Reconstructing hominid Y evolution: X-homologous block, created by X-Y transposition, was disrupted by Yp inversion through LINE-LINE recombination
Reconstructing hominid Y evolution: X-homologous block, created by X-Y transposition, was disrupted by Yp inversion through LINE-LINE recombinationAmy Schwartz1, David C. Chan1, Laura G. Brown1, Raaji Alagappan1, Dorothy Pettay1, Christine Disteche2, Barbara McGillivray3, Albert de la Chapelle4,+ and David C. Page1,*
1Howard Hughes Medical Institute, Whitehead Institute and Department of Biology, Massachusetts Institute of Technology, 9 Cambridge Center, Cambridge, MA02142, USA, 2Departments of Pathology and Medicine, University of Washington, Box 357470, Seattle, WA 98195, USA, 3University of British Columbia Clinical Genetics Unit, Vancouver, British Columbia V6H 3V5, Canada and 4Folkhälsan Institute of Genetics, and Department of Medical Genetics, University of Helsinki, Helsinki, Finland
Received July 30, 1997;Revised and Accepted October 14, 1997
The human X and Y chromosomes share many blocks of similar DNA sequence. We conducted mapping and nucleotide sequencing studies of extensive, multi-megabase homologies between Yp and Xq21, which do not recombine during male meiosis. We confirmed and built upon previous evidence that a Yp inversion had occurred during evolution: a single contiguous segment of Xq21 is homologous to two non-contiguous segments of Yp. We precisely defined and sequenced the inversion breakpoints, obtaining evidence that the inversion was mediated by recombination between LINE-1 elements in otherwise non-homologous regions. This inversion appears to have followed a single transposition of an ~4 Mb segment from the X to the Y chromosome. These events jointly account for the present arrangement of Yp-Xq21 homologous sequences. Based on Southern blotting studies of primates and of humans drawn from diverse populations, we conclude that both the X-Y transposition and the subsequent, LINE-mediated Yp inversion occurred after the divergence of hominid and chimp lineages but before the radiation of extant human populations. This evolutionary scenario is consistent with our finding of 99.3 ± 0.2% nucleotide identity between the X and Y chromosomes within the transposed region, which suggests that the transposition occurred ~3-4 million years ago, near the time of emergence of Homo. Comparative sequencing of the entire human X and Y chromosomes may reveal a succession of transpositions, inversions and other rearrangements underlying the complex pattern of sequence similarities between the present-day sex chromosomes. With the possible exception of cubitus valgus, phenotypic features of Turner syndrome are absent in individuals monosomic for Yp-Xq21 homologous sequences, suggesting that most of the critical `Turner genes' are found elsewhere on the X and Y chromosomes.
Nucleotide sequence similarities between the human X andY chromosomes are extensive, totaling at least one quarter of the Y chromosome's euchromatic regions (1 ,2 ). Of these 8-10 Mb of X-Y homologous sequences, only 3 Mb comprise the pseudoautosomal regions (pter and qter), where frequent X-Y recombination during male meiosis ensures co-linearity of sequence between the sex chromosomes (3 -8 ). The majority of X-Y homologous sequences are located in the strictly sex-linked regions, from which X-Y recombination is normally excluded. Within these regions, there are at least a dozen blocks of X-Y sequence similarity, which occur in a strikingly different order (and orientation) on the Y as opposed to the X chromosome (9 ). To account for this complex array of sequence similarities between the strictly sex-linked regions of the X and Y, investigators have postulated the occurrence of numerous inversions, transpositions and other rearrangements during primate evolution (10 -15 ). However, in no case have the postulated rearrangements been reconstructed through nucleotide sequence analysis of breakpoints.
On the human X chromosome, the largest single block of Y-homologous DNA sequence, and the first to have been discovered, is in band q21 (10 ,15 -20 ). Spanning ~4 Mb, these Xq21 sequences are highly similar to sequences on Yp. At least some of these Xq21-homologous sequences are present on Yp by virtue of an X-Y transposition that occurred during human evolution, after divergence of human from chimpanzee and gorilla lineages (10 ,13 ,18 ). However, while the Y-homologous sequences form a single contiguous block in Xq21, the corresponding sequences on Yp are divided into two non-contiguous segments separated by several megabases of Y-specific DNA (2 ,13 , 15 ,19 ,20 ). This bipartite arrangement of Xq21-homologous sequences on Yp can be explained most economically by a single transposition followed by a Yp inversion (13 ,15 ). We set out to reconstruct conclusively the evolutionary history of these extensive Xq21-Yp homologies by comparative nucleotide sequence analysis of the human sex chromosomes at selected sites within and bordering the homologous regions.
aNote: X-Y common STSs (shown here with prefix `sXY') are numbered according to Vollrath et al., 1992 (ref. 1) (where prefix was `sY'); e.g. sXY20 is identical to sY20. bHybridization stringency conditions: H, high; M, medium; P, pre-hybridization of probe followed by high stringency hybridization (see Materials and Methods).
. X- or Y-specific PCR assays at X-Y homologous loci
STS
X- or Y-specific primer
X-Y common primer
Product size (bp)
Relationship to primary amplificationa
sXY22-X
GGGAAGAATGAAAGGAAAG
TGGGCATCTTGGAAATCAA
145
nested
sXY22-Y
.......C..........A
...................
-
nested
sXY28-X
ACTGTGTGAAACATCCTAC
GATTAAAACAAGGCAATGG
152
nested
sXY28-Y
..................G
...................
-
nested
sXY29-X
GTATGTAGTTTTCGGTATG
ATATTTGCTTCCCTTTTCA
190
nested
sXY29-Y
..................A
...................
-
nested
sXY37-X
TTTTGTATACCCATAACTTT
TATGTGTTAGCCCTTCTTT
137
none
sXY37-Y
CCAAAATAATCTATTTCTCT
...................
120
none
sXY38-X
CATTTTTAATTCTTCTATGTT
ATGCTGCTGTGTTTCTGTGT
141
semi-nested
sXY38-Y
....................C
....................
-
semi-nested
sXY43-X
GGGTTGAAATAAACTGTGC
GAGAAGGAAGAATGTGAAA
162
nested
sXY43-Y
..................T
...................
-
nested
sXY47-X
TGGAGGTTGGAGATCTAC
ATCTGTGAAGCACCCACTGT
93
semi-nested
sXY47-Y
.................T
....................
-
semi-nested
sXY48-X
GGAGAACAGTATAGAGGT
TTGGACACTTAGATTGCT
185
nested
sXY48-Y
.................A
..................
-
nested
X (or Y)-specific primers bear a mismatch at the 3' end with the homologous sequence on the Y (or X) chromosome.
aSee Materials and Methods for explanation of nested and semi-nested assays.
We and our colleagues have been constructing and refining DNA-probe-based deletion and physical maps of the human Y chromosome for some years (1 ,2 ,19 ) (unpublished results). Most of the DNA markers employed in constructing these maps have been derived, essentially at random, from recombinant DNA libraries prepared from flow-sorted Y chromosomes. During the course of this work, we identified a large number of X-Y homologous markers, 46 of which we could assign to Yp and Xq21 (Tables 1 and 2 ). These 46 loci appear to be specific to Yp and Xq21, with no close homologs elsewhere on sex chromosomes or autosomes. On the Y chromosome, we mapped these loci to the short arm by: (i) deletion analysis [usually by Southern blotting; in some cases by PCR-based sequence tagged sites (STS) content mapping] of human XX males, XY females and other individuals carrying partial Y chromosomes (Fig. 1 A); and (ii) STS content analysis of a collection of yeast artificial chromosomes (YACs) spanning the euchromatic region of the Y chromosome (2 ). On the X chromosome, we mapped these loci to band q21 by: (i) deletion analysis (by Southern blotting) of human XY males with choroideremia (an X-linked recessive disorder) due to interstitial deletions of Xq21 (Fig. 1 C); and (ii) STS content analysis of X-chromosomal YAC and bacterial artificial chromosome (BAC) clones identified by screening human genomic libraries with previously assigned Yp-Xq21 probes (not shown). Some of the resulting data on Yp-Xq21 loci have been published previously (1 ,2 ,19 ).
In the pseudoautosomal regions, meiotic recombination ensures nucleotide sequence identity between the X and Y chromosomes. The Yp-Xq21 homologies fall outside the pseudoautosomal regions, however, and here the sequences of the two chromosomes are similar but not identical (10 ,13 ,17 ,18 ). Indeed, without occasional X-Y sequence differences, it would have been very difficult to carry out deletion mapping studies of the Yp-Xq21 loci using genomic DNAs from individuals with partially deleted X or Y chromosomes. According to the transposition/inversion model, the Yp-Xq21 homologous sequences on the ancestral X and Y chromosomes should have been identical, or nearly so, immediately following the postulated X-Y transposition event, with subsequent fixation of neutral mutations on either the X or the Y accounting for the modest sequence differences observed between the present-day sex chromosomes. If Xq-homologous sequences in both distal and proximal Yp (intervals 1-2-3 and 4A, respectively) were brought to the Y by a single transposition, then one would expect a similar level of X-Y sequence divergence throughout both segments.
To test this `molecular clock' prediction, we compared the nucleotide sequence of the X and Y chromosomes at 27 STSs (Table 1 ): 25 drawn from distal Yp (the 1-2-3 block) and two drawn from proximal Yp (interval 4A), all 27 of which have homologs in Xq21. In aggregate, we directly compared nearly 5000 nucleotides from each of the two sex chromosomes. As predicted, we observed a relatively uniform level of X-Y nucleotide divergence (average 0.7 ± 0.2%) throughout the sequences examined (Table 1 ). In particular, the levels of X-Y divergence were statistically indistinguishable in the 1-2-3 (distal) and 4A (proximal) regions (0.7 ± 0.2% and 1.0 ± 0.5%, respectively).
These direct measures of X-Y divergence are in good agreement with our previous estimates at DXYS1 (a locus in the proximal region), where comparative restriction mapping of the X and Y chromosomes had yielded an estimate of 0.4 ± 0.4% nucleotide divergence (10 ). Our findings agree less well with the conclusions of Lambson and colleagues (13 ), who, on the basis of comparative restriction fragment analysis of seven loci, estimated Xq21-Yp divergence to be 2%. We think it likely that Lambson and colleagues overestimated the degree of X-Y divergence by: (i) underestimating the number of nucleotides screened for X-Y differences (23 ); and (ii) including in their analysis the restriction enzymes TaqI and MspI, whose sites are known to be hypermutable (24 ). To our knowledge, the ~99.3% X-Y identity observed in the Yp-Xq21 region sets these sequences apart from all other identified, sizeable X-Y homologies, which exhibit either absolute identity (the pseudoautosomal regions) or no more than 98% identity between the sex chromosomes (25 ). These molecular clock studies are consistent with a single transposition.
Susbsequent to the transposition from Xq to Yp, an inversion or other rearrangement on Yp must have occurred to account for the bipartite structure of Xq21-homologous sequences there (13 ,15 ) (Fig. 2 ). As we will describe here, studies of the boundaries of the X-Y homologous regions enabled us to identify the Yp inversion breakpoints, thereby securing compelling evidence for the postulated single transposition/inversion sequence.
The most distal boundary of Xq21 homology, in Y deletion interval 1, was localized during the course of a chromosome walk through the sex-determining region of the Y chromosome (see Figure 1 of ref. 26 ). This chromosome walk, initiated at an X-Y homologous locus defined by probe pDP307 (in deletion interval 1B), extended distally into a 300 kb region (deletion interval 1A) that consists largely of Y-specific sequences, that contains the genes ZFY, RPS4Y and SRY, and that lies immediately proximal to the pter pseudoautosomal region. About 5 kb distal to the pDP307 locus, we had noted an abrupt transition from X-homologous to Y-specific DNA sequences (see Figure 2 of ref. 26 ).
To corroborate and characterize this distal boundary of X-Y homology, we compared corresponding X- and Y-derived clones isolated from [lambda] phage libraries of human genomic DNA. [X-derived clones were isolated from a library prepared from a 46,XX female. Y-derived clones were isolated from a library prepared from a 49,XYYYY male (20 ).] We compared the X- and Y-derived phages by cross-hybridization, by hybridization of subclones and other purified insert fragments to Southern blots of selected human and ape male and female genomic DNAs (e.g. Fig. 3 ), and by restriction mapping of plasmid subclones (e.g. Fig. 4 A). As expected, this analysis revealed that the Y chromosome DNA sequences are highly and continuously similar to Xq21 until ~5 kb distal to the pDP307 locus. Sequences proximal to this point readily cross-hybridized to their X homologs (e.g. probe pDP307 in Fig. 3 ). As predicted, more distal sequences on Yp showed no evidence of X homology in humans, chimps or gorillas, but are conserved on the Y chromosome among apes (e.g. probe [lambda]OX18-H3.5 in Fig. 3 ).
When during mammalian evolution did the X-Y transposition and the subsequent Yp inversion occur? By quantitative Southern blotting studies of human and ape genomic DNAs, we previously had demonstrated that the DXYS1 locus is present on human Yp (in interval 4A) by virtue of an X-Y transposition that occurred after the divergence of the human and chimpanzee lineages (10 ). If the entirety of the Xq21-Yp homology resulted from a single X-Y transposition, then one would expect parallel findings when hybridizing other Xq21-Yp probes to Southern blots of human and ape genomic DNAs. Indeed, our laboratory and others have obtained similar results for other human Xq21-Yp loci, including several in the distal Yp (interval 1-2-3) block (13 ) (e.g. pDP307 and pDP1015 in Fig. 3 ). These results confirm that the X-Y transposition responsible for this extensive X-Y homology occurred after the divergence of the human line from that of our closest extant relatives, chimpanzees-a split that is thought to have occurred between 4 and 8 million years (Myr) ago (27 ,28 ).
Can we estimate more precisely when the transposition occurred? Li and colleagues have studied the relative rates of accumulation of presumably neutral nucleotide substitutions on the primate X and Y chromosomes (29 ). A simple analysis of the data of Li and colleagues suggests that, among primates, the rate of X-Y divergence (at selectively neutral sites) is ~0.2% per Myr. Based on our measurement of 0.7 ± 0.2% nucleotide sequence divergence between the homologs on human Yp and Xq21, we propose that the X-Y transposition occurred ~3-4 Myr ago, probably a few million years after the hominid-chimpanzee split, perhaps near the time of the emergence of our genus, Homo, but well before the emergence of our species, H.sapiens. This estimate is at odds with the conclusions of Lambson and colleagues, who suggested that an Xq-Yp transposition had occurred ~8 Myr ago. As discussed earlier, Lambson and colleagues appear to have overestimated X-Y sequence divergence, and this in turn caused them to overestimate the age of the transposition.
If the X-Y transposition occurred ~3-4 Myr ago, how much more recently did the Yp inversion occur? Did the inversion occur before or after the primary radiation of human racial groups, estimated to have occurred perhaps 100 000-200 000 years ago (30 -33 )? To address this question, we tested genomic DNAs from males of diverse racial ancestry (African, Asian and Caucasian) by Southern blotting for the presence of one or more restriction fragments specific to the distal inversion junction, in interval 1. All human males examined were found to contain these fragments (not shown). We conclude that the Yp inversion occurred before the radiation of human racial groups.
In summary, it appears that a massive X-Y transposition occurred ~3-4 Myr ago, subsequent to the human-chimpanzee split but prior to the emergence of H.sapiens, creating the single largest block of sequence similarity between the hominid X and Y chromosomes. Subsequently, but prior to the radiation of human racial groups, a Yp inversion, mediated by homologous recombination between misaligned LINE-1 elements, disrupted that block of X homology, generating the bipartite structure found on the present-day human Y chromosome.
While this Yp inversion is, to our knowledge, the largest rearrangement in a primate genome to be defined at the nucleotide level, many other comparable or even larger rearrangements have been recognized through comparative chromosome banding studies. In the great apes, for example, known differences among species include almost two dozen pericentric inversions as well as a host of transpositions, paracentric inversions and telomeric fusions (34 ,35 ). Perhaps many of these evolutionary rearrangements involved homologous recombination between interspersed repetitive elements-the mechanism responsible for the Yp inversion studied here and also responsible for numerous mutations and chromosome abnormalities arising in human populations (36 -38 ).
The Y chromosome may be uniquely tolerant of inversions and other rearrangements during evolution. For other chromosomes,all of which normally undergo recombination throughout their lengths, large inversions may impair meiosis, cause repeated abortions or result in recombinational aneuploidy among offspring (39 ,40 ). By contrast, the bulk of the Y chromosome shows strictly sex-linked (as opposed to pseudoautosomal) inheritance, and here the absence of recombination during meiosis means that inversions arising in one generation would be unlikely to disrupt meiosis or create gene imbalances in subsequent generations. Moreover, there appears to be a low density of single-copy genes in the strictly sex-linked region of the human Y chromosome. Recent findings suggest that the majority of transcription units in the strictly sex-linked region are members of Y-specific gene families (41 -44 ). Thus, assuming that breakpoints are randomly distributed and that positions effects are modest, Y inversions should rarely disrupt non-redundant functions. Indeed, Y inversion polymorphisms, associated with no phenotypic abnormalities, are frequently observed in human populations (45 ).
Investigators have postulated numerous inversions or other rearrangements on the Y chromosome during human evolution to explain: (i) the complex pattern of sequence homologies to the human X chromosome; and (ii) occasional discrepancies in maps of the Y chromosome based on naturally occurring deletions (e.g. refs. 10 -14 ,46 ). Apart from the Yp inversion described in this report, these postulated events have yet to be reconstructed at the nucleotide level. The insights into X-Y transposition and Yp inversion reported here were gained from focused comparisons of X and Y nucleotide sequence, on a very modest scale. During the next several years, large-scale sequencing of the human sex chromosomes should make possible a comprehensive nucleotide comparison of the X and Y chromosomes. We anticipate that comprehensive X-Y sequence analysis will provide definitive evidence of multiple inversions and other Y rearrangements that occurred during human evolution.
Because the Xq21-Yp homologies are massive and characterized by such high X-Y sequence similarity, they merit close scrutiny for genes that play critical roles in Turner syndrome. Turner syndrome, a complex phenotype classically associated with monosomy X, probably results from haploinsufficiency of certain genes common to the X and Y chromosomes (47 ). Embryos with a 45,X karyotype develop as phenotypic females with poor viability in utero. Those that survive to term usually develop ovarian failure, short stature and specific anatomical abnormalities that include webbing ofthe neck (48 ). Different `Turner genes' may be responsible for different aspects of the phenotype (49 ).
Although the Xq21-Yp sequences constitute about a third of all X-Y homology, theoretical considerations and karyotype-phenotype correlations lead us to predict that no more than a few critical Turner genes will be found there. While Turner genes are expected to escape X inactivation (47 ,49 ), we suspect that most or all genes in the Yp-homologous region of Xq21 would undergo X inactivation. Homologous genes on the hominid X chromosome probably would have undergone X inactivation prior to the Yp transposition-a condition unlikely to have been altered by the appearance of a homolog on the Y chromosome.
These theoretical considerations are bolstered by karyotype-phenotype observations. Among the individuals whose genomic DNA we studied is a 46,XY male with an interstitial Xq21 deletion spanning the entirety of the Yp-homologous region (patient NP in Fig. 1 ). In this case, the interstitially deleted X chromosome was inherited from the mother, who was obviously fertile, and it was also present in a phenotypically unremarkable sister (50 ). This 46,XY male, his mother and his sister appear to be monosomic for all Xq21-Yp homologous sequences, just as a 45,X Turner female would be. Both the boy and his mother exhibited cubitus valgus, a frequent finding in Turner syndrome, suggesting that a gene for this particular Turner trait might be located among the Xq21-Yp sequences. However, the mother and sister were reported to exhibit no other Turner features (50 ), suggesting that monosomy for Xq21-Yp homologous sequences is not responsible for other components of the Turner phenotype. With the possible exception of a gene for cubitus valgus, the search for Turner determinants should be directed primarily to other regions of the sex chromosomes containing X-Y common sequences.
All DNA markers employed are listed in Table 1 , Table 2 or Figure 1 . Most of these probes derived from a library of genomic HindIII restriction fragments prepared from flow-sorted human Y chromosomes. This library, kindly provided by Marvin Van Dilla, was constructed in [lambda] phage vector Charon 21A at the Biomedical Sciences Division, Lawrence Livermore National Laboratory, Livermore, CA, under the auspices of the National Laboratory Gene Library Project, sponsored by the US Department of Energy. Several of the remaining probes were generous gifts of Jean Weissenbach and derived from a cosmid library prepared from a human-rodent hybrid cell line retaining the human Y (17 ,51 ,52 ). Four Yp-Xq21 hybridization probes used here (pDP7a, pDP61, pDP1057 and St25-2.7) are plasmid subclones of previously reported clones (p7b, p115, p8j and St25/2, respectively) (17 ,18 ). Additional probes were derived from chromosome walking in [lambda] phage libraries of human genomic DNAs (26 ).
Human or ape genomic DNAs were prepared from blood or cultured cell lines, digested with restriction endonucleases, electrophoresed on 0.75% agarose gels and transferred to nylon membranes (26 ). Human inserts purified from recombinant plasmids or [lambda] phage clones were labeled with 32Pby random-primer synthesis (53 ). The resulting probes were hybridized overnight to Southern blots at concentrations of 5*105-3*106 c.p.m./ml at 42°C (`moderate' stringency) or 47°C (`high' stringency) in 50% formamide, 5* SSC (1* SSC = 0.15 M NaCl, 15 mM Na citrate pH 7.4), 1* Denhardt's (0.02% Ficoll 400, 0.02% polyvinyl pyrrolidone, 0.02% bovine serum albumin), 1% SDS, 50 mM NaPO4 pH 6.6 and 0.01% yeast tRNA. Prior to hybridization, some probes were pre-hybridized with an excess of sonicated human genomic DNA (54 ). Following hybridization, blots were washed three times for 20 min each at 65°C in 0.1* SSC, 0.1% SDS.
At many Yp-Xq21 STSs (Table 1 ), we separately determined the nucleotide sequences of the X and Y chromosomes by dideoxy chain termination (55 ). Y chromosomal sequencing templates were derived by PCR amplification from appropriate Y chromosomal YACs (2 ). X chromosomal sequencing templates were derived by PCR amplification from human female genomic DNA. In all cases, both strands of the PCR products were sequenced, and only regions sequenced to high confidence were used in X-Y comparisons. Portions of the human genomic inserts of X-derived plasmid pDP1015 and Y-derived plasmids pDP1094 and pDP1034 were also sequenced (Fig. 4 ).
For most Yp-Xq21 loci, the previously reported PCR assays (1 ) do not discriminate between the X and Y chromosomes. We took advantage of occasional X-Y nucleotide substitutions to devise X- or Y-specific PCR assays at eight loci (Table 2 ), in most cases employing a nested (four-primer) or semi-nested (three-primer) strategy. For all nested and semi-nested assays, PCR was first carried out using human genomic DNAs, STS primers and conditions as previously reported (1 ). These primary amplification products were then diluted 1:10, and 1 µl was transferred to a second PCR reaction; in this case, the primers were those listed in Table 2 . Each primary amplification involved two X-Y common primers, and each secondary amplification involved one X-Y common and one X- or Y-specific primer. In the case of semi-nested (three-primer) assays, the X-Y common primer used in the secondary amplification is identical to one of the primers used in the primary amplification.
To achieve X or Y specificity, secondary amplifications were optimized as follows. All reactions were performed in 20 µl of 5 mM NH4Cl, 10 mM Tris (pH 8.2 at 25°C), 1.5 mM MgCl2, 50 mM KCl, 0.5 mM dNTPs and 1-1.2 U of Taq DNA polymerase. Each primer was at a concentration of 0.35 µM (assays sXY29-X, -Y), 0.5 µM (sXY47-X, -Y), 1 µM (sXY22-X, -Y; sXY28-X, -Y; sXY43-X, -Y; sXY48-X, -Y) or 1.95 µM (sXY38-X, -Y). The cycling protocol included an initial 5 min denaturation (94°C); 18 cycles of 1 min denaturation (94°C), 1.5 min annealing, 1 min extension (72°C); and finally 10 min at 72°C. Annealing temperatures were 53°C (assays sXY38-X, -Y); 55°C (sXY47-X, -Y); 57°C (sXY28-X, -Y; sXY48-X, -Y); 58°C (sXY29-X, -Y); or 59°C (sXY22-X, -Y; sXY43-X, -Y). All reactions were performed using an MJ Research thermal cycler. PCR products were analyzed by gel electrophoresis in 2% agarose.
In the case of STS sXY37, X-specific and Y-specific primers were chosen within and flanking a 17 bp insertion on the X chromosome, and no primary amplification was required. PCR conditions were as above except that 100 ng of human genomic DNA and 1.5 U of Taq DNA polymerase were used, primer concentrations were 1 µM, annealing was at 42°C and 35 cycles were performed.
In the case of Y-specific loci whose presence or absence was scored by PCR, primers and cycling conditions were as previously described (1 ).
We are grateful to Helen Skaletsky for data curation and statistical advice; to Marvin Van Dilla for the flow-sorted Y-DNA library; to Jean Weissenbach and Jean-Louis Mandel for DNA probes; and to Haig Kazazian, Masatoshi Nei, David Pilbeam and Wen-Hsiung Li for advice. We are indebted to the following colleagues for providing human DNA, blood or cell line samples: Kent Argubright, Ronald Bachman, Martin Bobrow, Enrico Cagliero, Christopher Cowell, Gerald Feldman, Robert Greenstein, Joseph Hersh, David Hoar, C.C. Lin, Willy Lissens, Paul McDonough, Robert Nussbaum, Pasquale Patrizio, Peter Pearson, Jean Priest, Marianne Schwartz, Jeffrey Shulkin, M.H.K. Shokeir, Philip Townes, Brian Walsh, and Lester Weiss. We thank Bruce Lahn, Gina Napoleone and Tomoko Sawai-Kawaguchi for comments on the manuscript. Supported by the National Institutes of Health.
1 Vollrath, D., Foote, S., Hilton, A., Brown, L.G., Beer-Romero, P., Bogan, J.S. and Page, D.C. (1992) The human Y chromosome: a 43-interval map based on naturally occurring deletions. Science, 258, 52-59.MEDLINE Abstract
2 Foote, S., Vollrath, D., Hilton, A. and Page, D.C. (1992) The human Y chromosome: overlapping DNA clones spanning the euchromatic region. Science, 258, 60-66.MEDLINE Abstract
3 Rouyer, F., Simmler, M., Johnsson, C., Vergnaud, G., Cooke, H.J. and Weissenbach, J. (1986) A gradient of sex linkage in the pseudoautosomal region of the human sex chromosomes. Nature, 319, 291-295.MEDLINE Abstract
4 Brown, W.R.A. (1988) A physical map of the human pseudoautosomal region. EMBO J., 7, 2377-2385.
5 Rappold, G.A. and Lehrach, H. (1988) A long range restriction map of the pseudoautosomal region by partial digest PFGE analysis from the telomere. Nucleic Acids Res., 16, 5361-5377.MEDLINE Abstract
6 Petit, C., Levilliers, J. and Weissenbach, J. (1988) Physical mapping of the human pseudo-autosomal region; comparison with genetic linkage map. EMBO J., 7, 2369-2376.MEDLINE Abstract
7 Freije, D., Helms, C., Watson, M.S. and Donis-Keller, H. (1992) Identification of a second pseudoautosomal region near the Xq and Yq telomeres. Science, 258, 1784-1787.MEDLINE Abstract
8 Kvaloy, K., Galvagni, F. and Brown, W.R.A. (1994) The sequence organization of the long arm pseudoautosomal region of the human sex chromosomes. Hum. Mol. Genet., 3, 771-778.MEDLINE Abstract
9 Affara, N., Bishop, C., Brown, W., Cooke, H., Davey, P., Ellis, N., Graves, J.M., Jones, M., Mitchell, M., Rappold, G., Tyler-Smith, C., Yen, P. and Lau, Y.-F.C. (1996) Report of the second international workshop on human Y chromosome mapping 1995. Cytogenet. Cell Genet., 73, 33-76.MEDLINE Abstract
10 Page, D.C., Harper, M.E., Love, J. and Botstein, D. (1984) Occurrence of a transposition from the X-chromosome long arm to the Y-chromosome short arm during human evolution. Nature, 311, 119-123.MEDLINE Abstract
11 Bickmore, W.A. and Cooke, H.J. (1987) Evolution of homologous sequences on the human X and Y chromosomes, outside of the meiotic pairing segment. Nucleic Acids Res., 15, 6261-6271.MEDLINE Abstract
12 Yen, P.H., Marsh, B., Allen, E., Tsai, S.P., Ellison, J., Connolly, L., Neiswanger, K. and Shapiro, L.J. (1988) The human X-linked steroid sulfatase gene and a Y-encoded pseudogene: evidence for an inversion of the Y chromosome during primate evolution. Cell, 55, 1123-1135.MEDLINE Abstract
13 Lambson, B., Affara, N.A., Mitchell, M. and Ferguson-Smith, M.A. (1992) Evolution of DNA sequence homologies between the sex chromosomes in primate species. Genomics, 14, 1032-1040.MEDLINE Abstract
14 Wang, I., Franco, B., Ferrero, G.B., Chinault, A.C., Weissenbach, J., Chumakov, I., Le Paslier, D., Levilliers, J., Klink, A., Rappold, G.A., Ballabio, A. and Petit, C. (1995) High-density physical mapping of a 3-Mb region in Xp22.3 and refined localization of the gene for X-linked recessive chondrodysplasia punctata (CDPX1). Genomics, 26, 229-238.MEDLINE Abstract
15 Mumm, S., Molini, B., Terrell, J., Srivastava, A. and Schlessinger, D. (1997) Evolutionary features of the 4-Mb Xq21.3 XY homology region revealed by a map at 60-kb resolution. Genome Res., 7, 307-314.MEDLINE Abstract
16 Page, D., deMartinville, B., Barker, D., Wyman, A., White, R., Francke, U. and Botstein, D. (1982) Single-copy sequence hybridizes to polymorphic and homologous loci on human X and Y chromosomes. Proc. Natl Acad. Sci. USA, 79, 5352-5356.MEDLINE Abstract
17 Geldwerth, D., Bishop, C., Guellaen, G., Koenig, M., Vergnaud, G., Mandel, J. and Weissenbach, J. (1985) Extensive DNA sequence homologies between the human Y and the long arm of the X chromosome. EMBO J., 4, 1739-1743.MEDLINE Abstract
18 Koenig, M., Moisan, J.P., Heilig, R. and Mandel, J.L. (1985) Homologies between X and Y chromosomes detected by DNA probes: localisation and evolution. Nucleic Acids Res., 13, 5485-5501.MEDLINE Abstract
19 Vergnaud, G., Page, D.C., Simmler, M.-C., Brown, L., Rouyer, F., Noel, B., Botstein, D., de la Chapelle, A. and Weissenbach, J. (1986) A deletion map of the human Y chromosome based on DNA hybridization. Am. J. Hum. Genet., 38, 109-124.MEDLINE Abstract
20 Sargent, C.A., Briggs, H., Chalmers, I.J., Lambson, B., Walker, E. and Affara, N.A. (1996) The sequence organization of Yp/proximal Xq homologous regions of the human sex chromosomes is highly conserved. Genomics, 32, 200-209.MEDLINE Abstract
21 Philippe, C., Arnould, C., Sloan, F., van Bokhoven, H., van der Velde-Visser, S.D., Chery, M., Ropers, H.H., Gilgenkrantz, S., Monaco, A.P. and Cremers, F.P.M. (1995) A high-resolution interval map of the q21 region of the human X chromosome. Genomics, 27, 539-543.MEDLINE Abstract
22 Jones, M.H., Khwaja, O.S.A., Briggs, H., Lambson, B., Davey, P.M., Chalmers, J., Zhou, C.-Y., Walker, E.M., Zhang, Y., Todd, C., Ferguson-Smith, M.A. and Affara, N.A. (1994) A set of ninety-seven overlapping yeast artificial chromosome clones spanning the human Y chromosome euchromatin. Genomics, 24, 266-275.MEDLINE Abstract
23 Nei, M. and Li, W.H. (1979) Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl Acad. Sci. USA, 10, 5269-5273.
24 Barker, D., Schafer, M. and White, R. (1984) Restriction sites containing CpG show a higher frequency of polymorphism in human DNA. Cell, 36, 131-138.MEDLINE Abstract
25 Weil, D., Wang, I., Dietrich, A., Poustka, A., Weissenbach, J. and Petit, C. (1994) Highly homologous loci on the X and Y chromosomes are hot-spots for ectopic recombinations leading to XX maleness. Nature Genet., 7, 414-419.MEDLINE Abstract
26 Page, D.C., Mosher, R., Simpson, E.M., Fisher, E.M.C., Mardon, G., Pollack, J., McGillivray, B., de la Chapelle, A. and Brown, L.G. (1987) The sex-determining region of the human Y chromosome encodes a finger protein. Cell, 51, 1091-1104.MEDLINE Abstract
27 Horai, S., Satta, Y., Hayasaka, K., Kondo, R., Inoue, T., Ishida, T., Hayashi, S. and Takahata, N. (1992) Man's place in hominoidea revealed by mitochondrial DNA genealogy. J. Mol. Evol., 35, 32-43.MEDLINE Abstract
28 Sibley, C.G. and Ahlquist, J.E. (1987) DNA hybridization evidence of hominoid phylogeny: results from an expanded data set. J. Mol. Evol., 26, 99-121.MEDLINE Abstract
29 Shimmin, L.C., Chang, B.H. and Li, W.H. (1993) Male-driven evolution of DNA sequences. Nature, 362, 745-747.MEDLINE Abstract
30 Nei, M. and Roychoudhury, A.K. (1993) Evolutionary relationships of human populations on a global scale. Mol. Biol. Evol., 10, 927-943.MEDLINE Abstract
31 Wills, C. (1996) Another nail in the coffin of the multiple-origins theory? BioEssays, 18, 1017-1020.MEDLINE Abstract
32 von Haeseler, A., Sajantila, A. and Paabo, S. (1996) The genetical archaeology of the human genome. Nature Genet., 14, 135-140.MEDLINE Abstract
33 Vigilant, L., Stoneking, M., Harpending, H., Hawkes, K. and Wilson, A.C. (1991) African populations and the evolution of human mitochondrial DNA. Science, 253, 1503-1507.MEDLINE Abstract
34 Clemente, I.C., Ponsa, M., Garcia, M. and Egozcue, J. (1990) Evolution of the Simiiformes and the phylogeny of human chromosomes. Hum. Genet., 84, 493-506.MEDLINE Abstract
35 Yunis, J.J. and Prakash, O. (1982) The origin of man: a chromosomal pictoral legacy. Science, 215, 1525-1530.MEDLINE Abstract
36 Stoppa-Lyonnet, D., Carter, P.E., Meo, T. and Tosi, M. (1990) Clusters of intragenic Alu repeats predispose the human C1 inhibitor locus to deleterious rearrangements. Proc. Natl Acad. Sci. USA, 87, 1551-1555.MEDLINE Abstract
37 Rouyer, F., Simmler, M.C., Page, D.C. and Weissenbach, J. (1987) A sex chromosome rearrangement in a human XX male caused by Alu-Alu recombination. Cell, 51, 417-425.MEDLINE Abstract
38 Goldstein, J.L., Hobbs, H.H. and Brown, M.S. (1995) Lipoprotein and lipid metabolism disorders. In Scriver, C.R., Beaudet, A.L., Sly, W.S. and Valle, D. (eds), The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, New York.
39 Vogel, F. and Motulsky, A.G. (1997) Human Genetics. Springer-Verlag, Berlin.
41 Ma, K., Inglis, J.D., Sharkey, A., Bickmore, W.A., Hill, R.E., Prosser, E.J., Speed, R.M., Thomson, E.J., Jobling, M., Taylor, K., Wolfe, J., Cooke, H.J., Hargreave, T.B. and Chandley, A.C. (1993) A Y chromosome gene family with RNA-binding protein homology: candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell, 75, 1287-1295.MEDLINE Abstract
42 Manz, E., Schnieders, F., Muller Brechlin, A. and Schmidtke, J. (1993) TSPY-related sequences represent a microheterogeneous gene family organized as constitutive elements in DYZ5 tandem repeat units on the human Y chromosome. Genomics, 17, 726-731.MEDLINE Abstract
43 Saxena, R., Brown, L.G., Hawkins, T., Alagappan, R.K., Skaletsky, H., Reeve, M.P., Reijo, R., Rozen, S., Dinulos, M.B., Disteche, C.M. and Page, D.C. (1996) The DAZ gene cluster on the human Y chromosome arose from an autosomal gene that was transposed, repeatedly amplified and pruned. Nature Genet., 14, 292-299.MEDLINE Abstract
44 Lahn, B. and Page, D.C. (1997) Functional coherence of the human Y chromosome. Science, in press.
45 Bernstein, R., Wadee, A., Rosendorff, J., Wessels, A. and Jenkins, T. (1986) Inverted Y chromosome polymorphism in the Gujerati Muslim Indian population of South Africa. Hum. Genet., 74, 223-229.MEDLINE Abstract
46 Klink, A., Schiebel, K., Winkelmann, M., Rao, E., Horsthemke, B., Ludecke, H., Claussen, U., Scherer, G. and Rappold, G. (1995) The human protein kinase gene PKX1 on Xp22.3 displays Xp/Yp homology and is a site of chromosomal instability. Hum. Mol. Genet., 4, 869-878.MEDLINE Abstract
47 Ferguson-Smith, M.A. (1965) Karyotype-phenotype correlations in gonadal dysgenesis and their bearing on the pathogenesis of malformations. J. Med. Genet., 2, 142-155.
48 Lippe, B. (1991) Turner syndrome. Endocrinol. Metab. Clin. North Am., 20, 121-152.MEDLINE Abstract
49 Zinn, A.R., Page, D.C. and Fisher, E.M.C. (1993) Turner syndrome: the case of the missing sex chromosome. Trends Genet., 9, 90-93.MEDLINE Abstract
50 Tabor, A., Andersen, O., Lundsteen, C., Niebuhr, E. and Sardemann, H. (1983) Interstitial deletion in the `critical region' of the long arm of the X chromosome in a mentally retarded boy and his normal mother. Hum. Genet., 64, 196-199.MEDLINE Abstract
51 Bishop, C.E., Guellaen, G., Geldwerth, D., Voss, R., Fellous, M. and Weissenbach, J. (1983) Single-copy DNA sequences specific for the human Y chromosome. Nature, 303, 831-832.MEDLINE Abstract
52 Bishop, C., Guellaen, G., Geldwerth, D., Fellous, M. and Weissenbach, J. (1984) Extensive sequence homologies between Y and other human chromosomes. J. Mol. Biol., 173, 403-417.MEDLINE Abstract
53 Feinberg, A.P. and Vogelstein, B. (1984) Addendum: a technique for radiolabeling DNA restriction endonuclease fragments to a high specific activity. Anal. Biochem., 137, 266-267.MEDLINE Abstract
54 Litt, M. and White, R.L. (1985) A highly polymorphic locus in human DNA revealed by cosmid-derived probes. Proc. Natl Acad. Sci. USA, 82, 6206-6210.MEDLINE Abstract
55 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl Acad. Sci. USA, 74, 5463-5467.MEDLINE Abstract
56 Nelson, D.L., Ballabio, A., Cremers, F., Monaco, A.P. and Schlessinger, D. (1995) Report of the sixth international workshop on X chromosome mapping 1995. Cytogenet. Cell Genet., 71, 307-342.
57 Cremers, F.P.M., van de Pol, T.J.R., Wieringa, B., Hofker, M.H., Pearson, P.L., Pfeiffer, R.A., Mikkelsen, M., Tabor, A. and Ropers, H.H. (1988) Molecular analysis of male-viable deletions and duplications allows ordering of 52 DNA probes on proximal Xq. Am. J. Hum. Genet., 43, 452-461.
58 Schwartz, M., Yang, H.-M., Niebuhr, E., Rosenberg, T. and Page, D.C. (1988) Regional localization of polymorphic DNA loci on the proximal long arm of the X chromosome using deletions associated with choroideremia. Hum. Genet., 78, 156-160.MEDLINE Abstract
59 Bach, I., Robinson, D., Thomas, N., Ropers, H.-H. and Cremers, F.P.M. (1992) Physical fine mapping of genes underlying X-linked deafness and non fra(X)-X-linked mental retardation at Xq21. Hum. Genet., 89, 620-624.MEDLINE Abstract
60 Merry, D.E., Lesko, J.G., Sosnoski, D.M., Lewis, R.A., Lubinsky, M., Trask, B., van den Engh, G., Collins, F.S. and Nussbaum, R.L. (1989) Choroideremia and deafness with stapes fixation: a continuous gene deletion syndrome in Xq21. Am. J. Hum. Genet., 45, 530-540.MEDLINE Abstract
61 Sankila, E.-M., Bruns, G.A.P., Schwartz, M., Nikoskelainen, E., Niebuhr, E., Hodgson, S.V., Wright, A.F. and de la Chapelle, A. (1990) DXS26 (HU16) is located in Xq21.1. Hum. Genet., 85, 117-120.MEDLINE Abstract
*To whom correspondence should be addressed. Tel: +1 617 258 5203; Fax: +1 617 258 5578; Email: page@wi.mit.edu
+Present address: Ohio State University, Columbus, OH, USA
C. J. Metcalfe, K. V. Bulazel, G. C. Ferreri, E. Schroeder-Reiter, G. Wanner, W. Rens, C. Obergfell, M. D. B. Eldridge, and R. J. O'Neill Genomic Instability Within Centromeres of Interspecific Marsupial Hybrids
Genetics,
December 1, 2007;
177(4):
2507 - 2517.
[Abstract][Full Text][PDF]
T. J. Crow How and Why Genetic Linkage Has Not Solved the Problem of Psychosis: Review and Hypothesis
Am J Psychiatry,
January 1, 2007;
164(1):
13 - 21.
[Abstract][Full Text][PDF]
A. M. Lopes, F. Calafell, and A. Amorim Microsatellite Variation and Evolutionary History of PCDHX/Y Gene Pair Within the Xq21.3/Yp11.2 Hominid-Specific Homology Block
Mol. Biol. Evol.,
November 1, 2004;
21(11):
2092 - 2101.
[Abstract][Full Text][PDF]
D. J. Hedges, P. A. Callinan, R. Cordaux, J. Xing, E. Barnes, and M. A. Batzer Differential Alu Mobilization and Polymorphism Among the Human and Chimpanzee Lineages
Genome Res.,
June 1, 2004;
14(6):
1068 - 1075.
[Abstract][Full Text][PDF]
F. Casals, M. Caceres, and A. Ruiz The Foldback-like Transposon Galileo Is Involved in the Generation of Two Different Natural Chromosomal Inversions of Drosophila buzzatii
Mol. Biol. Evol.,
May 1, 2003;
20(5):
674 - 685.
[Abstract][Full Text][PDF]
T.J. CROW Handedness, language lateralisation and anatomical asymmetry: relevance of protocadherin XY to hominid speciation and the aetiology of psychosis: Point of view
The British Journal of Psychiatry,
October 1, 2002;
181(4):
295 - 297.
[Full Text][PDF]
I. Negrutiu, B. Vyskot, N. Barbacar, S. Georgiev, and F. Moneger Dioecious Plants. A Key to the Early Events of Sex Chromosome Evolution
Plant Physiology,
December 1, 2001;
127(4):
1418 - 1424.
[Full Text][PDF]
S. Boissinot, A. Entezam, and A. V. Furano Selection Against Deleterious LINE-1-Containing Loci in the Human Lineage
Mol. Biol. Evol.,
June 1, 2001;
18(6):
926 - 935.
[Abstract][Full Text]
P. Blanco, M. Shlumukova, C. A Sargent, M. A Jobling, N. Affara, and M. E Hurles Divergent outcomes of intrachromosomal recombination on the human Y chromosome: male infertility and recurrent polymorphism
J. Med. Genet.,
October 1, 2000;
37(10):
752 - 758.
[Abstract][Full Text]
M. B. Evgen'ev, H. Zelentsova, H. Poluectova, G. T. Lyozin, V. Veleikodvorskaja, K. I. Pyatkov, L. A. Zhivotovsky, and M. G. Kidwell Mobile elements and chromosomal evolution in the virilis group of Drosophila
PNAS,
September 29, 2000;
(2000)
210386297.
[Abstract][Full Text]
N. Fedoroff Transposons and genome evolution in plants
PNAS,
June 20, 2000;
97(13):
7002 - 7007.
[Abstract][Full Text][PDF]
S. Boissinot, P. Chevret, and A. V. Furano L1 (LINE-1) Retrotransposon Evolution and Amplification in Recent Human History
Mol. Biol. Evol.,
June 1, 2000;
17(6):
915 - 928.
[Abstract][Full Text][PDF]
J. Pecon Slattery, L. Sanner-Wachter, and S. J. O'Brien Novel gene conversion between X-Y homologues located in the nonrecombining region of the Y chromosome in Felidae (Mammalia)
PNAS,
May 9, 2000;
97(10):
5307 - 5312.
[Abstract][Full Text][PDF]
J. P. Slattery, W. J. Murphy, and S. J. O'Brien Patterns of Diversity Among SINE Elements Isolated from Three Y-Chromosome Genes in Carnivores
Mol. Biol. Evol.,
May 1, 2000;
17(5):
825 - 829.
[Full Text][PDF]
A. Tremblay, M. Jasin, and P. Chartrand A Double-Strand Break in a Chromosomal LINE Element Can Be Repaired by Gene Conversion with Various Endogenous LINE Elements in Mouse Cells
Mol. Cell. Biol.,
January 1, 2000;
20(1):
54 - 60.
[Abstract][Full Text]
S. Gaudieri, J. K. Kulski, R. L. Dawkins, and T. Gojobori Different Evolutionary Histories in Two Subgenomic Regions of the Major Histocompatibility Complex
Genome Res.,
June 1, 1999;
9(6):
541 - 549.
[Abstract][Full Text][PDF]
M. L. Moseley, K. A. Benzow, L. J. Schut, T. D. Bird, C. M. Gomez, P. E. Barkhaus, K. A. Blindauer, M. Labuda, M. Pandolfo, M. D. Koob, et al. Incidence of dominant spinocerebellar and Friedreich triplet repeats among 361 ataxia families
Neurology,
December 1, 1998;
51(6):
1666 - 1671.
[Abstract][Full Text][PDF]
C. S. Benton, R. de Silva, S. L. Rutledge, S. Bohlega, T. Ashizawa, and H. Y. Zoghbi Molecular and clinical studies in SCA-7 define a broad clinical spectrum and the infantile phenotype
Neurology,
October 1, 1998;
51(4):
1081 - 1086.
[Abstract][Full Text][PDF]
M. B. Evgen'ev, H. Zelentsova, H. Poluectova, G. T. Lyozin, V. Veleikodvorskaja, K. I. Pyatkov, L. A. Zhivotovsky, and M. G. Kidwell Mobile elements and chromosomal evolution in the virilis group of Drosophila
PNAS,
October 10, 2000;
97(21):
11337 - 11342.
[Abstract][Full Text][PDF]
M. Caceres, M. Puig, and A. Ruiz Molecular Characterization of Two Natural Hotspots in the Drosophila buzzatii Genome Induced by Transposon Insertions
Genome Res.,
August 1, 2001;
11(8):
1353 - 1364.
[Abstract][Full Text][PDF]
CiteULike 
Connotea 
Del.icio.us What's this?
