Fine mapping of de novo CMT1A and HNPP rearrangements within CMT1A-REPs evidences two distinct sex-dependent mechanisms and candidate sequences involved in recombination
Fine mapping of de novo CMT1A and HNPP rearrangements within CMT1A-REPs evidences two distinct sex-dependent mechanisms and candidate sequences involved in recombinationJudith Lopes1, Nicole Ravisé1, Antoon Vandenberghe2, Francisco Palau3, Victor Ionasescu4, Michelle Mayer5, Nicolas Lévy6, Nicholas Wood7, Nobutada Tachi8, Pierre Bouche9, Philippe Latour2, Merle Ruberg1, Alexis Brice1-10 and Eric LeGuern1-10,*
1INSERM U289, 9Service d'Exploration Fonctionnelles Neurologiques and 10Fédération de Neurologie, Hôpital de la Salpêtrière, 75651 Paris cedex 13, France, 2Unité de Neurogénétique Moléculaire, Hôpital de l'Antiquaille, Lyon, France, 3Unitat de Genètica, Hospital Universitari `La Fe', Valencia, Spain, 4Department of Pediatrics, University of Iowa, Iowa City, IA, USA, 5Service Pédiatrie, Hôpital St-Vincent de Paul, Paris, France, 6Département de Génétique Médicale, Hôpital d'enfants de la Timone, Marseille, France, 7University Department of Clinical Neurology, Institute of Neurology, London, UK and 8Department of Occupational Therapy, Sapporo Medical University, Sapporo, Japan
Received July 17, 1997;Revised and Accepted October 2, 1997
The molecular mechanism resulting in the duplication or deletion of a 1.5 Mb region of 17p11.2-p12, associated, respectively, with Charcot-Marie-Tooth type 1A (CMT1A) and hereditary neuropathy with liability to pressure palsies (HNPP), has been proposed to be an unequal crossing-over during meiosis between the two chromosome 17 homologues generated by misalignment of the proximal and distal CMT1A-REP repeats, two homologous sequences flanking the 1.5 Mb CMT1A/HNPP monomer unit. In a recent study of a large series of de novo cases of CMT1A and HNPP, two distinct sex-dependent mechanisms were identified. Rearrangements of paternal origin, essentially duplications, were indeed generated by unequal meiotic crossing-over between the two chromosome 17 homologues, but duplications and deletions of maternal origin resulted from an intrachromosomal process, either unequal sister chromatid exchange or, in the case of deletion, excision of an intrachromatidal loop. In order to determine how these recombinations occur, 24 de novo crossover breakpoints were localized within the 1.7 kb rearrangement hot spot by comparing the sequences of the parental CMT1A-REPs with the chimeric copy in affected offspring. Nineteen out of 21 paternal crossovers were found in a 741 bp hot spot. All the breakpoints of maternal origin (n = 3), however, were located outside this interval, but in closely flanking sequences, supporting the hypothesis that two distinct sex-dependent mechanisms are involved. Several putative recombination promoting sequences in the hot spot, which are rare or absent in the surrounding 7.8 kb, were identified.
Charcot-Marie-Tooth (CMT) disease is a genetically heterogeneous group of disorders. CMT type 1 (CMT1), the demyelinating or hypertrophic form, is the most common of the seven types of hereditary motor sensory neuropathies described by Dyck (1 ). CMT1 patients develop slowly progressive muscle weakness and atrophy, predominantly in the distal limb muscles, sensory loss and absence of deep tendon reflexes, often associated with pes cavus. All gene carriers, whether symptomatic or not, show markedly reduced nerve conduction velocities reflecting demyelination. The conduction velocity of the median motor nerve is <35 m/s (2 ). Hereditary neuropathy with liability to pressure palsies (HNPP) is characterized by recurrent sensory or motor nerve palsies, often precipated by minor trauma. Nerve conduction studies reveal decreased motor velocities, prolonged distal latencies and altered sensory nerve action potentials, especially in entrapment sites, even in clinically non-affected areas or in asymptomatic at-risk individuals (3 ).
The diseases result from alterations in a 1.5 Mb region of chromosome 17p11.2, that is duplicated in CMT1A (4 -7 ) and deleted in HNPP (8 ,9 ). This 1.5 Mb region contains the gene coding for the peripheral myelin protein 22 (PMP22) (10 -12 ), which, when mutated, can also cause the CMT1A phenotype in patients without duplications (13 ,14 ). It was hypothesized that unequal crossing-over would generate both a duplication that would lead to CMT1A and a deletion that would result in HNPP (6 ,8 ,9 ,15 ). The identification of two homologous sequences of 24 kb flanking the 1.5 Mb CMT1A/HNPP monomer unit, the CMT1A-REPs, supported this hypothesis (16 -19 ). Reiter et al. (20 ) reported that 80 and 95% of crossover breakpoints were found in a 3.2 kb region of the CMT1A-REPs in CMT1A and HNPP patients, respectively. However, Lopes et al. (21 ) demonstrated that up to 25% of the rearrangements in both CMT1A and HNPP are located outside this interval, particularly in a 9.2 kb region delimited by Kiyosawa et al. (18 ), suggesting that the crossovers leading to both types of rearrangement are distributed similarly. This observation was confirmed by Kiyosawa and Chance (19 ) and Timmerman et al. (22 ). The 3.2 kb hot spot region was reduced to a 1.7 kb NsiI-EcoRI fragment (20 ). The presence of a mariner transposon-like element (MITE) near the hot spot led Reiter et al. (20 ) to hypothesize that it might be involved in the recombination process. However, the presence of numerous nonsense mutations in this MITE element (19 ) rendered this hypothesis improbable. Recently, an exon of the human heme A:farnesyltransferase gene (COX10) has been identified in the distal CMT1A-REP and a `pseudo-exon' in the proximal CMT1A-REP, thus this gene is disrupted after an unequal recombination between the proximal and distal CMT1A-REPs (23 ).
In a large series of de novo cases (29 CMT1A and four HNPP), it was found that the 17p11.2 rearrangements that occur during spermatogenesis differ from those that occur during oogenesis (24 ). The rearrangements of paternal origin, essentially duplications, were generated by unequal meiotic crossing-over between the two chromosome 17 homologues, whereas the duplications and deletions of maternal origin resulted from an intrachromosomal process, either unequal sister chromatid exchange or, in the case of deletion, excision of an intrachromatidal loop (25 ). In order to elucidate the mechanism responsible for duplications and deletions of the 17p11.2 region, we refined the localization of the rearrangements within the CMT1A-REPs of the 33 previously described patients and 11 new de novo CMT1A cases. The 17p11.2 duplications observed in eight of these new cases were of paternal origin and resulted from unequal crossing-over between homologues, reinforcing the hypothesis of a sex-dependent mechanism. For the three other de novo cases, the parental origin and the chromosomal mechanism could not be determined.
The rearrangements which occurred within the 1.7 kb NsiI-EcoRI fragment were mapped precisely in 24 patients. When the sequences of the parental CMT1A-REPs were compared with the chimeric copy in the affected child, a 741 bp hot spot was found that contained 19 of the 21 rearrangements of paternal origin, whereas those of maternal origin were situated in flanking sequences outside this interval. The structural characteristics of this DNA fragment were compared with those of sequences in other hot spots of recombination in humans, mice, yeast and bacteria. Several sequences were identified that might promote the rearrangements in 17p11.2.
The parental origin of the 11 newly analysed de novo 17p11.2 duplications was determined by allele segregation of 17p11.2 microsatellite markers. Eight were of paternal origin and generated by unequal crossing-over between chromosome 17 homologues. For the three others, the markers were not sufficiently informative for determination of the parental origin and the chromosomal mechanism. These results, together with those of the 33 de novo cases previously described (24 ), confirm that rearrangements of paternal origin are generated by an unequal crossover between the two chromosome 17 homologues and those of maternal origin result from an intrachromosomal process (sister chromatid exchange or, in the case of deletion, excision of an intrachromatidal loop) (Table 1 ). The difference between the parental origins of rearrangements and the chromosomal mechanisms was statistically significant (P < 10-6 ,Yates corrected [chi]2).
Crossover breakpoints in all 44 de novo CMT1A and HNPP patients were localized within the four zones previously described by Lopes et al. (21 ), as shown on Southern blots of EcoRI-SacI and EcoRI-HindIII digests hybridized respectively, with the pJ7.8P and pJ5P probes (Fig. 1 ). In 30 patients (68%), the crossover breakpoints mapped to the 3.2 kb zone 1. When EcoRI-NsiI-digested DNA was hybridized with the pNEA102 probe, 29 of the 30 breakpoints were found in the 1.7 kb NsiI-EcoRI junction fragment. For one CMT1A patient, for whom the parental origin of the duplication could not be determined, the rearrangement occurred in the more telomeric fragment located between the differential SacI and NsiI sites.
Twenty four of the 29 de novo patients with crossovers mapped to the 1.7 kb NsiI-EcoRI region (21 CMT1A and three HNPP, for whom the parental origin of the rearrangements was known) were sequenced. The sequences of the proximal and distal CMT1A-REPs diverge at 15 nucleotides that were used to delimit the minimum interval for each rearrangement in the 1.7 kb NsiI-EcoRI region (Fig. 2 ). Two divergent bases were polymorphic: one corresponding to a PmeI restriction site [GT(T/G)TAAAC], and the other to an MaeI site [CT(A/G)G], located 302 bp centromeric to the PmeI site (Fig. 2 ). The allelic frequencies of these two polymorphic restriction sites, calculated from the 38 proximal and distal CMT1A-REPs from transmitting parents, are presented in Table 2 . Allele frequencies at the PmeI site of the proximal and distal CMT1A-REPs are similar, but those of the MaeI restriction site are significantly different (P < 10-4, Yates corrected [chi]2).
Since the CMT1A-REPs are located in a chromosomal region that contains a hot spot of recombinations and rearrangements (16 ,26 ,27 ), we analysed the 1.7 kb NsiI-EcoRI fragment for specific sequences known to be involved in such processes. Five human minisatellite consensus sequences (28 ,29 ) with two or four mismatches were found within an interval of 270 bp located in the 741 bp hot spot (Table 3 and Fig. 2 ). An ATGCAG sequence, present at the chromosomal junction in human translocations (30 ), was found 210 bp centromeric to the NsiI restriction site. Since one may expect to find a given six nucleotide sequence once every 4 kb (46), the presence of this sequence in the hot spot region is of questionable significance. No long terminal repeat (LTR) sequences (31 ) or tetranucleotide repeats (32 -34 ) were observed. A chi-like sequence (35 ) with a single mismatch was detected, however, near the PmeI restriction site (Fig. 2 ). The clustering of five minisatellite-like sequences and one chi-like sequence within a 270 bp stretch appears to be characteristic of the CMT1A-REPs, since only seven widely distributed minisatellite-like sequences with two mismatches were found in the flanking regions of the 7.8 kb EcoRI-EcoRI fragment, at nucleotides 1663, 1779, 4663, 4999, 5391, 5798 and 7773, starting from the centromeric EcoRI restriction site in the sequence published by Reiter et al. (20 ), and two chi sequences with one mismatch at nucleotides 3575 and 5800. In addition, a 13 nucleotide sequence [GGG(A/C)GGAAAGGGT] in the 741 bp region is highly homologous to a region of the 289 bp MT sequence involved in recombination in mice (36 ) and a 15 nucleotide sequence (CCTCTTCTTTCCTGG) was perfectly homologous to a sequence in the 1649 bp Lmp2 murine hot spot (37 ). These two sequences are rare. Their expected frequencies in the genome are one in 1.7\×107 bp (412) and 109 bp (415) for the 13 nucleotide sequence (with one mismatch) and the 15 nucleotide sequence, respectively. They have not been implicated previously in recombination events.
The comparison of junctional CMT1A-REP sequences in de novo cases of CMT1A and HNPP with the CMT1A-REP sequences in their transmitting parent permitted a precise localization of the recombination breakpoints in regions delimited by nucleotides that differ in the proximal and distal CMT1A-REPs. De novo cases were necessary for this analysis since several of the divergent bases are polymorphic.
Sixty eight per cent (30/44) of de novo rearrangements occurred in a previously described 3.2 kb restriction fragment denoted zone 1 (21 ), and all but one of the 30 could be further localized in a 1.7 kb region defined by differential EcoRI and NsiI restriction enzymes. This distribution is not significantly different from that observed in the general population of CMT1A and HNPP patients (19 ,21 ,22 ). This series of de novo CMT1A and HNPP patients is, therefore, a representative sample. In 24 patients with rearrangements in the 1.7 kb region, all the breakpoints were finally restricted to a 1.2 kb region, but their distribution varied according to the parental origin. Rearrangements of paternal origin, generated by an unequal crossover between the two chromosome 17 homologues, mostly map to a 741 bp interval (19/21), while the three maternal rearrangements, resulting from an intrachromosomal process (sister chromatid exchange or, in the case of deletion, excision of an intrachromatidal loop), were all located outside the 741 bp interval, although in closely flanking sequences. This observation supports the hypothesis that two distinct sex-dependent chromosomal mechanisms are responsible for 17p11.2 rearrangements (24 ), although the distribution of duplications leading to CMT1A and deletions leading to HNPP are similar (P < 0.18, Yates corrected [chi]2).
The 741 bp interval, in which most rearrangements of paternal origin occurred, contained fewer divergent nucleotides than flanking regions. Moreover, because of a polymorphism at the two divergent nucleotides, the length of identical sequences in three of the transmitting fathers increased to 477 bp (absence of divergent bases at the MaeI site), to 566 bp in three fathers (absence of divergent bases at the PmeI site) and to 741 bp in one father (absence of divergent bases at both the PmeI and MaeI sites). These data suggest that long stretches of strict identity between two sequences favour recombination in humans, although precise characterization of recombination between homologues in other models is needed to confirm this hypothesis. Lagerstedt et al. (38 ) have shown recently, in Hunter syndrome, that the inversion between the IDS gene and its putative pseudogene IDS-2 might be the consequence of an intrachromosomal mispairing caused by recombination between the IDS gene and the IDS-2 pseudogene. They identified a 1 kb hot spot which exhibits significantly higher sequence identity (<98%) than the overall <88% homology between the IDS gene and the IDS-2 locus. These results are consistent with several studies of well-documented recombination hot spots within the I region of mouse major histocompatibility complex (MHC), showing that a high rate of recombination requires a high degree of identity. Base pair mismatches and small deletions or insertions strongly affect the efficiency of genetic recombination in the MHC (37 ,39 ). These results are in accordance with experimental models developed by Waldman and Liskay (40 ) in mammalian cells, which show that the rate of intrachromosomal recombination is determined by the extent of uninterrupted identity and not by the total number of mismatches within a given interval of DNA. They determined that the minimum sequence identity required for homologous recombination in mammalian cells is ~200 bp and that the frequency of recombination decreases rapidly when the homologous sequence is smaller (40 ,41 ). However, if strict identity is necessary to initiate intrachromosomal recombination, the process can extend through and terminate within adjacent sequences containing a higher degree of mismatches (40 ). This might explain the localization of five crossover breakpoints, in particular those of maternal origin, in sequences flanking the 741 bp CMT1A-REP hot spot. In the maternal rearrangements, the identical sequence in the 741 bp interval is 566 bp long in families 524 and 902, and 741 bp in family 309. If intrachromosomal rearrangements also require identical sequences of at least 200 bp to activate the enzymatic machinery, the breakpoint feasibly can occur in the flanking sequences that are within 300 bp of the 741 bp region.
Strict sequence identity may not be sufficient, however, to promote unequal recombination. Sequence analysis has shown that the 1.5 kb SacI-NsiI adjacent region, telomeric to the NsiI-EcoRI region, contains two large intervals (306 and 465 bp) in which the proximal and distal CMT1A-REPs are strictly identical (20 ), but only one of the 30 rearrangements mapped to the 3.2 kb SacI-EcoRI restriction fragment was located in this region; the other 29 were found in the 1.7 kb NsiI-EcoRI region. Specific sequences in the 1.7 kb region might therefore be necessary for crossing-over to occur. Screening of this region for sequences known to be involved in recombination in humans, mice, yeast or bacteria, revealed, within the 741 bp hot spot, five sequences that are highly homologous to human minisatellite consensus sequences and one homologue of the bacterial chi sequence. The five human minisatellite-like sequences are not arranged in tandem but are very close to one another. Hypervariable minisatellite DNA sequences are short tandemly repeated sequences that are present throughout the human genome and enhance recombination. The consensus core sequence of hypervariable minisatellites shows similarity to the chi sequence, a hot spot that promotes generalized recombination catalysed by the RecA-RecBC system of Escherichia coli (29 ). In many regards, the effects of the hypervariable minisatellite sequences are similar to the effects of the bacterial chi sequence. Minisatellites, like the chi sequence, enhance recombination at a distance, do not require perfect homology at their site of action and stimulate recombination in both directions with a marked directionality (29 ). Wahls et al. (29 ) showed that minisatellite sequences act co-dominantly: enhancement occurs in the heterozygous state, but is markedly increased if the sequence is present in both substrates, as in proximal and distal CMT1A-REPs. Sequence analysis of the meiotic recombination hot spot within the mouse MHC locus reveals the presence of 21 intermingled repeats showing 50-80% homology to the human hypervariable minisatellite core sequence (32 ). These data support the hypothesis that the minisatellite-like sequences in the 741 bp hot spot of the CMT1A-REPs favour the occurrence of recombination events. Two short sequences of 13 and 15 nucleotides, homologous to the MT family sequence and the Lmp2 locus, respectively, both of which are located in the recombinational hot spot in the mouse MHC, have also been identified in the 741 bp CMT1A-REP hot spot interval. These sequences may contain specific motifs recognized by proteins involved in recombination, which remain to be identified. Since all these sequences, that have been associated elsewhere with recombination, are rare or absent in the 7.8 kb EcoRI-EcoRI region flanking the CMT1A-REP hot spot, they may also promote recombination in this region.
The interhomologue crossovers that occurred in male gametes were located preferentially within the 741 bp interval, whereas the maternal rearrangements, generated by intrachromosomal recombination, were found in adjacent sequences. This supports the hypothesis that 17p11.2 rearrangements are caused by two distinct sex-dependent mechanisms. It is interesting, however, that the type of rearrangement, deletion or duplication, was not related to location of the breakpoint. The factors that determine the type of rearrangement remain to be elucidated.
The 17p11.2 duplication was detected in 40 unrelated patients with CMT1 by gene dosage on MspI-digested Southern blots, using the restriction fragment length polymorphism (RFLP) probes, VAW409R3a (D17S122), EW401 (D17S61) and VAW412 (D17S125), which are located in the CMT1A/HNPP monomer unit. The 17p11.2 deletion was detected in four unrelated HNPP patients, by gene dosage with VAW409R3a (D17S122) and marker SF85 (D21S46) as a reference probe. The parents of these patients presented no clinical or electrophysiological abnormalities and no rearrangements in 17p11.2.
The parental origin of 17p11.2 rearrangements was determined by allele segregation of the following 17p11.2 microsatellite markers D17S953, D17S122 (RM11GT), D17S839, D17S955, D17S921 and D17S922 (26 ) and RFLP probes VAW409R3a, EW401 and VAW412 (24 ). These markers were informative in all but four cases with CMT1A. Results were reported previously for 29 de novo CMT1A and four de novo HNPP (24 ). Among the 29 CMT1A de novo patients, 26 were of paternal origin and two of maternal origin. In the four de novo HNPP patients, one deletion was generated in a paternal gamete and three in maternal gametes. No false paternity was detected in these families.
The localization of crossover breakpoints within the CMT1A-REPs was established by gene dosage on Southern blot of DNA (5 µg) digested with EcoRI-SacI, EcoRI-HindIII and EcoRI-NsiI restriction enzymes (Boehringer), electrophoresed in 0.8% agarose gel, transferred to Hybond N+ membrane (Amersham), and hybridized with random primed 32P-labelled probes corresponding to pJ7.8P, pJ5P (21 ) and pNEA102 (17 ), after pre-annealing with placental DNA (2 mg/ml).
PCR primers were designed that were specific to either the proximal (P1, P2) or the distal (D1, D2) CMT1A-REP on both sides of the 1.7 kb NsiI-EcoRI region (the divergent nucleotides are presented in bold): primer P1: 5' agttggattcaaagatattagtgttatga 3', primer P2: 5' caaatattctaaagaaaatcctctagttacccctttattta 3', primer D1: 5' ggccagttggattcagagacattagtgttacga 3' and primer D2: 5' aaaatcctctagttacccctttaactt 3' (20 ). PCR was performed with an initial denaturation at 96°C for 5 min, then 94°C for 10 min, and 30 cycles with denaturation at 94°C for 15 s, annealing at 60°C for 30 s and extension at 72°C for 1 min, with a final 10 min extension at 72°C. P1/P2 and D1/D2 primer couples were used to amplify 2.2 kb fragments from proximal and distal parental CMT1A-REPs, respectively. The specific 2.2 kb junction fragments from de novo HNPP and CMT1A patients were amplified by the P1/D2 and P2/D1 primer couples, respectively. The 2.2 kb amplified products were digested with appropriate restriction enzymes in order to confirm the specificity of the PCR reaction: NsiI, EcoRI and EcoRI-NsiI for PCR fragments from parental proximal and distal CMT1A-REPs and from junctional CMT1A-REP, respectively. After isolation on agarose gel and purification by standard phenol/chloroform extraction, these fragments were sequenced using the automated fluorescent DNA ABI PRISM 377 sequencer (Perkin Elmer) and Dye Primer Sequencing kit (Perkin Elmer). Sequence analysis was performed with the Sequence Navigator Program (Perkin Elmer).
The 7.8 kb EcoRI-EcoRI region was screened for the presence of the following sequences involved in chromosomal rearrangements, using the Lalign DNA analysis program version 2.0 (42 ): (i) human hypervariable minisatellite consensus sequences GGGCAGGA(A/G)G (28 ) and AGAGGTGGGCAGGTGG (29 ), consensus sequences ATGCAG and GCCC(A/T)CCT found at chromosomal breakpoint junctions in patients with translocations (30 ); (ii) tetranucleotide repeats (TCTG)4-6 and (CAGG)7-9 identified within the I region of the mouse MHC in two recombination hot spots located between the Ab3 and Ab2 genes, and in the Eb gene, respectively (32 -34 ); (iii) the 289 bp consensus sequence of the middle repetitive MT family, present in both hot spots between the Ab3 and Ab2 genes, and in the Eb gene (36 ); (iv) the 1649 bp sequence corresponding to the Lmp2 hot spot in the mouse MHC (37 ); (v) the retroposon LTR sequence TCATACACCACGCAGGGGTAGAGGACT, located in the recombinational hot spot of the Eb gene in the mouse MHC (31 ); (vi) the ATGACGT sequence present in the ade6 gene of Schizosaccharomycespombe with the M26 mutation that promotes frequent recombinations in this gene (43 ); and (vii) the chi consensus sequence GCTGGTGG which stimulates generalized recombination in E.coli (35 ).
The authors thank Drs P. Bridge and V. Layet for referring some of the families, Christiane Penet, Yolaine Pothin, Jacqueline Bou, Agnès Camuzat, Isabelle Lagroua, for technical and Drs R. Gouider and N. Birouk for medical assistance. This study was supported by the Association Française contre les Myopathies (AFM), the Assistance Publique des Hôpitaux de Paris (AP-HP), the Association pour le Développement de la Recherche surles Maladies Génétiques Neurologiques et Psychiatriques (ADRMGNP) and Biomed 2 concerted action CT961614.
1Dyck, P., Chance, P., Lebo, R. and Carney, J. (1993) In Dyck, P., Thomas, P., Griffin, J., Low, P. and Poduslo, J. (eds) Hereditary Motor and Sensory Neuropathies.Peripheral Neuropathy, 3d edn. WB Saunders, Philadelphia, PA, pp. 1094-1136.
2Birouk, N., Gouider, R., LeGuern, E., Gugenheim, M., Tardieu, S., Maisonoble, T., Le Forestier, N., Agid, Y., Brice, A. and Bouche, P. (1997) Charcot-Marie-Tooth disease type 1A with 17p11.2 duplication. Clinical and electrophysiological phenotype study and factors influencing disease severity in 119 cases. Brain, 120, 813-823.MEDLINE Abstract
3Gouider, R., LeGuern, E., Gugenheim, M., Tardieu, S., Maisonoble, T., Léger, J.-M.,Vallat, J.-M., Agid, Y., Bouche, P. and Brice, A. (1995) Clinical, electrophysiologic, and molecular correlations in 13 families with hereditary neuropathy with liability to pressure palsies and a chromosome 17p11.2 deletion. Neurology, 45, 2018-2023.MEDLINE Abstract
4Lupski, J., Montes de Oca-Luna, R., Slaugenhaupt, S., Pentao, L., Guzzetta, V., Trask, B., Saucedo-Cardenas, O., Barker, D., Killian, J., Garcia, C., Chakravarti, A. and Patel, P. (1991) DNA duplication associated with Charcot-Marie-Tooth disease type 1A. Cell, 66, 219-232.MEDLINE Abstract
5Lupski, J., Wise, C., Kuwano, A., Pentao, L., Parke, J., Glaze, D., Ledbetter, D., Greenberg, F. and Patel, P. (1992) Gene dosage is a mechanism for Charcot-Marie-Tooth disease type 1A. Nature Genet., 1, 29-33.MEDLINE Abstract
6Raeymaekers, P., Timmerman, V., Nelis, E., De Jonghe, P., Hoogendijk, J., Baas, F., Barker, D., Martin, J.-J., De Vissier, M., Bolhuis, P., Van Broeckhoven, C. and the HMSN Collaborative Research Group (1991) Duplication in chromosome 17p11.2 in Charcot-Marie-Tooth neuropathy type 1a (CMT 1a). Neuromusc. Dis., 1, 93-97.MEDLINE Abstract
7Brice A., Ravisé, N., Stevanin, G., Gugenheim, M., Bouche, P., Penet, C., Agid, Y. and the French CMT Research Group (1992) Duplication within chromosome 17p11.2 in 12 families of French ancestry with Charcot-Marie-Tooth disease type 1A. J. Med. Genet., 29, 807-812.MEDLINE Abstract
8Chance, P., Alderson, M., Leppig, K., Lensch, W., Matsunami, N., Smith, B., Swanson, P., Odelberg, S., Disteche, C. and Bird, T. (1993) DNA deletion associated with hereditary neuropathy with liability to pressure palsies. Cell,72, 143-151.MEDLINE Abstract
9LeGuern, E., Sturtz, F., Gugenheim, M., Gouider, R., Bonnebouche, C., Ravisé, N., Gonnaud, P-M., Tardieu, S., Bouche, P., Chazot, G., Agid, Y., Vandenberghe, A. and Brice, A. (1994) Detection of deletion within 17p11.2 in 7 French families with hereditary neuropathy with liability to pressure palsies (HNPP). Cytogenet. Cell. Genet., 65, 261-264.
10Patel, P., Roa, B., Welcher, A., Schoener-Scott, R., Trask, B., Pentao, L., Snipes, J., Garcia, C., Francke, U., Shooter, E., Lupski, J. and Suter, U. (1992) The gene for peripheral myelin protein PMP22 is a candidate for Charcot-Marie-Tooth disease type 1A. Nature Genet., 1, 159-165.MEDLINE Abstract
11Timmerman, V., Nelis, E., Van Hul, W., Nieuwenhuijsen, B., Chen, K., Wang, S., Ben Othman, K., Cullen, B., Leach, R., Hanemann, C., De Jonghe, P., Raeymaekers, P., Van Ommen, G.-J., Martin, J.-J., Müller, H., Vance, J., Fischbeck, K. and Van Broeckhoven, C. (1992) The peripheral myelin protein gene PMP22 is contained within the Charcot-Marie-Tooth disease type 1A duplication. Nature Genet., 1, 171-175.MEDLINE Abstract
12Valentijn, L., Bolhuis, P., Zorn, I., Hoogendijk, J., Van Der Bosch, N., Hensels, G., Stanton, V., Housman, D., Fischbeck, K., Ross, D., Nicholson, G., Meershoek, E., Dauwerse, H., Van Ommen, G. and Baas, F. (1992) The peripheral myelin gene PMP22/GAS-3 is duplicated in Charcot-Marie-Tooth disease type 1A. Nature Genet., 1, 166-170.MEDLINE Abstract
13Valentijn, L., Baas, F., Wolterman, R., Hoogendijk, J., Van Den Bosch, N., Zorn, I., Gabreëls-Festen, A., De Visser, M. and Bolhuis, P. (1992) Identical point mutations of PMP-22 in trembler-J mouse and Charcot-Marie-Tooth disease type 1A. Nature Genet., 2, 288-291.MEDLINE Abstract
14Roa, B., Garcia, C., Suter, U., Kulpa, D., Wise, C., Mueller, J., Welcher, A., Snipes, J., Shooter, E., Patel, P. and Lupski, J. (1993) Charcot-Marie-Tooth disease Type 1A: association with spontaneous point mutation in the PMP22 gene. N. Engl. J. Med., 329, 96-101.MEDLINE Abstract
15Palau, F., Löfgren, A., De Jonghe, P., Bort, S., Nelis, E., Sevilla, T., Martin, J.-J., Vilchez, J., Prieto, F. and Van Broeckhoven, C. (1993) Origin of the de novo duplication in Charcot-Marie-Tooth disease type 1A: unequal nonsister chromatid exchange during spermatogenesis. Hum. Mol. Genet., 2, 2031-2035.MEDLINE Abstract
16Pentao, L., Wise, C., Chinault, C., Patel, P. and Lupski, J. (1992) Charcot-Marie-Tooth type 1A duplication appears to arise from recombination at repeat sequences flanking the 1.5 Mb monomer unit. Nature Genet., 2, 292-300.MEDLINE Abstract
17Chance, P., Abbas, N., Lensch, M., Pentao, L., Roa, B., Patel, P. and Lupski, J. (1994) Two autosomal dominant neuropathies result from reciprocal DNA duplication/deletion of a region on chromosome 17. Hum. Mol. Genet., 3, 223-228.MEDLINE Abstract
18Kiyosawa, H., Lensch, W. and Chance, P. (1995) Analysis of the CMT1A-REP repeat: mapping crossover breakpoints in CMT1A and HNPP. Hum. Mol. Genet.,4, 2327-2334.MEDLINE Abstract
19Kiyosawa, H. and Chance, P. (1996) Primate origin of the CMT1A-REP repeat and analysis of a putative transposon-associated recombinational hotspot. Hum. Mol. Genet.,5, 745-753.MEDLINE Abstract
20Reiter, L., Murakami, T., Koeuth, T., Pentao, L., Muzny, D., Gibbs, R. and Lupski, J. (1996) A recombination hotspot responsible for two inherited peripheral neuropathies is located near a mariner transposon-like element. Nature Genet., 12, 288-297.MEDLINE Abstract
21Lopes, J., LeGuern, E., Gouider, R., Tardieu, S., Abbas, N., Birouk, N., Gugenheim, M., Bouche, P., Agid, Y., Brice, A. and the French CMT Collaborative Reseach Group. (1996) Recombination hot spot in a 3.2 kb region of the Charcot-Marie-Tooth Type 1A repeat sequences: new tools for molecular diagnosis of hereditary neuropathy with liability to pressure palsies and of Charcot-Marie-Tooth Type 1A. Am. J. Hum. Genet.,58, 1223-1230.MEDLINE Abstract
22Timmerman, V., Rautenstrauss, B., Reiter, L., Koeuth, T., Löfgren, A., Liehr, T., Nelis, E., Bathke, K., De Jonghe, P., Grehl, H., Martin, J.-J., Lupski, J. and Van Broeckhoven, C. (1997) Detection of the CMT1A/HNPP recombination hotspot in unrelated patients of European descent. J. Med. Genet., 34, 43-49.MEDLINE Abstract
23Reiter, L., Murakami, T., Koeuth, T., Gibbs, R. and Lupski, J. (1997) The human COX10 gene is disrupted during homologous recombination between the 24 kb proximal and distal CMT1A-REPs. Hum. Mol. Genet.,6, 1595-1603.MEDLINE Abstract
24Lopes, J., Vandenberghe, A., Tardieu, S., Ionasescu, V., Lévy, N., Wood, N., Tachi, N., Bouche, P., Latour, Ph., Brice, A. and LeGuern, E. (1997) Sex-dependent rearrangements resulting in CMT1A and HNPP. Nature Genet., 17, 136-137.MEDLINE Abstract
25LeGuern, E., Gouider, R., Ravisé, N., Lopes, J., Tardieu, S., Gugenheim, M., Abbas, N., Bouche, P., Agid, Y. and Brice, A. (1996) A de novo case of hereditary neuropathy with liability to pressure palsies (HNPP) of maternal origin: a new mechanism for deletion in 17p11.2? Hum. Mol. Genet.,5, 103-106.MEDLINE Abstract
26LeGuern, E., Ravisé, N., Gouider, R., Gugenheim, M., Lopes, J., Bouche, P., Agid, Y. and Brice A. (1996) Microsatellite mapping of the deletion in patients with hereditary neuropathy with liability to pressure palsies (HNPP): new molecular tools for the study of the region 17p12-p11 and for diagnosis. Cytogenet. Cell Genet., 72, 20-25.MEDLINE Abstract
27Wright, E.C., Goldgar, D.E., Fain, P.R., Barker, D.F. and Skolnick, M.H. (1990) A genetic map of human chromosome 17p. Genomics, 7, 103-109.MEDLINE Abstract
28Jeffreys, A., Wilson, V. and Lay Thein, S. (1985) Hypervariable `minisatellite' regions in human DNA. Nature,314, 67-73.MEDLINE Abstract
29Wahls, W., Wallace, L. and Moore, P. (1990) Hypervariable minisatellite DNA is a hotspot for homologous recombination in human cells. Cell, 60, 95-103.MEDLINE Abstract
30Aoki, K., Suzuki, K., Sugano,T., Tasaka, T., Nakahara, K., Kuge, O., Omori, A. and Kasai, M. (1995) A novel gene, Translin, encodes a recombination hotspot binding protein associated with chromosomal translocations. Nature Genet., 10, 167-174.MEDLINE Abstract
31Zimmerer, E. and Passmore, H. (1991) Structural and genetic properties of the Eb recombinational hotspot in the mouse. Immunogenetics, 33, 132-140.MEDLINE Abstract
32Steinmetz, M., Stephan, D. and Fischer-Lindahl, K. (1986) Gene organization and recombinational hotspot in the murine major histocompatibility complex. Cell, 50, 719-727.
33Uematsu, Y., Kiefer, H., Schulze, R., Fischer-Lindahl, K. and Steinmetz, M. (1986) Molecular characterization of a meiotic recombinational hotspot enhancing homologous equal crossing-over. EMBO J., 5, 2123-2129.MEDLINE Abstract
34Kobori, J., Strauss, E., Minard, K. and Hood, L. (1986) Molecular analysis of the hotspot of recombination in the murine major histocompatibility complex. Science, 234, 173-179.MEDLINE Abstract
35Smith, G., Kunes, S., Schultz, D., Taylor, A. and Triman, K. (1981) Structure of chi hotspots of generalized recombination. Cell, 24, 429-436.MEDLINE Abstract
36Shiroishi, T., Hanzawa, N., Sagai, T., Ishiura, M., Gojobori, T., Steinmetz, M. and Moriwaki, K. (1990) Recombinational hotspot specific to female meiosis in the mouse major histocompatibility complex. Immunogenetics, 31, 79-88.MEDLINE Abstract
37Yoshino, M., Sagai, T., Fischer-Lindahl, K., Toyoda, Y., Moriwaki, K. and Shiroishi, T. (1995) Allele-dependent recombination frequency: homology requirement in meiotic recombination at the hot spot in the mouse major histocompatibility complex. Genomics, 27, 298-305.MEDLINE Abstract
38Lagerstedt, K., Karsten, S., Carlberg, B.-M., Kleijer, W., Tönnesen, T., Pettersson, U. and Bondeson, M.-L. (1997) Double-strand breaks may initiate the inversion mutation causing the Hunter syndrome. Hum. Mol. Genet., 6, 627-633.MEDLINE Abstract
39Sant'Angelo, D., Lafuse, W. and Passmore, H. (1992) Evidence that nucleotide sequence identity is a requirement for meiotic crossing-over within mouse Eb recombinational hot spot. Genomics, 13, 1334-1336.MEDLINE Abstract
40Waldman, A. and Liskay, M. (1988) Dependence of intrachromosomal recombination in mammalian cells on uninterrupted homology. Mol. Cell. Biol., 8, 5350-5357.MEDLINE Abstract
41Rubnitz, J. and Subramani, S. (1984) The minimum amount of homology required for homologous recombination in mammalian cells. Mol. Cell. Biol., 4, 2253-2258.MEDLINE Abstract
42Huang, X. and Miller, W. (1991) Adv. Appl. Math., 12, 373-381.
43Schuchert, P., Langsford, M., Käslin, E. and Kohli, J. (1991) A specific DNA sequence is required for high frequency of recombination in the ade6 gene of fission yeast. EMBO J., 10, 2157-2163.MEDLINE Abstract
*To whom correspondence should be addressed. Tel: +33 1 42162182; Fax: +33 1 44243658; Email: leguern@u289.ext.infobiogen.fr
K.-W. G. Lam and A. J. Jeffreys Processes of de novo duplication of human {alpha}-globin genes
PNAS,
June 26, 2007;
104(26):
10950 - 10955.
[Abstract][Full Text][PDF]
K.-W. G. Lam and A. J. Jeffreys Inaugural Article: Processes of copy-number change in human DNA: The dynamics of {alpha}-globin gene deletion
PNAS,
June 13, 2006;
103(24):
8921 - 8927.
[Abstract][Full Text][PDF]
R Visser, O Shimokawa, N Harada, N Niikawa, and N Matsumoto Non-hotspot-related breakpoints of common deletions in Sotos syndrome are located within destabilised DNA regions
J. Med. Genet.,
November 1, 2005;
42(11):
e66 - e66.
[Abstract][Full Text][PDF]
N. Kurotaki, P. Stankiewicz, K. Wakui, N. Niikawa, and J. R. Lupski Sotos syndrome common deletion is mediated by directly oriented subunits within inverted Sos-REP low-copy repeats
Hum. Mol. Genet.,
February 15, 2005;
14(4):
535 - 542.
[Abstract][Full Text][PDF]
R. L. Glaser and E. W. Jabs Dear Old Dad
Sci. Aging Knowl. Environ.,
January 21, 2004;
2004(3):
re1 - re1.
[Abstract][Full Text][PDF]
P. Latour, L. Boutrand, N. Levy, R. Bernard, A. Boyer, F. Claustrat, G. Chazot, M. Boucherat, and A. Vandenberghe Polymorphic Short Tandem Repeats for Diagnosis of the Charcot-Marie-Tooth 1A Duplication
Clin. Chem.,
May 1, 2001;
47(5):
829 - 837.
[Abstract][Full Text][PDF]
C PERFUMO, P C. MAINARDI, A CALÌ, G COUCOURDE, F ZARA, S CAVANI, J OVERHAUSER, F D. BRICARELLI, and M PIERLUIGI The first three mosaic cri du chat syndrome patients with two rearranged cell lines
J. Med. Genet.,
December 1, 2000;
37(12):
967 - 972.
[Full Text]
L.-L. Han, M. P. Keller, W. Navidi, P. F. Chance, and N. Arnheim Unequal exchange at the Charcot-Marie-Tooth disease type 1A recombination hot-spot is not elevated above the genome average rate
Hum. Mol. Genet.,
July 22, 2000;
9(12):
1881 - 1889.
[Abstract][Full Text][PDF]
Y. Ji, E. E. Eichler, S. Schwartz, and R. D. Nicholls Structure of Chromosomal Duplicons and their Role in Mediating Human Genomic Disorders
Genome Res.,
May 1, 2000;
10(5):
597 - 610.
[Abstract][Full Text]
A. J. Jeffreys, A. Ritchie, and R. Neumann High resolution analysis of haplotype diversity and meiotic crossover in the human TAP2 recombination hotspot
Hum. Mol. Genet.,
March 22, 2000;
9(5):
725 - 733.
[Abstract][Full Text][PDF]
F. Stogbauer, P. Young, G. Kuhlenbaumer, P. De Jonghe, and V. Timmerman Hereditary recurrent focal neuropathies: Clinical and molecular features
Neurology,
February 8, 2000;
54(3):
546 - 546.
[Abstract][Full Text][PDF]
M. O. Dorschner, V. P. Sybert, M. Weaver, B. A. Pletcher, and K. Stephens NF1 microdeletion breakpoints are clustered at flanking repetitive sequences
Hum. Mol. Genet.,
January 1, 2000;
9(1):
35 - 46.
[Abstract][Full Text][PDF]
N. C. Schanen Molecular Approaches to the Rett Syndrome Gene
J Child Neurol,
December 1, 1999;
14(12):
806 - 814.
[Abstract][PDF]
A. Brusco, S. Saviozzi, F. Cinque, A. Bottaro, and M. DeMarchi A Recurrent Breakpoint in the Most Common Deletion of the Ig Heavy Chain Locus (del A1-GP-G2-G4-E )
J. Immunol.,
October 15, 1999;
163(8):
4392 - 4398.
[Abstract][Full Text][PDF]
J Wirth, H-G Nothwang, S van der Maarel, C Menzel, G Borck, I Lopez-Pajares, K Brøndum-Nielsen, N Tommerup, M Bugge, H-H Ropers, et al. Systematic characterisation of disease associated balanced chromosome rearrangements by FISH: cytogenetically and genetically anchored YACs identify microdeletions and candidate regions for mental retardation genes
J. Med. Genet.,
April 1, 1999;
36(4):
271 - 278.
[Abstract][Full Text]
CiteULike 
Connotea 
Del.icio.us What's this?
