublished data), the complete genomic sequence of the RnBP gene was determined (accession no. U52112, positions 87 938-100 489). The RnBP gene is located on cosmid 12B2 between the genes TE2 and HCF1 (21 -25 ). All three genes are transcribed in the same direction from telomer to centromer, with the HCF1 gene ending 2948 bp telomeric and the TE2 gene starting 270 bp centromeric of the RnBP gene.

Table 2 . Human repetitive sequence elements within the chromosomal region of the RnBP gene, identified by CENSOR (28)
No. Repeat Position Strand Intron
    From To    
1 Alu-Sg -1320 -1017 + 5'-UTRa
2 Alu-Jb -933 -664 + 5'-UTR
3 Alu-Sx 1880 2170 + 6
4 MER41 3072 3681 + 8
5 Alu-Sx 3269 3557 - 8
6 MER41 3685 3926 + 8
7 Alu-J 5031 5320 + 9
8 Alu-Sx 5323 5613 + 9
9 Alu-Sq 6386 6968 + 9
10 Alu-Jo 7213 7501 - 9
11 Alu-Y 7903 8110 - 9
12 Alu-S 8111 8190 - 9
13 Alu-Sx 8277 8568 - 9
14 MIR 8714 8778 + 9
a5'-UTR, 5'-untranslated region.

Table 3 . Short tandem repeats within the RnBP gene
No. Sequence Position Repeats (no.) Identity (%) Localisation
    From To      
1 GGAAAAGGGCATGGCACCCAGT 5818 5880 3 100 Intron 9
2 TTTA 7172 7219 11 100 Intron 9
3 TTTG 8249 8280 9 100 Intron 9
4 CCCCGC 9076 9111 6 94 Exon 11
5 CGCCCCGCGCATTGGCC 9249 9316 4 81 3'-UTRa
a3'-UTR, 3'-untranslated region.

Table 4 . Primers used for PCR, sequencing and RT-PCR
Region Position (5' -> 3') Sequence Application
Promotor -640 -> -618 5'-ACA GAA CTT GCC TCC TGT CTA CC-3' PCR, sequencing
  -338 -> -359 5'-TTG TTC CTG CCG CGA CCC TCC A-3' PCR, sequencing
Exon 1 -442 -> -421 5'-GGC CAT CCC AGC TTT TCC CAC C-3' PCR, sequencing
  -98 -> -119 5'-ACG GGG CTT CAG ACG TCA CCA T-3' PCR, sequencing
Exon 2 -123 -> -102 5'-GGG GAT GGT GAC GTC TGA AGC C-3' PCR, sequencing
  196 -> 174 5'-GCC AGC AAA TCT GTG AGG TGC CT-3' PCR, sequencing
Exon 3 162 -> 184 5'-CTT CTC ACT CTC AGG CAC CTC AC-3' PCR, sequencing
  433 -> 411 5'-GGA GGG AAA GTG GCT TAA GTG GC-3' PCR, sequencing
Exon 4 350 -> 371 5'-AGC CTG GAA GCT CAG GCA CAC G-3' PCR, sequencing
  619 -> 596 5'-TTC GCT GCT TCT AGA TCC CTC TAG-3' PCR, sequencing
Exon 5 616 -> 637 5'-CGA AGG ACT TGG GGA GGC TCA A-3' PCR, sequencing
  955 -> 933 5'-GAC TTG CGT AGT GAG TGG GAA TG-3' PCR, sequencing
Exon 6 1217 -> 1240 5'-GGA TGA AGG TGT CTC TGG GTT CAG-3' PCR
  1864 -> 1841 5'-GTA ATC CTC ACT TCT GGC CTG ATC-3' PCR
Exon 6 1265 -> 1285 5'-AGG GCC GTG TCC AGG GGG ATG-3' Sequencing
  1649 -> 1630 5'-CTC TCC AGG TGT GTC GAG CC-3' Sequencing
Exon 7 2196 -> 2218 5'-CTA GGC CCA AGG GAG TGA ATC AG-3' PCR
  2630 -> 2608 5'-TGG AAG CCT GCT CCT CTG CAG AA-3' PCR
Exon 7 2275 -> 2297 5'-TTG GGT AAG AGG GAG GGA GGA AG-3' Sequencing
  2583 -> 2562 5'-CTC GCT CCT CTG CCT CCT CAA G-3' Sequencing
Exon 8 2638 -> 2660 5'-GGA GCT CAG AGC CTC GCT CAT TG-3' PCR
  3051 -> 3029 5'-AGG CCT CTA GGT TCC AAT CCA GC-3' PCR
Exon 8 2687 -> 2708 5'-GGG CTT TTG CTC CCT CTG TTC C-3' Sequencing
  3021 -> 3000 5'-TAC CCT CTA GAG AAG CAA CCA C-3' Sequencing
Exon 9 4080 -> 4102 5'-GCA ATT CAC CTC CAG TAG CTT GG-3' PCR, sequencing
  4415 -> 4394 5'-GCT GAG CGA CTG TGC TCA GCG A-3' PCR, sequencing
Exon 10 8727 -> 8748 5'-GGT TCT GGA GCC ACG TCA CCT G-3' PCR, sequencing
  9024 -> 9003 5'-ACG TGG AAA CAG CCT CCG GGT A-3' PCR, sequencing
Exon 11 8889 -> 8911 5'-GCA AGG TGG CCC TCT CCA TCA AG-3' PCR
  9487 -> 9465 5'-CAG CGG ATC GTG AAG GTG CAG TC-3' PCR
Exon 11 8913 -> 8935 5'-GAG GTC CTT TCA AAG GTG AGT GG-3' Sequencing
Introns 6-7 2294 -> 2316 5'-GAA GGG CTT TCC GGA GAaT GGG TC-3' Polymorphism screening
  2529 -> 2507 5'-CCA GAA CAC AAG GCT CAG CGC TC-3' Polymorphism screening
Exons 5-8 831 -> 853 5'-GAA CGA GCT GTG GAG AGC CAC AG-3' RT-PCR
  2801 -> 2779 5'-AAT GAC GGA GCA GAA ACC AGC CG-3' RT-PCR
aAt the seventh position from the 3'-end of this primer, a mismatch (A for C) has been introduced to abolish an AluI restriction recognition sequence.

The RnBP gene is 9340 bp long and consists of 11 exons (Fig. 1 , Table 1 ). The putative translation initiation site is at position 4 of the second exon. This position is referred to as +1 in the present publication.

Computer analysis of the 5'-untranslated region of the RnBP gene reveals a CpG island from position -512 to -232 (score 0.63, 70.5% GC, 17 CpG). One putative TATA-less promotor region was predicted with a transcription start site at position -298 (TSSW) or at position -285 (TSSG). The transcription start site has been experimentally determined before by Takahashi et al. (19 ) with a major start site at position -364 and two minor start sites at positions -319 and -312.

Table 5 . Distribution of the T61C allele (intron 6 of the RnBP gene) in 505 Caucasians
  Males (n = 293) Females (n = 212)
T 0.82  
C 0.18  
TT   0.66
TC   0.33
CC   0.01

There is one additional CpG island near the end of the long intron 9, extending from bp 8703 to 8858 (score 0.86, 60.9% GC, 12 CpG), and a putative promotor at position 8163 with a TATA box at position 8135 (TSSW and TSSG). This could represent the regulatory region of the TE2 gene, which starts 559 bp 3' of this CpG island.

We screened for common human repetitive sequence elements using the program CENSOR (28 ). The results are summarized in Table 2 . Most of the repetitive elements are located within the large introns 8 and 9. There are two pairs of nearly perfectly inverted sequences, formed by Alu repeats 3 and 5 (85%) identity) and Alu repeats 5 and 8 (90% identity) respectively. In addition, we identified five short tandem repeats within the RnBP gene, as shown in Table 3 .

Search for RnBP gene mutations by direct sequencing

We designed primers to amplify and sequence the promotor region, all 11 exons and flanking intronic sequences of the RnBP gene (Table 4 ). We selected 14 male and six female patients with familiar and/or early onset hypertension and four normotensive individuals (two males and two females) and sequenced these RnBP gene regions of putative functional significance.

In five patients (three males and two females) we identified one T -> C sequence variation 61 bp 5' of the intron 6/exon 7 boundary. This intronic polymorphism is referred to as T61C. Except for this variant, all patients and all normotensive control individuals revealed a sequence identical to the genomic sequence derived from cosmid 12B2.

Population screening for the T61C polymorphism and association study

The T61C base change in intron 6 of the RnBP gene creates a new AluI restriction site which we used to determine the allele distribution in the general population. PCR-based AluI restriction analysis (Fig. 2 ) was performed on 293 male and 212 female randomly selected Caucasian individuals (Table 5 ). The allele distribution was found to be in Hardy-Weinberg equilibrium (P = 0.2 for females, [chi]2 test).

Anthropometric characteristics of this population have been reported before in detail (29 ). Table 6 displays cardiovascular and biochemical data according to the T61C allele status after exclusion of subjects treated with antihypertensive drugs. The number of subjects on antihypertensive medication was similar in the respective genotype groups (in men: 61C allele, 29.4%, 61T allele, 23.3%; in women: 61TT allele, 18.9%, 61CT allele, 14.7%; P not significant).


Figure 2.Polymorphism screening: AluI restriction endonuclease digestion patterns after electrophoresis on 12% polyacrylamide and ethidium bromide staining. Lane 1, male individual hemizygous for the T allele; lane 2, female individual heterozygous for the C and T alleles; lane 3, male individual hemizygous for the C allele; lane 4, DNA size standard X (Boehringer); lane 5, undigested PCR product.


Figure 3. RT-PCR amplification of kidney RnBP RNA and [beta]-actin RNA. Lane 1, DNA size standard; lane 2, RnBP amplification for male individual hemizygous for the T allele; lane 3,RnBP amplification for male individual hemizygous for the C allele; lane 4, [beta]-actin amplification for male individual hemizygous for the T allele; lane 5, [beta]-actin amplification for male individual hemizygous for the C allele.

In men, no significant association was observed between the 61C allele and age, body mass index, blood pressure, heart rate or left ventricular mass index. Likewise, on average there was little difference between genotype groups with regard to circulating active renin (Table 6 ). However, prorenin levels were found to be higher in those men carrying the 61T allele (256 +- 12 versus 196 +- 15, P < 0.05), whereas the renin to prorenin ratio was higher in males with the 61C allele (10.7 +- 1.5 versus 7.7 +- 0.3%, P = 0.002). In women, before and after exclusion of those taking oestrogen replacement therapy, no significant differences were observed between respective genotype groups (data not shown).

RT-PCR

To investigate if the T61C polymorphism influences RNA splicing, RT-PCR was performed concurrently in two male subjects carrying the 61T and the 61C allele respectively (Fig. 3 ). Primers were designed to anneal to exon 5 and exon 8 sequences. An RnBP RNA transcript of the expected size (386 bp) was amplified from both individuals, indicating that the T61C polymorphism does not interfere with correct RNA splicing. RT-PCR for a [beta]-actin gene transcript served as an internal control to indicate successful reverse transcription and amplification.

Table 6 . Anthropometric and biochemical data of participants according to the T61C genotype, after exclusion of individuals taking antihypertensive drugs (n = 410)
Men T (n = 182) C (n = 35)  
Age (years) 57.5 +- 0.2 56.8 +- 0.5  
BMI (kg/m2) 27.3 +- 0.2 26.7 +- 0.7  
Heart rate (per min) 70.4 +- 1.0 72.3 +- 3  
Systolic BP (mmHg) 146 +- 1 146 +- 3  
Diastolic BP (mmHg) 91 +- 0.7 89 +- 1.7  
LVMI (g/m2) 107 +- 2 105 +- 6  
Renin (mU/L) 18.5 +- 0.9 19.7 +- 2.6  
Prorenin (mU/L) 256 +- 12 196 +- 15a  
Renin/prorenin (%) 7.7 +- 0.3 10.7 +- 1.5b  
Women TT (n = 127) TC (n = 65) CC (n = 1)
Age (years) 58,5 +- 0.5 57.1 +- 0.5 55
BMI (kg/m2) 26.8 +- 0.5 26.7 +- 0.6 23
Heart rate (per min) 71 +- 1.5 75 +- 1 69
Systolic BP (mmHg) 143 +- 2.4 143 +- 3.6 166
Diastolic BP (mmHg) 90 +- 1.5 87 +- 1.8 110
Renin (mU/L) 15.1 +- 1.1 15.5 +- 1.5 7.6
Prorenin (mU/L) 171 +- 11 181 +- 10 82
Renin/prorenin (%) 9.2+- 0.5 8.5 +- .0.7 9.3
Values are expressed as mean +- SEM; BMI, body mass index; systolic and diastolic BP, systolic and diastolic blood pressure respectively; LVMI, left ventricular mass index.
aP < 0.05.
bP = 0.002.

DISCUSSION

Large scale genomic sequencing is an efficient tool to identify human genes and to determine their genomic structure, as well as their chromosomal location with respect to other genes. The complete genomic sequence is the ideal starting point for mutation screening of candidate genes and for the search for associations with human disease.

Direct genomic sequencing of the promoter region, the 11 exons and adjacent intronic regions of the RnBP gene in 20 hypertensive individuals disclosed no sequence changes except for one intronic single base exchange polymorphism well outside the known splice consensus sites. The lack of mutations within functionally important regions of the RnBP gene suggests that structural changes in RnBP are uncommon in hypertensive patients. The search for mutations was limited to 20 Caucasian individuals with essential hypertension. The selection for this screening focussed on those individuals with a positive family history compatible with X chromosomal inheritance and/or early onset of hypertension. Thus, we concentrated our search on patients with a fair chance of displaying alterations in an X chromosomal gene involved in blood pressure regulation. Nevertheless, we may have missed mutations that may occur only in a subset of patients (e.g. mild hypertension in older patients) or in other ethnic groups.

Although the detection of heterozygous sequence signals in female individuals can be complicated with fluorescent dye terminator sequencing, it seems highly unlikely that sequence changes have been missed because both strands were sequenced at least once in both directions. However, sequence variants within 5' or 3' regulatory regions cannot be excluded by our studies.

The identification of a common polymorphism within intron 6 provided the basis for a large population-based study to further investigate the role of the RnBP gene in hypertension and to possibly detect other phenotypes associated with this gene locus. In contrast to studies investigating dichotomous traits (i.e. hypertensive versus normotensive populations), this approach covers a wide spectrum of blood pressure levels and allows inclusion of other intermediate phenotypes, i.e. enzyme activities. Thus, this protocol may be much more sensitive in uncovering potential effects of RnBP, provided that the genetic marker is associated with a structural or quantitative alteration of a protein that affects these phenotypes.

Interestingly, we observed that men carrying the 61T allele displayed higher circulating prorenin levels, with no changes in active renin or blood pressure levels. An association study such as this falls short of elucidating the mechanism of this observation. However, given the known biochemical effects of the protein one may propose a hypothesis that may explain the lower level of prorenin in men carrying the 61C allele. First, circulating renin levels are known to be under tight control, including a negative feedback loop that down-regulates expression of the renin gene via angiotensin II. Second, RnBP has not yet been detected in serum, so that the protein may not alter circulating renin levels. However, men with the 61C allele may express less RnBP and therefore display less renin sequestration within the renin-producing juxtaglomerular cells. Via a negative feedback loop, this may relate to a reduction in renin gene expression and constitutively secreted prorenin levels. These data are in good agreement with the proposed biochemical action of RnBP. The level of significance for the observed association between the renin/prorenin ratio and the 61C/T allele status in men (P = 0.002) makes a type 1 mistake unlikely. Taken together, RnBP may indeed participate in renin processing within juxtaglomerular cells. We were, however, unable to obtain direct evidence that RnBP may be involved in the regulation of circulating renin and, thus, the pathophysiology of essential hypertension.

From a molecular genetic point of view, one possible explanation for the observed association is that the intron 6 polymorphism is in linkage disequilibrium with functionally important sequence variants adjacent to the investigated RnPB gene regions. Differential splicing related to the intronic polymorphism as a potential mechanism for altered levels of RnBP was excluded in this study. Therefore, the association between T61C allele status of the RnBP gene and the renin/prorenin ratio in men should be corroborated by analyses of renal RnBP mRNA levels and replicated in other populations before definitive conclusions can be derived.

Since only one woman was found to be homozygous for the 61C allele, no statement can be made about an association between the RnBP gene and cardiovascular parameters in women.

To our knowledge, the present investigation is the first on the role of the RnBP gene in hypertension. Although we observed no association between the RnBP gene and blood pressure, we point out that these results are not definitive and additional data should be obtained in populations with a different genetic background. The complete sequence and precise localization of the RnBP gene, provided in this study, as well as the identification of an intronic polymorphism and short tandem repeats which might prove to be polymorphic, will facilitate further investigations on the molecular genetics and pathophysiological significance of the RnBP gene.

MATERIAL AND METHODS

Cosmid sequencing

The cosmid 12B2 was prepared and sequenced as previously described by Craxton (30 ). In brief, after sonication of the DNA, a 0.8-1.4 kb fraction was subcloned into the SmaI site of M13mp18. M13 templates were prepared with magnetic bead technology and sequenced using dye primer chemistry. The raw data were collected using ABI 373 A automated sequencers and assembled with the XBAP program (31 ). Gaps were closed with custom primers on M13 templates, PCR products or cosmid DNA in combination with Taq dye terminator chemistry (Perkin Elmer) or internal labelling (Pharmacia).

Computer analysis

Homology searches against the EMBL database were performed with BLAST v.1.4 (32 ), and FASTA v.2.0 (33 ). The gene prediction programs GRAIL (34 ) and XPOUND (35 ) were utilized and sequence alignments used the Global Alignment Program (GAP) (36 ). For promotor prediction the computer program Transcription Start Site, using both the Ghosh/Prestridge (TSSG) and Wingender (TSSW) motif databases (V.V.Solovyev, A.A.Salamov and C.B.Lawrence, personal communication), was applied. Human repetitive elements were identified with CENSOR (28 ).

Search for RnBP mutations by genomic sequencing

DNA was isolated from EDTA/blood using the Quiamp Kit (Qiagen).PCR. Intronic PCR primers were designed (Table 4 ) to amplify the promoter region and each exon, including the adjacent intronic sequences. PCR amplification was performed using the following conditions (except exons 8 and 11): 300 ng DNA, 250 [mu]M each dNTP, 0.5 [mu]M each primer, 1.5 (promoter and exons 2, 5, 6 and 7), 2.125 (exons 1 and 3), 2.25 (exon 10) or 2.75 mM (exons 4 and 9) MgCl2, 50 mM KCl, 10 mM Tris-HCl, pH 8.3, and 1.25 U Taq polymerase in a total volume of 50 [mu]l. To increase effectivness, promoter + exons 1 + 2 and exons 3 + 4 + 5 could also be amplified as continguous segments, using MgCl2 concentrations of 3.375 and 4 mM respectively. After an initial denaturation step of 1 min at 95oC, each of 35 cycles consisted of 1 min at 95oC, 2 min at 65oC and 3 min at 72oC.

Exons 8 and 11 were amplified using 300 ng DNA, 350 [mu]M dATP, 350 [mu]M dCTP, 350 [mu]M dTTP, 250 [mu]M dGTP, 300 [mu]M dITP, 0.5 mM each primer, 4 mM MgCl2, 0.02% NP-40, 0.02% Tween 20, 42 [mu]M 2-mercaptoethanol, 16.2 mM Tris-HCl, pH 9.5, and 16 U Thermosequenase (Amersham Life Science Inc.) in a total volume of 50 [mu]l and the following cycling conditions: 1 min at 98oC, 2 min at 68oC and 3 min at 72oC for 35 cycles.Precipitation with PEG. Polyethylene glycol (52.4 g PEG 8000, 40 ml 3 M NaOAc, pH 5.2, 1.32 ml 1 M MgCl2 in a total volume of 200 ml) was used to remove unincorporated dNTPs and primers from the PCR product. The concentration of the recovered PCR product was estimated by ethidium bromide staining after agarose gel electrophoresis.Cycle sequencing. This was performed for the promoter and each exon in both directions with either the PCR primers or internal primers (Table 4 ) using 30 ng PCR product and the Taq Dye Terminator protocol (ABI, Perkin-Elmer) on an ABI 373 A automated sequencer. The sequences obtained from each patient were compared with the genomic sequence derived from cosmid 12B2 using DNAstar software (DNAstar, Wisconsin).

Screening by AluI restriction

PCR primers were designed to amplify a 236 bp fragment spanning the polymorphic site, which creates a novel AluI recognition sequence (AGTT -> AGCT). An AluI recognition site only 15 bp away from the polymorphism was abolished by the introduction of a mismatch into the forward primer at the seventh position from its 3'-end. An additional AluI recognition site within the PCR fragment served as an internal control for successful digestion into 132 and 104 bp fragments. PCR was performed with 300 ng DNA isolated from blood leukocytes, 250 [mu]M each dNTP, 0.5 [mu]M each primer, 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris, pH 8.3, and 0.5 U Taq polymerase in a total volume of 20 [mu]l. After an initial denaturation step of 4 min at 94oC, 35 cycles consisted of 1 min at 95oC, 2 min at 68oC and 3 min at 72oC.

Aliquots of 10 [mu]l PCR product were then incubated with 2 U AluI restriction enzyme (Boehringer Mannheim) in the buffer recommended by the manufacturer at 37oC for 2 h. The restriction products were subjected to electrophoresis on a 12% polyacrylamide minigel and stained with ethidium bromide. The T allele was detected by the presence of 132 and 104 bp fragments, the C allele by the presence of 132, 74 and 30 bp fragments (Fig. 2 ).

RT-PCR

DNA and RNA were isolated from frozen surgical kidney specimens using the Quiamp Tissue Kit and the Rneasy Kit respectively (Qiagen). After screening the DNA for the T61C polymorphism, RT-PCR was performed on RNA from two male individuals hemizygous for each allele . Primers weresynthesized to anneal to exon 5 and exon 8 sequences (Table 4 ). Aliquots of 500 ng total RNA were incubated with 1 [mu]g reverse primer, 10 mmol each dNTP, 2 [mu]l 0.1 M DTT, 4 ml 5* first strand buffer and 100 U Superscripttm II RT (Gibco-BRL) in a total volume of 20 [mu]l at 50oC for 45 min. After RNA digestion with 1 [mu]l RNase A for 15 min at 37oC, PCR was performed by adding 70 [mu]l H2O, 8 [mu]l 10* PCR buffer, 1 [mu]g forward primer and 2.5 U Taq polymerase (Boehringer), with 25 cycles of 1 min at 95oC, 2 min at 62oC and 3 min at 72oC. As an internal control RT-PCR was performed for [beta]-actin, with 25 cycles of 45 s at 94oC, 30 s at 55oC and 1 min at 72oC (Fig. 3 ).

Biochemical measurements

Blood was drawn from non-fasting subjects who were in a supine resting position for at least 30 min. Immunoreactive renin was quantified in 200 [mu]l plasma using an immunoradiometric assay kit (Nichols Institute, Wychen, The Netherlands), following the methods proposed by Derkx et al. (37 ). Cross-reactivity of the monoclonal renin antibody with prorenin is ~1%. The concentration of prorenin was calculated by subtracting the results obtained before activation of prorenin (i.e. active renin) from those obtained after activation (i.e. total renin). Prorenin was activated non-proteolytically, using the renin inhibitor remikiren. Results are expressed as mU/l using the international reference preparation 68/356 as standard (37 ).

Subjects screened for mutations in the RnBP gene

After giving informed consent, four normotensive Caucasian individuals (two males) as well as 20 Caucasian patients with essential hypertension (14 males) were screened for mutations within the RnBP gene. Hypertension was defined as a blood pressure >= 160/95 mmHg on more than three occasions or chronic intake of antihypertensive medication. The absence of secondary hypertension was excluded by a thorough clinical work-up. The onset of hypertension was before the age of 50 in all 20 patients. No patient reported excessive alcohol intake, oral contraception, diabetes mellitus or renal failure. There was a positive family history of hypertension compatible with X chromosomal inheritance in 14 of the patients (nine males, five females).

Population screened for the intronic T61C polymorphism

The subjects of this protocol had initially participated in the MONICA (Multinational Monitoring of Trends and Determinants in Cardiovascular Disease), Augsburg, baseline survey of 1984/85 and its follow-up examination in 1987/88 (38 ). Subjects originate from a sex/age-stratified random sample of all German residents of the Augsburg study area. In 1994 a second follow-up examination, including echocardiographic, biochemical and anthropometric measurements, was offered to a total of 1010 men and women aged 52-65 years, of whom 646 (64%) attended.

All subjects responded to a questionnaire on medical history, physical activities, medication and personal habits. Height and weight were recorded in light clothing and body mass index was computed as weight divided by height (kg/m2). Resting blood pressure was measured after subjects maintained a sitting position for a minimum of 30 min. Using a mercury sphygmomanometer, blood pressure was read three times on the right arm by two investigators. The mean of three measurements was used for this study. Two-dimensional guided M-mode echocardiograms were recorded on strip chart paper at 50 mm/s (Sonos 1500; Hewlett Packard Inc.). Only tracings that demonstrated optimal visualization of left ventricular interference were used, a requirement that resulted in exclusion of 17% of potential subjects. All M-mode tracings were analysed by a single cardiologist who was blind as to clinical and biochemical data. Measurements for M-mode guided calculation of left ventricular mass were taken just below the tip of the mitral valve. Left ventricular internal end-diastolic (EDD) and end-systolic dimensions (ESD) and septal (sWth) and posterior wall thickness (pWth) were measured according to the guidelines of the American Society of Echocardiography (39 ). Left ventricular mass (LVM) was calculated from M-mode echocardiograms according to the formula

 LVM M-mode (g) = 0.8 (1.04 [EDD +sWth + pWth]3 - EDD3) + 0.6 g

(40 ). LVM was indexed to body surface area as LVMI (g/m2 body surface area).

Statistical analyses

Anthropometric and biochemical data were compared between subjects with the 61T and 61C alleles by ANOVA for the comparison of independent samples. In the case of comparisons between classified values, e.g. comparisons between T61C allele status and drug intake, [chi]2 tests were performed. Subjects taking antihypertensive drugs were excluded from the analyses of potential associations between RnBP allele status and renin, prorenin or other cardiovascular parameters because these drugs either decrease ([beta]-blockers) or increase (ACE inhibitors, diuretics, calcium channel blockers) renin levels. P values are reported for each test and statistical model.

ACKNOWLEDGEMENTS

We thank Drs A.Bosserhoff, A.Hartmann, H.-W.Hense and S.S.Sommer for many helpful discussions and suggestions regarding this manuscript and Drs F.Hofstädter and R.Büttner for generously supporting this work.

ABBREVIATION

RnBP, renin binding protein.

REFERENCES

1 James,G.D. and Baker,P.T. (1990) In Laragh,J.H. and Brenner,B.M. (eds), Hypertension: Pathophysiology, Diagnosis, and Management. Raven Press, New York, NY, pp. 137-145.

2 Kurtz,T.W. and Spence,M.A. (1993) Genetics of essential hypertension. Am. J. Med., 94, 77-84. MEDLINE Abstract

3 Lifton,R.P. (1995) Genetic determinants of human hypertension. Proc. Natl. Acad. Sci. USA, 92, 8545-8551. MEDLINE Abstract

4 Ward,R. (1990) In Laragh,J.H. and Brenner,B.M. (eds), Hypertension: Pathophysiology, Diagnosis, and Management. Raven Press, New York, NY, pp. 81-100.

5 Jeunemaitre,X., Soubrier,F., Kotelevtsev,Y.V., Lifton,R.P., Williams,C.S., Charru,A., Hunt,S.C., Hopkins,P.N., Williams,R.R., Lalouel,J.M. and Corvol,P. (1992) Molecular basis of human hypertension: role of angiotensinogen. Cell, 71, 169-180. MEDLINE Abstract

6 Iwai,N., Shimoike,H., Ohmichi,N. and Kinoshita,M. (1995) Angiotensinogen gene and blood pressure in the Japanese population. Hypertension, 25, 688-693. MEDLINE Abstract

7 Ward,K., Hata,A., Jeunemaitre,X., Helin,C., Nelson,L., Namikawa,C., Farrington,P.F., Ogasawara,M., Suzumori,K., Tomoda,S., Berrebi,S., Sasaki,M., Corvol,P. and Lifton,R.P. (1993) A molecular variant of angiotensinogen associated with preeclampsia. Nature Genet., 4, 59-61. MEDLINE Abstract

8 Cambien,F., Poirier,O., Lecerf,L., Evans,A., Cambou,J.P., Arveiler,D., Luc,G., Bard,J.M., Bara,L., Ricard,S., Tiret,L., Amoyel,P., Alhenc-Gelas,F. and Soubrier,F. (1992) Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature, 359, 641-644. MEDLINE Abstract

8 Leatham,E., Barley,J., Redwood,S., Hussein,W., Carter,N., Jeffery,S., Bath,P.M. and Camm,A. (1994) Angiotensin-1 converting enzyme (ACE) polymorphism in patients presenting with myocardial infarction or unstable angina. J. Hum. Hypertension, 8, 635-638.

10 Tiret,L., Bonnardeaux,A., Poirier,O., Ricard,S., Marques-Vidal,P., Evans,A., Arveiler,D., Luc,G., Kee,F., Ducimetiere,P., Soubrier,F. and Cambien,F. (1994) Synergistic effects of angiotensin-converting enzyme and angiotensin-II type 1 receptor gene polymorphisms on risk of myocardial infarction. Lancet, 344, 910-913. MEDLINE Abstract

11 Morris,B.J., Zee,R.Y. and Schrader,A.P. (1994) Different frequencies of angiotensin-converting enzyme genotypes in older hypertensive individuals. J. Clin. Invest., 94, 1085-1089. MEDLINE Abstract

12 Harrap,S.B., Davidson,H.R., Connor,J.M., Soubrier,F., Corvol,P., Fraser,R., Foy,C.J. and Watt,G.C. (1993) The angiotensin I converting enzyme gene and predisposition to high blood pressure. Hypertension, 21, 455-460. MEDLINE Abstract

13 Tiret,L., Rigat,B., Visvikis,S., Breda,C., Corvol,P., Cambien,F. and Soubrier,F. (1992) Evidence, from combined segregation and linkage analysis, that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. Am. J. Hum. Genet., 51, 197-205. MEDLINE Abstract

14 Schmidt,S., van Hooft,I.M., Grobbee,D.E., Ganten,D. and Ritz, E. (1993) Polymorphism of the angiotensin I converting enzyme gene is apparently not related to high blood pressure: Dutch Hypertension and Offspring Study. J. Hypertension, 11, 345-348.

15 Naftilan,A.J., Williams,R., Burt,D., Paul,M., Pratt,R.E., , Chirgwin,J. and Dzau,V.D. (1989) A lack of genetic linkage of renin gene restriction fragment length polymorphisms with human hypertension. Hypertension, 14, 614-618. MEDLINE Abstract

16 Soubrier,F., Jeunemaitre,X., Rigat,B., Houot,A., Cambien,F. and Corvol, P. (1990) Similar frequencies of renin gene restriction fragment length polymorphisms in hypertensive and normotensive subjects. Hypertension, 16, 712-717. MEDLINE Abstract

17 Zee,R.Y., Ying,L.H., Morris,B.J. and Griffiths, L.R. (1991) Association and linkage analyses of restriction fragment length polymorphisms for the human renin and antithrombin III genes in essential hypertension. J. Hypertension, 9, 825-830.

18 Takahashi,S.H., Fukui,K. and Miyake,Y. (1994) Structure and function of renin binding protein. Kidney Internatl, 46, 1525-1527.

19 Takahashi,S., Inoue,H. and Miyake,Y. (1992) The human gene for renin-binding protein. J. Biol. Chem., 267, 13007-13013. MEDLINE Abstract

20 Maru, I.,Ohta,Y., Murata,K. and Tsukada,Y. (1996) Molecular cloning and identification of N-acyl-D-glucosamine 2-epimerase from porcine kidney as a renin-binding protein. J. Biol. Chem., 271, 16294-16299.

21 Tribioli,C., Mancini,M., Plassart,E., Bione,S., Rivella,S., Sala,C., Torri,G. and Toniolo,D. (1994) Isolation of new genes in distal Xq28: transcriptional map and identification of a human homologue of the ARD1 N-acetyl transferase of Saccharomyces cerevisiae. Hum. Mol. Genet., 3, 1061-1067.

22 Faranda,S., Frattini,A. and Vezzoni,P. (1995) The human genes encoding renin-binding protein and host cell factor are closely linked in Xq28 and transcribed in the same direction. Gene, 155, 237-239. MEDLINE Abstract

23 Frattini,A., Faranda,S., Redolfi,E., Zucchi,I., Villa,A., Patrosso,M.C., Strina D., Susani,L. and Vezzoni, P. (1994) Genomic organization of the human VP16 accessory protein, a housekeeping gene (HCFC1) mapping to Xq28. Genomics, 23, 30-35. MEDLINE Abstract

24 van den Ouweland,A.M.W., Verdijk,M., Kiochis,P., Poustka,A. and van Oost,B.A. (1994) The human renin-binding protein (RENBP) maps in Xq28. Genomics, 21, 279-281.

25 Wilson,A.C., Parrish,J.E., Massa,H.F., Nelson,D.L., Trask,B.J. and Herr,W. (1995) The gene encoding the VP16-accessory protein HCF (HCFC1) resides in human Xq28 and is highly expressed in fetal tissues and the adult kidney. Genomics, 25, 462-468. MEDLINE Abstract

26 National Center for Health Statistics. (1982) In Rowland,M. and Roberts,G. (eds), The National Health and Nutrition Examination Survey II (NHANES II). Public Health Service, Rockville, MD, pp. 1-84.

27 Whelton,P.K. (1994) Epidemiology of hypertension. Lancet, 344, 101-106. MEDLINE Abstract

28 Jurka,J., Klonowski,P., Dagman,V. and Pelton,P. (1996) CENSOR-a program for identification and elimination of repetitive elements from DNA sequences. Comput. Chem., 20, 119-121. MEDLINE Abstract

29 Schunkert,H., Hense,H.W., Muscholl,M., Luchner,A. and Riegger,G.A.J. (1996) Association of angiotensin converting enzyme activity and arterial blood pressure in a population based sample. J. Hypertension, 14, 571-575.

30 Craxton,M. (1993) In Griffin,H. and Griffin,A. (eds), DNA Sequencing Protocols. Humana Press, pp. 149-167.

31 Dear,S. and Staden,R. (1991) A sequence assembly and editing program for efficient management of large projects. Nucleic Acids Res., 19, 3907-3911. MEDLINE Abstract

32 Altschul,S.F., Gish,W., Miller,W., Myers,E.W. and Lipman,D.J. (1990) Basic local alignment search tool. J. Mol. Biol., 215, 403-410. MEDLINE Abstract

33 Pearson,W.R. and Lipman, D.J. (1988) Improved tools for biological sequence comparison. Proc. Natl Acad. Sci. USA, 85, 2444-2448. MEDLINE Abstract

34 Uberbacher,E.C. and Mural, R.J. (1991) Locating protein-coding regions in human DNA sequences by a multiple sensor-neural network approach. Proc. Natl. Acad. Sci. USA, 88, 11261-11265. MEDLINE Abstract

35 Thomas,A., Skolnick,M.H. and Lewis,C.M. (1994) Genomic mismatch scanning in pedigrees. IMA J. Math. Appl. Med. Biol., 11, 1-16. MEDLINE Abstract

36 Huang,X. (1994) On global sequence alignment. Comput. Appl. Biosci., 10, 227-235. MEDLINE Abstract

37 Derkx,F.H., de Bruin,R.J., van Gool,J.M., van den Hoek,M.J., Beerendonk,C.C., Rosmalen,F., Haima,P. and Schalekamp, M.A. (1996) Clinical validation of renin monoclonal antibody-based sandwich assays of renin and prorenin, and use of renin inhibitor to enhance prorenin immunoreactivity. Clin. Chem., 42, 1051-1063. MEDLINE Abstract

38 Keil,U., Stieber,J., Döring,A., Härtel,U., Filipatrik,B. and Hense,H.W. (1988) The cardiovascular risk profile in the study area Augsburg: results from the first MONICA survey 1984-1985. Acta Med. Scand., 728(suppl.), 119-128.

39 Sahn,D., DeMaria,A., Kisslo,J. and Weymann,A. (1978) The committee on M-mode standardization of the American Society of Echocardiography: results on a survy of echocardiographic measurements. Circulation, 58, 1072-1083. MEDLINE Abstract

40 Devereux,R.B., Koren,M.J., deSimone,P., Okin,N. and Klingfield,P. (1993) Methods for detection of left ventricular hypertrophy: application to hypertensive heart disease. Eur. Heart J., 14 (suppl. D), 8-15. MEDLINE Abstract


Top

*To whom correspondence should be addressed. Tel: +49 3641 656 241; Fax: +49 3641 656 255; Email: arosenth@imb-jena.de

-->
This page is maintained by OUP admin. Last updated Wed Aug 13 15:52:16 BST 1997. Part of the OUP Journals World Wide Web service. Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J BiochemHome page
S. Takahashi, K. Hori, H. Ogasawara, K. Hiwatashi, and T. Sugiyama
Effects of Nucleotides on the Interaction of Renin with GlcNAc 2-Epimerase (Renin Binding Protein, RnBP)
J. Biochem., November 1, 2006; 140(5): 725 - 730.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Fischer, A. Baessler, and H. Schunkert
Renin angiotensin system and gender differences in the cardiovascular system
Cardiovasc Res, February 15, 2002; 53(3): 672 - 677.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. Engeli, R. Negrel, and A. M. Sharma
Physiology and Pathophysiology of the Adipose Tissue Renin-Angiotensin System
Hypertension, June 1, 2000; 35(6): 1270 - 1277.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Schmitz, M. Gotthardt, S. Hinderlich, J.-R. Leheste, V. Gross, H. Vorum, E. I. Christensen, F. C. Luft, S. Takahashi, and T. E. Willnow
Normal Blood Pressure and Plasma Renin Activity in Mice Lacking the Renin-binding Protein, a Cellular Renin Inhibitor
J. Biol. Chem., May 12, 2000; 275(20): 15357 - 15362.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Knoll, A.
Right arrow Articles by Rosenthal, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knoll, A.
Right arrow Articles by Rosenthal, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?