Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (200)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cruts, M.
Right arrow Articles by Van Broeckhoven, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cruts, M.
Right arrow Articles by Van Broeckhoven, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 43-51


Estimation of the genetic contribution of presenilin-1 and -2 mutations in a population-based study of presenile Alzheimer disease
Introduction
Results
   Mutation analysis of PS-1 and PS-2
   Segregation analysis
Discussion
Materials And Methods
   Subjects
   Polymerase chain reaction (PCR) analyses
   cDNA sequence analysis
Acknowledgements
References


Estimation of the genetic contribution of presenilin-1 and -2 mutations in a population-based study of presenile Alzheimer disease

Estimation of the genetic contribution of presenilin-1 and -2 mutations in a population-based study of presenile Alzheimer disease Marc Cruts1, Cornelia M. van Duijn2, Hubert Backhovens1, Marleen Van den Broeck1, Anita Wehnert1, Sally Serneels1, Robin Sherrington3, Michael Hutton4, John Hardy4, Peter H. St George-Hyslop3, Albert Hofman2 and Christine Van Broeckhoven1,*

1Laboratory of Neurogenetics, Flanders Interuniversity Institute for Biotechnology (VIB), Born-Bunge Foundation (BBS), University of Antwerp (UIA), Department of Biochemistry, Antwerpen, Belgium, 2Department of Epidemiology and Biostatistics, Erasmus University, Rotterdam, The Netherlands, 3Centre for Research into Neurodegenerative Diseases, Department of Medicine and Medical Biophysics, University of Toronto, Toronto, Canada and 4Neurogenetics Laboratory, The Mayo Clinic, Jacksonville, FL, USA

Received August 1, 1997; Revised and Accepted October 2, 1997

Two closely related genes, the presenilins (PS), located at chromosomes 14q24.3 and 1q42.1, have been identified for autosomal dominant Alzheimer disease (AD) with onset age below 65 years (presenile AD). We performed a systematic mutation analysis of all coding and 5'-non-coding exons of PS-1 and PS-2 in a population-based epidemiological series of 101 unrelated familial and sporadic presenile AD cases. The familial cases included 10 patients of autosomal dominant AD families sampled for linkage analysis studies. In all patients mutations in the amyloid precursor protein gene (APP) had previously been excluded. Four different PS-1 missense mutations were identified in six familial cases, two of which where autosomal dominant cases. Three mutations resulted in onset ages above 55 years, with one segregating in an autosomal dominant family with mean onset age 64 years (range 50-78 years). One PS-2 mutation was identified in a sporadic case with onset age 62 years. Our mutation data provided estimates for PS-1 and PS-2 mutation frequencies in presenile AD of 6 and 1% respectively. When family history was accounted for mutation frequencies for PS-1 were 9% in familial cases and 18% in autosomal dominant cases. Further, polymorphisms were detected in the promoter and the 5'-non-coding region of PS-1 and in intronic and exonic sequences of PS-2 that will be useful in genetic association studies.

INTRODUCTION

Alzheimer disease (AD) is the most common cause of senile dementia and the fourth leading cause of death in western societies. AD is a neurodegenerative disorder of the central nervous system characterized by progressive loss of memory and intellectual functioning due to the appearance in the brain of two major lesions: senile plaques and neurofibrillary tangles. The exact biochemical pathway leading to neurodegeneration is still unknown. In most AD cases the first symptoms of memory dysfunction or behavior changes become apparent after age 65 years (late-onset or senile AD); however, in many cases the disease starts earlier in life (early-onset or presenile AD). There are no indications that the disease in presenile AD cases is different from that observed in senile AD cases, apart from a more severe pathology and more rapid clinical progression. Both senile and presenile AD have a genetic etiology; however, genetic cases are more frequent among presenile AD cases (for a review see 1 ). Also, several AD families have been documented that segregate presenile AD in an autosomal dominant manner. In these families a positional cloning approach has been employed to identify AD genes (for a review see 1 ). To date, three AD genes are known that, when mutated, lead to presenile AD: the amyloid precursor protein gene (APP) on chromosome 21 at 21q21.1 (2 ); the presenilin-1 gene (PS-1) on chromosome 14 at 14q24.3(3 ); the presenilin-2 gene (PS-2) on chromosome 1 at 1q42.1 (4 ,5 ). Although the normal function of the amyloid precursor protein (app) is unknown, mutations have been demonstrated to alter endoproteolysis of app such that more of a 42 amino acid long form of amyloid [beta] (A[beta]42) is produced (6 ). Rapid deposition of A[beta]42 in AD brains is an early morphological event in AD pathology. Also, the normal and pathological functions of the presenilin proteins (ps-1 and ps-2) are unknown (for a review see 7 ). Since they both constitute integral membrane proteins with six to eight transmembrane domains (TM) and one large hydrophilic loop (HL) (8 ,9 ), similar functions of ps-1 and ps-2 were predicted. Remarkably, mutations in PS-1 and PS-2 also produce more A[beta]42, suggesting that PS mutations and APP mutations lead to AD pathology through a common biochemical pathway.

In APP seven different mutations have been identified in autosomal dominant families with presenile AD or AD-related phenotypes (6 ). All mutations occur in exons 16 and 17, encoding the A[beta] proteolysis product of app. However, extensive mutation analyses have shown that mutations in APP are rare, since they segregate in only 5% of the presenile AD families (1 ). Since the PS genes were identified more recently (for a review see 7 ), extensive mutation analyses have not yet been performed. However, initial estimates based on linkage analysis studies suggested that 70% of the presenile AD families were linked to chromosome 14 (10 ). Later, a mutation in PS-1 was found in each chromosome 14-linked AD family (3 ,11 ,12 ). To date 42 different missense mutations and one in-frame splice site mutation in PS-1 have been reported in 82 families world wide (13 ). Mutation screenings of PS-1 in presenile AD families not selected on the basis of linkage to chromosome 14 indicated that PS-1 mutations contribute less (30-50%) than initially estimated (14 ,15 ). A possible explanation for the lower mutation frequency of PS-1 may be that the initial mutation data were biased towards finding PS-1 mutations, since most families analyzed had been included in a genome-wide search for AD genes and were known to be linked to chromosome 14. Only one mutation has been reported in a proven non-familial AD case (16 ); however, only few mutation studies of sporadic AD cases have been performed.

Initial linkage studies indicated that PS-2 mutations are far less frequent than PS-1 mutations (5 ). Apart from the one PS-2 mutation identified in the chromosome 1-linked group of Volga German AD families, only one other PS-2 mutation has been identified to date (5 ,17 ). However, in contrast to PS-1 families onset ages in PS-2 families are highly variable and usually later in life (13 ). Therefore, it cannot be excluded that PS-2 families may have been missed, since presenile AD families with earlier onset ages are more likely to be ascertained for linkage analysis studies since they have more clear inheritance patterns. To date no mutation reports of PS-2 in non-familial presenile AD cases have been published; however, PS-2 has been less intensively investigated for mutations than PS-1.

In this study we aimed at evaluating the genetic contributions of PS-1 and PS-2 mutations to presenile AD in autosomal dominant, familial and sporadic cases. To overcome several of the biases mentioned above we used a unique sample of 101 unrelated familial and sporadic presenile AD cases ascertained in a population-based manner in The Netherlands (18 ,19 ). The sample contained 11 autosomal dominant, 56 familial and 34 sporadic presenile AD cases. The mean onset age was 56.7 ± 5.4 years (range 45-64 years), being lower than 60 years in 71 cases and lower than 50 years in 10 cases. In the autosomal dominant AD families all probands had an onset age before 65 years; however, in four families the mean onset age was above 65 years. In addition we analyzed the families of 10 autosomal dominant presenile AD cases included in this population-based study (20 ). In all cases mutations in exons 16 and 17 of the APP gene were previously excluded (19 ,20 ) while one family was shown to be linked to chromosome 14 (20 ).

Table 1 . Intronic PCR primers flanking the coding and 5'-non-coding exons of PS-1 and PS-2
PS-1 PS-2
Exon Primer Sequence Size (bp) Exon Primer Sequence Size (bp)
1A S182ex1A-3 TTCTCCCCGCAATCGTTTCTCCAG 297 1 PS-2ex1-3 TGTTAGCAGCGGTGTTTG 248
  S182ex1A-4 GCCCATGTCCGCGGTGCCTTCC     PS-2ex1-4 TCTGCTCGGAGGGATGGAC
1B S182ex1B-3 AGGAGGGGCGGCCCGTTTCTCG 523 2 PS-2ex2-1 CAGGGCCAGGGGGAGGAA 303
  S182ex1B-4 AGCCTCTGCCACCACCGNAGGATC     PS-2ex2-2 AAAAGCAGGTTGGGAGTCAC
2 S182ex2-3 TGGATGACCTGGTGAAATCCTATT 223 3 PS-2ex3-1 GTCCTCCACTGCCTTTGTCTCAC 328
  S182ex2-4 CAGAAAACAAAGCCTCTTGAGGTT     PS-2ex3-2 CTTCCCTTCTCCCTCCCGCATCAG
3 S182ex3-1 ACAAAGTTCTGTTTTTCTTTCCC 247 4 52PS-2x4 AAAAATCCGTGCATTACAT 395
  S182ex3-2 CAGCATTTCTCAGAGGTGAGG     3PS-2x4 GCTGGTTGTGAGCTGCAGGTACAGTG
4 S182ex4-1 CGTTACCTTGATTCTGCTGA 371 5 PS-2-ex5-1 AGCCTCGAGGAGCAGTCAG 241
  S182ex4-2 GACATGCTGTAAAGAAAAGCC     PS-2-ex5-2 GCAGACGGAGAGAAGCGT  
5 S182ex5-3 GATTGGTGAGTTGGGGAAAAGTG 335 6 5PS-2x6 GGTATCAGTCTCAGGATCATGGG 265
  S182ex5-4 ATACCCAACCATAAGAAGAACAGG     3PS-2x6 TGGGGAAGACTGGAGCTCGATG  
6 S182ex6-3 GGTTGTGGGACCTGTTAATT 149 7 PS-2-ex7-1 GTAAAGAGGGCCAGGTTGGG 387
  S182ex6-4 TTAATTCTGAAAGACAGACCC     PS-2-ex7-2 GTGCAGCACTGGGGACGATTT  
7 S182ex7-1 GGAGCCATCACATTATTCTAAA 326 8 52PS-2x8 GGGCAGGCTCTTCTTCAGGG 251
  S182ex7-2 AACAAATTATCAGTCTTGGGTTT     3PS-2x8 GAAAGCCACGGCCAGGAAG  
8 S182ex8-1 TTACAAGTTTAGCCCATACATTTT 215 9 PS-2ex9-3 ACCGCCTGAGACGTGAACCTT 235
  S182ex8-2 TCAAGTTCCCGATAAATTCTAC     PS-2ex9-4 TCCCTCTGCCCCTCCTGAACT  
9 S182ex9-1 TGTGTGTCCAGTGCTTACCTG 188 10 5PS-2x10 CTCTGACCAGCTGTTGTTTC 249
  S182ex9-2 TGTTAGCTTATAACAGTGACCCTG     3PS-2x10 AGCCTCCACCCTCTGTCT
10 S182ex10-1 CCAGCTAGTTACAATGACAGC 345 11 5PS-2x11 TTCCATTCTGTGCACGCCTC 244
  S182ex10-2 TCAAAAAGGTTGATAATGTAGCT     3PS-2x11 ACCTGCCCCCACCACAATG  
11 S182ex11-1 GGTTGAGTAGGGCAGTGATA 275 12 PS-2ex12-3 ACACCAGGGATCACCACGCTCAC 344
  S182ex11-2 TTAAAGGGACTGTGTAATCAAAG     PS-2ex12-4 TGCCTCCTCCTCACCAAGTAAACA
12 S182ex12-1 GTCTTTCCCATCTTCTCCAC 199
  S182ex12-2 GGGATTCTAACCGCAAATAT

Table 2 . Missense mutations detected in PS-1 and PS-2
Gene Exon Location Mutation Family Onset age (years) Family historya Restriction site change
PS-1 4 236C -> T Ala79Val 1005 53 AD AciI, BbeI, BanI, EheI, HaeII, HinP1I, HhaI, Hsp92I, KasI, NarI, NlaIV
        1087 55 F  
        1061 58 F  
  5 344A -> G Tyr115Cys 1066 45 AD Csp6I, RsaI
  7 692C -> T Ala231Val 1072 58 F BglI, Bsp1286I, MwoI
  9 953A -> G Glu318Gly 1069 57 F
PS-2 4 185G -> A Arg62His 1121 62 S AciI
aAD, autosomal dominant; F, familial; S, sporadic.Nucleotide positions are relative to the translation start site in the PS-1 or PS-2 cDNA. Restriction enzymes used in this study to test for the presence of the mutation are denoted in bold (Fig. 1A). The pedigrees of families with a PS-1 mutation are depicted in Figure 2.

Table 3 . Polymorphisms detected in PS-1 and PS-2
Gene Exon Location Codon Allele frequencies Restriction site change
PS-1 1A (-48)C -> T   0.88/0.12 HgaI, Hsp96I, SfaNI
  1B -364C -> A   0.18/0.82 BstXI
  8 (+16)A -> C   0.54/0.46 Alw26I
PS-2 3 69C -> T Ala23 0.79/0.21 DdeI
  3 129C -> T Asn43 n.d. TspRI
  4 (-42)A -> G   0.54/0.46 NcoI, NlaIII, StyI
  4 261C -> T His87 0.46/0.54 BbrPI, BsaAI, Eco72I, MaeII, NlaIII, NspI, TaiI
  5 366G -> A Thr122 n.d.  
  7 708T -> C Ser236 n.d. BssHII, BstUI, Cag8I, HinPI, TspRI
  11 (+24)A -> G   0.55/0.45 AluI, Bst71I, BstF5I, CviJI, MspA1I, PvuII
The nucleotide position of exonic polymorphisms are relative to the translation start site in the PS-1 or PS-2 cDNA. The nucleotide positions of intronic polymorphisms are relative to the start (+) or end (-) of the intron. Allele frequencies were determined in the 118 control individuals using the restriction enzymes denoted in bold (Fig. 1B). n.d., not determined.

RESULTS

Mutation analysis of PS-1 and PS-2

Previously, the complete genomic structure of PS-1 and PS-2 was determined identifying 10 coding exons in each gene (21 ,22 ). In order to avoid confusion we used the exon numbering 3-12 for PS-1 in this study, as introduced by Clark et al. (11 ). Intronic primer pairs were designed allowing PCR amplification of the 10 coding exons of PS-1 and PS-2 (Table 1 ). All 101 AD patients were examined for mutations in PS-1 and PS-2 by SSCP analysis and PCR cycle sequencing.

In PS-1 we identified four missense mutations in exons 4, 5, 7 and 9 respectively and one intronic polymorphism in intron 8 (Tables 2 and 3 and Fig. 1 ). The Ala79Val mutation was identified in three patients (1005, 1061 and 1087) (Table 2 ). To test whether the mutation in the three patients has the same ancestral origin we genotyped three simple tandem repeat (STR) markers flanking PS-1 (23 ,24 ). For D14S1028, D14S77 and D14S1004 all patients shared one common allele with allele frequencies calculated among the cases of respectively 0.27, 0.05 and 0.12. These data suggested that the three patients carrying the Ala79Val mutation might be related, although not closely, since genealogy studies had not indicated a familial relationship. The other three mutations occurred only once and none of the mutations were present in the 118 control individuals. The polymorphism observed in intron 8 is identical to that reported by Wragg et al. (25 ) and allele frequencies were determined by the primer mismatch PCR assay described by those authors (Table 3 ). Since the SSCP pattern of the intron 8 polymorphism could have masked the presence of mutations, we sequenced exon 8 in all cases. No other mutations were found.


Figure 1. Restriction enzyme analyses of mutations and polymorphisms in PS-1 and PS-2. PCR amplified exons were digested with the restriction enzymes indicated. (A) Missense mutations in PS-1 and PS-2. (B) Polymorphisms in PS-1 and PS-2.

In one patient a missense mutation in PS-2 was detected, resulting in an Arg -> His substitution at codon 62 in exon 4 (Table 2 and Fig. 1 A). Restriction digestion analysis showed that the mutation was absent in the other patients and controls. In addition, SSCP and sequence analysis of exon 4 identified two different polymorphisms in intron 3 and at codon His87 respectively (Table 3 ). Also, the SSCP patterns observed for exons 3, 5, 7 and 11 were due to polymorphisms, since the nucleotide changes involved intronic variations or exonic silent mutations (Table 3 and Fig. 1 B). The polymorphism in exon 5 (Thr122) was seen in only one patient and represents a very rare polymorphism. Also, the polymorphism in exon 7 (Ser236) is rare, since it was seen in only two patients. The allele frequencies of the other more frequent polymorphisms were estimated in the 118 control individuals by restriction enzyme digestion (Table 3 ). Comparison of the allele distribution in 15 control individuals showed that the two exon 3 polymorphisms are in linkage disequilibrium. Also, the two exon 4 polymorphisms are in linkage disequilibrium. Further, we demonstrated that the PS-2 polymorphisms in exons 3 (Ala23) and 4 (His87) and intron 11 show Mendelian inheritance.

To complete the mutation analysis of PS-1 and PS-2 we developed flanking primers for the three exons located in the 5'-untranslated region (5'-UTR) of PS-1 (numbered exons 1A, 1B and 2) and the two 5'-UTR of PS-2 (21 ,26 ). SSCP analysis followed by PCR cycle sequencing revealed two polymorphisms in the 5'-UTR of PS-1, but no mutations (Table 3 ). Allele frequencies of both polymorphisms were estimated by SSCP analysis of exon 1A and restriction digestion of exon 1B (Table 3 and Fig. 1 B). Mendelian inheritance of both polymorphisms was demonstrated. No mutations or polymorphisms were detected in the 5'-UTR of PS-2.

Although SSCP analysis of PS-1 and PS-2 was negative in eight of the 10 autosomal dominant probands included in our sample, we could not rule out that mutations may have been missed, since the sensitivity of SSCP is not 100%. Therefore, we performed a mutation analysis of PS-1 and PS-2 cDNA synthesized from RNA isolated from cultured lymphoblasts of a patient and an escapee. No other than the Ala79Val and Tyr115Cys mutations in PS-1 were detected.

Segregation analysis

All six PS-1 mutations occurred in patients with a positive family history of presenile AD, while the PS-2 mutation was observed in a sporadic case (Table 2 ). Two PS-1 mutations were present in autosomal dominant cases (1005 and 1066), while four PS-1 mutations were detected in familial cases (1061, 1069, 1072 and 1087) (Fig. 2 ). In the latter families the inheritance pattern was consistent with autosomal dominant transmission (Fig. 2 ); however, these families had not been selected for linkage studies since they did not fulfil our rigid criteria for autosomal dominant AD (1061, 1069 and 1087) or showed bilineal transmission of AD (1072) (20 ). Only in family 1072 were additional family members available and the PS-1 mutation Ala231Val was shown to be present in at-risk individuals.


Figure 2. Pedigrees of the families of the autosomal dominant AD cases and the familial cases in which a PS-1 mutation was observed. Probands were included in the mutation analysis, except for families 1005 (III-20) and 1066 (V-2). Families 1061, 1069, 1072 and 1087 had not been included in our previous linkage studies (20). Symbols: circles depict females, squares depict males; open symbols: unaffected individuals; filled symbols: AD patients; partly filled symbols: patients diagnosed with CVA. Roman numbers to the left of the pedigree denote generations. Numbers below the patient symbols denote age at onset or age at death ([dagger]). Arrows indicate the probands. Patients that had autopsy confirmation of AD are indicated by an asterisk.

In autosomal dominant families 1005 and 1066 co-segregation of the mutation with presenile AD was confirmed by restriction enzyme digestion (Table 2 and Fig. 1 A). Previously we had used the informative families of the 10 autosomal dominant cases included among the 101 cases in genetic linkage studies (20 ). Family 1066 (mean onset age 42 years) was linked to D14S43 located at chromosome 14q24.3 [multipoint LOD score (Z = 3.71) at zero recombination] (20 ). Family 1005 was not informative for the chromosome 14 STR markers used.

DISCUSSION

Mutation analysis of all 10 coding exons as well as the 5'-non-coding exons of PS-1 and PS-2 by SSCP analysis and PCR cycle sequencing identified four different missense mutations in PS-1 in six patients (Ala79Val, Tyr115Cys, Ala231Val and Glu318Gly) and one missense mutation in PS-2 in one other patient (Arg62His) among 101 unrelated presenile AD cases in our study. All but one of the mutations (7 ,27 ) are novel mutations that were absent in 118 control individuals. Based on our mutation data we calculated a mutation frequency of 6% for PS-1 and 1% for PS-2 in presenile AD. Since all PS-1 mutations occurred in familial cases, i.e. cases with at least one first degree relative with AD, the mutation frequency is estimated at 9% (six out of 67 cases) in familial presenile AD cases. Among the familial cases in our study there were 11 cases belonging to families fulfilling our rigid criteria for autosomal dominant AD, i.e. three patients in two generations with a clinical diagnosis of AD in at least two cases (20 ). In two autosomal dominant families a PS-1 mutation was found resulting in a mutation frequency of 18% (two out of 11 cases) in autosomal dominant presenile AD.

Since the mutation screening of PS-1 and PS-2 was performed by SSCP analysis, we cannot exclude that our estimates of mutation frequencies of PS-1 and PS-2 are underestimates, as the sensitivity of SSCP is not 100% (28 ). However, we systematically analyzed each PCR-amplified exon of PS-1 and PS-2 together with positive controls of known mutations in the presence and absence of glycerol as denaturant. Mutations in PS-1 and PS-2 may also have been masked by polymorphisms in exonic and flanking intronic sequences. When polymorphic SSCP patterns were observed we sequenced the PCR products in five to 10 cases showing homozygous and heterozygous SSCP patterns. In each case the underlying polymorphism was detected and confirmed by restriction enzyme digestion of the amplified product. The efficiency of our mutation analysis strategy is demonstrated by detection of a mutation in exon 4 of PS-2 in one patient that had a unique SSCP pattern different from that of the polymorphic SSCP patterns observed for exon 4. Also, sequence analysis of the polymorphic PCR products of exon 8 of PS-1 identified no mutations.

The onset age in the PS-1 mutation cases varied from 45 to 58 years, with three mutations (Ala79Val, Ala231Val and Glu318Gly) having onset ages above 55 years (Table 2 ). Most PS-1 mutations reported so far had onset ages between 35 and 55 years (29 ). However, the majority of these mutations were located in exons 5 and 8, coding in part for TM II and the large HL after TM VI (13 ). Here the mutations are predicted to interfere with the [alpha]-helical structure of TM II or the proteolytic processing of ps-1 occurring in HL VI (7 ). The ps-1 mutations identified in this study are located in the N-terminal region (Ala79Val in exon 4), in TM V (Ala231Val in exon 7) and in the middle part of HL VI (Glu318Gly in exon 9). Most likely these mutations have a milder effect on ps-1 functioning, possibly because the amino acid changes are semi-conserved (Ala79Val and Ala231Val) or they are located in a functionally less important region (Glu318Gly). The Glu318 mutation is located in a region of ps-1 that is less conserved in ps-2 and ps of other species (13 ). Also, co-segregation of the Glu318Gly mutation with AD could not be demonstrated, since no other relatives in family 1069 were available. High variability in onset age was observed in PS-1 family 1005 segregating the Ala79Val mutation with a mean onset age in the family of 64 years, ranging from 55 to 78 years. In one mutation carrier the disease was not yet fully penetrant at age 76 years. Possibly, the onset age in this family is modulated by other genetic and/or environmental factors. In this respect it is important to note that the non-penetrant case had an APOE [epsilon]3[epsilon]3 genotype, which may have delayed his onset age (30 ). However, APOE studies in larger samples of PS-1 cases and families are needed to conclude that the APOE genotype modulates expression of PS-1 mutations. Also, no effect of the APOE genotype on onset age was observed in chromosome 14-linked AD families with PS-1 mutations, leading to very early onset ages and severe phenotypes (31 ). Another possibility is that the PS-1-linked phenotype is modulated by a polymorphism in ps-2 or that mutations in ps-1 and ps-2 act together to express the disease phenotype (digenic effect). However, SSCP analysis as well as RT-PCR analysis of PS-2 cDNA did not detect sequence alterations in ps-2. Family 1005 is also of particular interest since in this family several patients had been identified with cerebrovascular accidents (CVA) (Fig. 2 ). However, none of them carried the PS-1 mutation, indicating that the CVAs in this family are not related to presenile AD. In contrast to the previous three PS-1 mutations, the Tyr115Cys mutation in exon 5, corresponding to HL I, was detected in chromosome 14-linked family 1066, with mean onset age of 42 years (range 39-49 years) (20 ). The latter provides evidence that some of the earlier mutation studies may indeed have been biased towards finding PS-1 mutations resulting in earlier onset ages and more severe phenotypes.

Only one PS-2 mutation, Arg62His, was observed in a sporadic AD case with an onset age of 62 years. The two published PS-2 mutations had been identified in autosomal dominant families with presenile AD in TM II and TM V of ps-2 (4 ,5 ). The mutated Arg62 codon is not conserved in human ps-1 and ps of other mammalian species and is located in a region of the N-terminal domain that is generally not conserved between ps-1, ps-2 and the Caenorhabditis elegans homolog sel-12 (32 ). Also, the mutation itself is a conserved amino acid substitution. Therefore, it cannot be excluded that this ps-2 mutation is a rare polymorphism not related to AD pathogenesis, since the patient also had an APOE [epsilon]3[epsilon]4 genotype which may have increased her risk of developing AD (30 ).

In conclusion, our mutation data showed that PS-1 and PS-2 mutations are rare genetic causes of presenile AD in general. Also, the frequency of PS-1 mutations in autosomal dominant AD families (18%) is less frequent than initially estimated. No mutations were identified in exons 16 and 17 of APP of any of the cases (33 ), suggesting that other AD genes must exist. It is possible that a fraction of the cases may be attributed to the presence of an APOE [epsilon]4 allele. In a previous study of this population-based sample we demonstrated that the risk for developing presenile AD is significantly increased in APOE [epsilon]4 homozygotes independent of family history and in APOE [epsilon]4 heterozygotes in which the family history is positive (33 ). In the sample of 101 cases there were 19 APOE [epsilon]4 homozygotes and 31 familial APOE [epsilon]4 heterozygotes.

In contrast to previous reports (29 ), we observed several PS-1 mutations leading to AD with onset ages above 55 years. Also, one of these PS-1 mutations was identified in an autosomal dominant family with a mean onset age of 64 years (range 55-78 years). The identification of these PS-1 mutations predicts that PS-1 mutations with even milder effects on ps-1 functioning may be present in senile AD. This is of particular importance since a genetic association between an intronic PS-1 polymorphism and senile AD has been reported (25 ), although this association could not be replicated in all studies. Possibly, the association is the result of a functionally more relevant sequence variation elsewhere in the PS-1 gene. Preliminary data obtained by sequence analysis failed to demonstrate sequence variations in the coding region of PS-1 (25 ). However, the promoter and 5'-non-coding region of PS-1 had not been examined, since these sequences became available only recently. In this respect the identification by us of two polymorphisms in the 5'-non-coding region of PS-1 is of interest, since these polymorphisms may be used in genetic association studies to test whether PS-1 is also a susceptibility gene for senile and/or presenile AD. Also, the intronic and exonic polymorphisms identified in PS-2 are useful to test the role of this gene in AD, an analysis that has not yet been performed.

MATERIALS AND METHODS

Subjects

All patients with a clinical diagnosis of AD and onset at or before age 65 years, made in the period January 1980 and July 1987, living in metropolitan Rotterdam and the four northern provinces were ascertained (18 ). The clinical diagnosis of AD was independently confirmed by two neurologists using a standardized protocol according to NINCDS-ADRDA criteria for AD (34 ). A total of 198 patients participated in the study (18 ). Onset age was defined as the age at which memory problems or behavior changes were first noted. Cases were considered familial when at least one first degree relative suffered from dementia. The percentage of familial cases in the total sample of presenile AD patients was 48% (18 ,33 ). Of familial cases the pedigree was considered to segregate with autosomal dominant AD if at least three patients with dementia were reported in two generations and if there were at least two patients with detailed medical records on the clinical diagnosis of AD (18 ,33 ).

Blood samples were drawn from 100 randomly selected AD patients (33 ) and detailed data on family history of disease were collected (18 ). Affected and unaffected relatives of 17 families were visited at home, where blood was drawn. All relatives were assessed for family history of disease, risk factors for AD and memory performance (20 ). Blood samples were obtained from 118 control individuals matched for age within 5 years and place of residence. The controls were drawn randomly from the population register of the municipality of the patient (33 ). Cognitive status of the control individuals was tested and none of them showed symptoms of dementia at the time of the study. Leukocytes were collected from total blood of the patients and relatives and permanent lymphoblast cell lines were obtained by transformation using Ebstein-Barr virus. DNA was extracted from total blood or cultured lymphoblasts using a standard phenol/chloroform DNA extraction procedure.

In our initial genetic analyses of the 100 cases we had included nine autosomal dominant cases. However, recently an at-risk individual in 1066 (V-2, Fig. 2 ) was diagnosed with probable AD and included in this study, bringing the total number of cases to 101. Mutation analysis of exons 16 and 17 of APP excluded the presence of APP mutations in all cases (33 ). The informative families of 10 autosomal dominant cases were used in linkage analysis studies with chromosome 14, 19 and 21 markers (20 ). Family 1066 (mean onset age 42 years) was conclusively linked to chromosome 14, while two others were excluded. The other results were not informative. Since the linkage analysis studies were performed before the presenile AD locus on chromosome 1 was identified, the families had not been analyzed for linkage with chromosome 1 markers.

Polymerase chain reaction (PCR) analyses

About 200 ng DNA were amplified in a 25 µl reaction mixture containing 20 pmol each primer, 0.2 mM dNTPs, 0.2 U Taq DNA polymerase (Gibco-BRL, Gaithersburg, MD), 1.0 mM MgCl2, 75 mM Tris-HCl, pH 9.0, 20 mM (NH4)2SO4 and 0.01% Tween-20. The PCR amplification consisted of 30 cycles of 90 s at 94°C, 90 s at the empirically defined optimal annealing temperature and 90 s at 72°C.

In the PCR-SSCP analyses intronic PCR primers were used to amplify the exons and flanking intronic sequences of PS-1 and PS-2 (Table 1 ). The PCR amplification products were heat denatured, cooled on ice and separated using two different electrophoresis systems. The coding exons of PS-1 were analyzed on a 1× HydroLink MDE gel (J.T.Baker, Phillipsburg) with and without 10% glycerol. Electrophoresis was for 20 h at 800 V and at 4°C (with glycerol) or room temperature (without glycerol). The SSCP/heteroduplex patterns were visualized using silver staining. Alternatively, the non-coding exons of PS-1 and all exons of PS-2 were analyzed on a MultiPhorII electrophoresis system (Pharmacia Biotech, Uppsala, Sweden) using ExcellGel precast polyacrylamide gels and 1× HydroLink MDE gels containing 5% glycerol. Electrophoresis was at 600 V for 2-5 h, depending on the product sizes, and SSCP patterns were visualized using silver staining. SSCP analyses of exons 5-8, and 11 of PS-1 were performed in the presence of positive control samples of the Ile143Thr, Met146Leu, His163Arg, Ala246Glu, Leu286Val, Gly384Ala and Cys410Tyr mutations (3 ,23 ). When aberrant SSCP patterns were observed the sequences of the fragments were determined using cycle sequencing. The PCR amplification products were pretreated with 10 U exonuclease I and 2 U shrimp alkaline phosphatase to remove excess PCR primers and nucleotides. PCR amplification product (5 µl) was used as template in the cycle sequencing reaction using the ABI PRISM Dye Terminator Cycle Sequencing Core Kit (Applied Biosystems, Foster City, CA) according to the supplier's protocol, using the same primers as in the PCR amplification. The sequences were analyzed on an ABI 373A automated DNA sequencer.

Sequence variations in PS-1 and PS-2 were analyzed by restriction enzyme digestion of amplified products when they involved the creation or abolition of a restriction enzyme recognition site. Also, the intron 8 polymorphism in PS-1 was analyzed by BamHI digestion as described (25 ). Genomic PCR amplification products were digested for 3 h using 5 U of the corresponding restriction enzyme (Tables 2 and 3 ) at the appropriate reaction temperature. The restriction fragments were separated on a 1.5-3% agarose gel, depending on the allele sizes, and visualized on an UV transilluminator after EtBr staining.

The APOE genotype was scored by PCR amplification of genomic DNA using published primers (35 ) in a standard PCR of 35 cycles. After digestion with 5 U HhaI for 3 h at 37°C the alleles were separated on ExcellGel precast polyacrylamide gels as described above and visualized using silver staining.

The STRs D14S1028, D14S77 and D14S1008 were amplified in a standard PCR using published primer sets, one of which was fluorescently labeled. The alleles were separated on a 6% polyacrylamide gel containing 8 M urea and analyzed on an ABI 373A automated DNA sequencer using GENESCAN 672 software (Applied Biosystems).

cDNA sequence analysis

Approximately 107 lymphoblast cells were homogenized in the presence of 1 ml TRIzol (Gibco-BRL). RNA was isolated by chloroform extraction and precipitated with isopropanol. After centrifugation for 10 min in a microfuge, the pellet was washed with 75% EtOH and dissolved in 20 µl DEPC-treated H2O. First strand cDNA synthesis was performed with random primers using the SuperScript pre-amplification kit (Gibco-BRL) as described in the protocol supplied with the kit. The RNA was removed by adding 2 U RNase H and incubating for 20 min at 37°C. A standard PCR amplification of 30 cycles was performed using 100 ng first strand cDNA as template. Then PS-1 cDNA was PCR amplified using primer pairs 917/892, 901/111R and 1017/852 (3 ). The sequence of the amplification products was determined by cycle sequencing as described above. Sequencing primers were as published (3 ,23 ). PS-2 cDNA was PCR amplified using primer pairs STM2-6/7 (5'-AACCAGCGCTGCCCTCTTTGAA-3' and 5'-AGGATGACCCACGCGGACCACTC-3') and STM2-8/9 (5'-CTACCCCACCCTCTTGCTGACTGT-3' and 5'-CTCCCCGCCCTAATCTGACCTTCT-3'). Cycle sequencing was performed using the same primers, primer 1021 (5 ) (5'-CAGAGGATGGAGAGAACAC-3'), STM2-6 (5'-AACCAGCGCTGCCCTCTTTGAA-3'), STM2-1 (5'-ATCGTGGTGGTAGCC-3'), STM2-2 (5'-GTTATGACCATCTTCTTGG-3'), STM2-4 (5'-TGTGCTGTGTCCCAAAGG-3') and PS2-1742AS (5'-TCCAATGAAAATTCCCTGC-3'). The sequence of the PS-2 cDNA was determined by cycle sequencing as described above.

ACKNOWLEDGEMENTS

The work described in this study was financed in part by the Fund for Scientific Research-Flanders (Belgium) (FWO), the Flemish Biotechnology Programme, the DWTC Interuniversity Attractionpoles, European BIOTECH grant CT96-0743, the American Health Assistance Foundation and grants of the Netherlands Organization of Scientific Research (NWO). We thank Drs Wim Schulte, Teun Tanja, Rob Haaxma, Arie Lameris and Rolf Saan for assisting with the case diagnoses and Helen de Bruijn, Micheline de Haes, Jeanette Kammen, Hilda Kornman, Hanneke van Meurs and Caroline Valkenburg for genealogy studies. Marc Cruts is a post-doctoral fellow of the FWO.

REFERENCES

1 Van Broeckhoven,C. (1995) Molecular genetics of Alzheimer disease: identification of genes and gene mutations. Eur. Neurol., 35, 8-19. MEDLINE Abstract

2 Goate,A., Chartier-Harlin,M., Mullan,M., Brown,J., Crawford,F., Fidani,L., Giuffra,L., Haynes,A., Irving,N., James,L., Mant,R., Newton,P., Rooke,K., Roques,P., Talbot,C., Pericak-Vance,M., Roses,A., Williamson,R., Rossor,M., Owen,M. and Hardy,J. (1991) Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease. Nature, 349, 704-706. MEDLINE Abstract

3 Sherrington,R., Rogaev,E.I., Liang,Y., Rogaeva,E.A., Levasque,G., Ikeda,M., Chi,H., Lin,C., Li,G., Holman,K., Tsuda,T., Mar,L., Foncin,J.F., Bruni,A.C., Montesi,M.P., Sorbi,S., Rainero,I., Pinessi,L., Nee,L., Chumakov,I., Pollen,D., Brookes,A., Sansosu,P., Polinsky,R.J., Wasco,W., Da Silva,H.A.R., Haines,J.L., Pericak-Vance,M.A., Tanzi,R.E., Roses,A.D., Fraser,P.E., Rommens,J.M. and St George-Hyslop,P. (1995) Cloning of a gene bearing mis-sense mutations in early-onset familial Alzheimer's disease. Nature, 375, 754-760. MEDLINE Abstract

4 Levy-Lahad,E., Wasco,W., Poorkaj,P., Romano,D.M., Oshima,J., Pettingell,W.H., Yu,C., Jondro,P.D., Schmidt,S.D., Wang,K., Crowley,A.C., Fu,Y., Guenette,S.Y., Galas,D., Nemens,E., Wijsman,E.M., Bird,T.D., Schellenberg,G.D. and Tanzi,R.E. (1995) Candidate gene for the chromosome 1 familial Alzheimer's disease locus. Science, 269, 973-977. MEDLINE Abstract

5 Rogaev,E.I., Sherrington,R., Rogeava,E.A., Levesque,G., Ikeda,M., Liang,Y., Chi,H., Lin,C., Holman,K., Tsuda,T., Mar,L., Sorbi,S., Nacmias,B., Piancentini,S., Amaducci,L., Chumakov,I., Cohen,D., Lannfelt,L., Fraser,P.E., Rommens,J.M. and St George-Hyslop,P.H. (1995) Familial Alzheimer's disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer's disease type 3 gene. Nature, 376, 775-778. MEDLINE Abstract

6 Hardy,J. (1997) Amyloid, the presenilins and Alzheimer disease. Trends Neurosci., 20, 154-159. MEDLINE Abstract

7 Cruts,M., Hendriks,L. and Van Broeckhoven,C. (1996) The presenilin genes: a new gene family involved in Alzheimer disease pathology. Hum. Mol. Genet., 5, 1449-1455. MEDLINE Abstract

8 Doan,A., Thinakaran,G., Borchelt,D.R., Slunt,H.H., Ratovitsky,T., Podlisny,M., Selkoe,D.J., Seeger,M., Gandy,S.E., Price,D.L. and Sisodia,S.S. (1996) Protein topology of presenilin 1. Neuron, 17, 1023-1030. MEDLINE Abstract

9 Lehman,S., Chiesa,R. and Harris,D.A. (1997) Evidence for a six-transmembrane domain structure of presenilin 1. J. Biol. Chem., 272, 12047-12051.

10 Schellenberg,G.D., Bird,T.D., Wijsman,E.M., Orr,H.T., Anderson,L., Nemens,E., White,J.A., Bonnycastle,L., Weber,J.L., Alonso,M.E., Potter,H., Heston,L.L. and Martin,G.M. (1992) Genetic linkage evidence for a familial Alzheimer's disease locus on chromosome 14. Science, 258, 668-671. MEDLINE Abstract

11 Alzheimer's Disease Collaborative Group: Clark,R.F., Hutton,M., Fuldner,R.A., Froelich,S., Karran,E., Talbot,C., Crook,R., Lendon,C., Prihar,G., He,C., Korenblat,K., Martinez,A., Wragg,M., Busfield,F., Behrens,M.I., Myers,A., Norton,J., Morris,J., Mehta,N., Pearson,C., Lincoln,C., Baker,M., Duff,K., Zehr,C., Perez-Tur,J., Houlden,H., Ruiz,A., Ossa,J., Lopera,F., Arcos,M., Madrigal,L., Collinge,J., Humphreys,C., Ashworth,A., Sarner,S., Fox,N., Harvey,R., Kennedy,A., Roques,P., Cline,R.T., Philips,C.A., Venter,J.C., Forsell,L., Axelman,K., Lilius,L., Johnston,J., Cowburn,R., Viitanen,M., Windblad,B., Kosik,K., Haltia,M., Poyhonen,M., Dickson,D., Mann,D., Neary,D., Snowdon,J., Lantos,P., Lannfelt,L., Rossor,M., Roberts,G.W., Adams,M.D., Hardy,J. and Goate,A. (1995) The structure of the Presenilin 1 (S182) gene and identification of six novel mutations in early onset AD families. Nature Genet., 11, 219-222.

12 Cruts,M., Backhovens,H., Wang,S.-Y., Van Gassen,G., Theuns,J., De Longhe,C., Wehnert,A., De Voecht,J., De Winter,G., Cras,P., Bruyland,M., Datson,N., Weissenbach,J., den Dunnen,J.T., Martin, J.-J., Hendriks, L. and Van Broeckhoven,C. (1995) Molecular genetic analysis of familial early-onset Alzheimer's disease linked to chromosome 14q24.3. Hum. Mol. Genet. 4, 2363-2372. MEDLINE Abstract

13 Cruts,M. and Van Broeckhoven,C. (1997) Presenilin mutations in Alzheimer's disease. Hum. Mutat., in press.

14 Campion,D., Flaman,J.-M., Brice,A., Hannequin,D., Dubois,B., Martin,C., Moreau,V., Charbonnier,F., Didierjean,O., Tardieu,S., Penet,C., Puel,M., Pasquier,F., Bellis,G., Calenda,A., Heilig,R., Martinez,M., Mallet,J., Bellis,M., Clerget-Darpoux,F., Agid,Y. and Frebourg,T. (1995) Mutations of the Presenilin-1 gene in families with early-onset Alzheimer's disease. Hum. Mol. Genet., 4, 2373-2377. MEDLINE Abstract

15 Hutton,M., Busfield,F., Wragg,M., Crook,R., Perez-Tur,J., Clark,R.F., Prihar,G., Talbot,C., Phillips,H., Wright,K., Baker,M., Lendon,C., Duff,K., Martinez,A., Houlden,H., Nichols,A., Karran,E., Roberts,G., Venter,J.C., Adams,M.D., Cline,R.T., Phillips,C.A., Fuldner,R.A., Hardy,J. and Goate,A. (1996) Complete analysis of the presenilin 1 gene in families with early onset Alzheimer's disease. Neuroreport, 7, 801-805. MEDLINE Abstract

16 Tanahashi,H., Kawakatsu,S., Kaneko,M., Yamanaka,H., Takahashi,K. and Tabira,T. (1996) Sequence analysis of presenilin-1 gene mutation in Japanese Alzheimer's disease patient. Neurosci. Lett., 218, 139-141. MEDLINE Abstract

17 Sherrington,R., Froelich,S., Sorbi,S., Campion,D., Chi,H., Rogaeva,E.A., Levesque,G., Rogaev,E.I., Lin,C., Liang,Y., Ikeda,M., Mar,L., Brice,A., Agid,Y., Percy,M.E., Clerget-Darpoux,F., Piacentini,S., Marcon,G., Nacmias,B., Amaducci,L., Frebourg,T., Lannfelt,L., Rommens,J.M. and St George-Hyslop,P.H. (1996) Alzheimer's disease associated with mutations in presenilin 2 is rare and variably penetrant. Hum. Mol. Genet., 5, 985-988. MEDLINE Abstract

18 Hofman,A., Schulte,W., Tanja,T.A., van Duijn,C.M., Haaxma,R., Lameris,A.J., Otten,V.M. and Saan,R.J. (1989) History of dementia and Parkinson's disease in 1st-degree relatives of patients with Alzheimer's disease. Neurology, 39, 1589-1592. MEDLINE Abstract

19 van Duijn,C.M., Hendriks,L., Cruts,M., Hardy,J.A., Hofman,A. and Van Broeckhoven,C. (1991) Amyloid precursor protein gene mutation in early-onset Alzheimer's disease. Lancet, 337, 978. MEDLINE Abstract

20 van Duijn,C.M., Farrer,L.A., Backhovens,H., Cruts,M., Wehnert,A., Hofman,A. and Van Broeckhoven,C. (1994) A population-based study of familial Alzheimer's disease: linkage to chromosome 14, 19 and 21. Am. J. Hum. Genet., 55, 714-727. MEDLINE Abstract

21 Rogaev,E.I., Sherrington,R., Wu,C., Levesque,G., Liang,Y., Rogaeva,E.A., Ikeda,M., Holman,K., Lin,C., Lukiw,W.J., de Jong,P.J., Fraser,P.E., Rommens,J.M. and St George-Hyslop,P.H. (1997) Analysis of the 5' sequence, genomic structure, and alternative splicing of the presenilin-1 gene (PSEN1) associated with early onset Alzheimer's disease. Genomics, 40, 415-424. MEDLINE Abstract

22 Prihar,G., Fuldner,R.A., Perez-Tur,J., Lincoln,S., Duff,K., Crook,R., Hardy,J., Phillips,C.A., Venter,C., Talbot,C., Clark,R.F., Goate,A., Li,J., Potter,H., Karran,E., Roberts,G.W., Hutton,M. and Adams,M.D. (1996) Structure and alternative splicing of the presenilin-2 gene. Neuroreport, 7, 1680-1684. MEDLINE Abstract

23 Cruts,M., Backhovens,H., Wang,S.-Y., Van Gassen,G., Theuns,J., De Jonghe,C., Wehnert,A., De Voecht,J., De Winter,G., Cras,P., Bruyland,M., Datson,N., Weissenbach,J., den Dunnen,J.T., Martin,J.-J., Hendriks,L. and Van Broeckhoven,C. (1995) Molecular genetic analysis of familial early-onset Alzheimer's disease linked to chromosome 14q24.3. Hum. Mol. Genet., 4, 2363-2372. MEDLINE Abstract

24 van Duijn,C.M., Cruts,M., Backhovens,H., Wehnert,A., Theuns,J., Van Gassen,G., Hofman,A. and Van Broeckhoven,C. (1996) A genetic association study of presenilin 1 in early-onset Alzheimer's disease. Am. J. Hum. Genet., 59 (suppl.), A192.

25 Wragg,M., Hutton,M., Talbot,C., Busfield,F., Han,S.W., Lendon,C., Clark,R.F., Morris,J.C., Edwards,D., Goate,A., Pfeiffer,E., Crook,R., Prihar,G., Philips,H., Baker,M., Hardy,J., Rossor,M., Houlden,H., Karran,E., Roberts,G. and Craddock,N. (1996) Genetic association between intronic polymorphism in presenilin-1 gene and late-onset Alzheimer's disease. Lancet, 347, 509-512. MEDLINE Abstract

26 Levy-Lahad,E., Poorkaj,P., Wang,K., Hui Fu,Y., Oshima,J., Mulligan,J. and Schellenberg,G.D. (1996) Genomic structure and expression of STM2, the chromosome 1 familial Alzheimer's disease gene. Genomics, 34, 198-204. MEDLINE Abstract

27 Sandbrink,R., Zhang,D., Schaeffer,S., Masters,C.L., Bauer,J., Förstl,H. and Beyreuther,K. (1996) Missense mutations of the S182/PS1 gene in German early-onset Alzheimer's disease patients. Annls Neurol., 40, 265-266.

28 Hayashi,K. and Yandell,D.W. (1993) How sensitive is PCR-SSCP? Hum. Mutat., 2, 338-346. MEDLINE Abstract

29 Van Broeckhoven,C. (1995) Presenilins and Alzheimer disease. Nature Genet., 11, 230-232. MEDLINE Abstract

30 Corder,E.H., Saunders,A.M., Strittmatter,W.J., Schmechel,D.E., Gaskell,P.C., Small,G.W., Roses,A.D., Haines,J.L. and Pericak-Vance,M.A. (1993) Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families. Science, 261, 921-923. MEDLINE Abstract

31 Van Broeckhoven,C., Backhovens,H., Cruts,M., Martin,J., Crook,R., Houlden,H. and Hardy,J. (1994) APOE genotype does not modulate age of onset in families with chromosome 14 encoded Alzheimer's disease. Neurosci. Lett., 169, 179-180. MEDLINE Abstract

32 Levitan,D. and Greenwald,I. (1995) Facilitation of lin-12-mediated signalling by sel-12, a Caenorhabditis elegans S182 Alzheimer's disease gene. Nature, 377, 351-354. MEDLINE Abstract

33 van Duijn,C.M., de Knijff,P., Cruts,M., Wehnert,A., Havekes,L.M., Hofman,A. and Van Broeckhoven,C. (1994) Apolipoprotein E4 allele in a population-based study of early-onset Alzheimer's disease. Nature Genet., 7, 74-78. MEDLINE Abstract

34 McKhann,G., Drachman,D., Folstein,M., Katzman,R., Price,D. and Stadlan,E.M. (1984) Clinical diagnosis of Alzheimer's disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's disease. Neurology, 34, 939-944. MEDLINE Abstract

35 Wenhan,P.R., Price,W.H. and Blundell,G. (1991) Apolipoprotein E genotyping by one-stage PCR. Lancet, 337, 1158-1159.


*To whom correspondence should be addressed. Tel: +32 3 8202601; Fax: +32 3 8202541; Email: cvbroeck@uia.ac.be
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
AM J ALZHEIMERS DIS OTHER DEMENHome page
L. Dintchov Traykov, S. Mehrabian, M. Van den Broeck, M. Radoslavova Raycheva, M. Cruts, A. Kirilova Jordanova, and C. Van Broeckhoven
Novel PSEN1 Mutation in a Bulgarian Patient With Very Early-Onset Alzheimer's Disease, Spastic Paraparesis, and Extrapyramidal Signs
American Journal of Alzheimer's Disease and Other Dementias, October 1, 2009; 24(5): 404 - 407.
[Abstract] [PDF]


Home page
Cereb CortexHome page
C. Cruchaga, M. A. Fernandez-Seara, M. Seijo-Martinez, L. Samaranch, E. Lorenzo, A. Hinrichs, J. Irigoyen, C. Maestro, E. Prieto, J. M. Marti-Climent, et al.
Cortical Atrophy and Language Network Reorganization Associated with a Novel Progranulin Mutation
Cereb Cortex, August 1, 2009; 19(8): 1751 - 1760.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
P. Piscopo, G. Marcon, M. R. Piras, A. Crestini, L. M. Campeggi, E. Deiana, R. Cherchi, F. Tanda, A. Deplano, N. Vanacore, et al.
A novel PSEN2 mutation associated with a peculiar phenotype
Neurology, April 22, 2008; 70(17): 1549 - 1554.
[Abstract] [Full Text] [PDF]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
K. L Brickell, J. B Leverenz, E. J Steinbart, M. Rumbaugh, G. D Schellenberg, D. Nochlin, T. H Lampe, I. E Holm, V. V. Deerlin, W. Yuan, et al.
Clinicopathological concordance and discordance in three monozygotic twin pairs with familial Alzheimer's disease
J. Neurol. Neurosurg. Psychiatry, October 1, 2007; 78(10): 1050 - 1055.
[Abstract] [Full Text] [PDF]


Home page
AM J ALZHEIMERS DIS OTHER DEMENHome page
C. K. Chai
The Genetics of Alzheimer's Disease
American Journal of Alzheimer's Disease and Other Dementias, February 1, 2007; 22(1): 37 - 41.
[Abstract] [PDF]


Home page
BrainHome page
K. Sleegers, N. Brouwers, I. Gijselinck, J. Theuns, D. Goossens, J. Wauters, J. Del-Favero, M. Cruts, C. M. v. Duijn, and C. V. Broeckhoven
APP duplication is sufficient to cause early onset Alzheimer's dementia with cerebral amyloid angiopathy
Brain, November 1, 2006; 129(11): 2977 - 2983.
[Abstract] [Full Text] [PDF]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
M Preusser, T Strobel, E Gelpi, M Eiler, G Broessner, E Schmutzhard, and H Budka
Alzheimer-type neuropathology in a 28 year old patient with iatrogenic Creutzfeldt-Jakob disease after dural grafting.
J. Neurol. Neurosurg. Psychiatry, March 1, 2006; 77(3): 413 - 416.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
M. G. Marrosu, G. Floris, G. Costa, L. Schirru, G. Spinicci, M. V. Cherchi, M. Mura, M. G. Mascia, and E. Cocco
Dementia, pyramidal system involvement, and leukoencephalopathy with a presenilin 1 mutation
Neurology, January 10, 2006; 66(1): 108 - 111.
[Abstract] [Full Text] [PDF]


Home page
J Geriatr Psychiatry NeurolHome page
J. M. Ringman
What the Study of Persons At Risk for Familial Alzheimer's Disease Can Tell Us About the Earliest Stages of the Disorder: A Review
J Geriatr Psychiatry Neurol, December 1, 2005; 18(4): 228 - 233.
[Abstract] [PDF]


Home page
Arch NeurolHome page
B. J. Snider, J. Norton, M. A. Coats, S. Chakraverty, C. E. Hou, R. Jervis, C. L. Lendon, A. M. Goate, D. W. McKeel Jr, and J. C. Morris
Novel Presenilin 1 Mutation (S170F) Causing Alzheimer Disease With Lewy Bodies in the Third Decade of Life
Arch Neurol, December 1, 2005; 62(12): 1821 - 1830.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
J. S. Goldman, J. K. Johnson, K. McElligott, O. Suchowersky, B. L. Miller, and V. M. Van Deerlin
Presenilin 1 Glu318Gly Polymorphism: Interpret With Caution
Arch Neurol, October 1, 2005; 62(10): 1624 - 1627.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
P. H. Wen, R. De Gasperi, M. A. G. Sosa, A. B. Rocher, V. L. Friedrich Jr, P. R. Hof, and G. A. Elder
Selective expression of presenilin 1 in neural progenitor cells rescues the cerebral hemorrhages and cortical lamination defects in presenilin 1-null mutant mice
Development, September 1, 2005; 132(17): 3873 - 3883.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
A. K. Godbolt, K. A. Josephs, T. Revesz, E. K. Warrington, P. Lantos, A. King, N. C. Fox, S. Al Sarraj, J. Holton, L. Cipolotti, et al.
Sporadic and Familial Dementia With Ubiquitin-Positive Tau-Negative Inclusions: Clinical Features of One Histopathological Abnormality Underlying Frontotemporal Lobar Degeneration
Arch Neurol, July 1, 2005; 62(7): 1097 - 1101.
[Abstract] [Full Text] [PDF]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
E A Croes, J Theuns, J J Houwing-Duistermaat, B Dermaut, K Sleegers, G Roks, M Van den Broeck, B van Harten, J C van Swieten, M Cruts, et al.
Octapeptide repeat insertions in the prion protein gene and early onset dementia
J. Neurol. Neurosurg. Psychiatry, August 1, 2004; 75(8): 1166 - 1170.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
A. Tedde, B. Nacmias, M. Ciantelli, P. Forleo, E. Cellini, S. Bagnoli, C. Piccini, P. Caffarra, E. Ghidoni, M. Paganini, et al.
Identification of New Presenilin Gene Mutations in Early-Onset Familial Alzheimer Disease
Arch Neurol, November 1, 2003; 60(11): 1541 - 1544.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
M. Ezquerra, A. Lleo, M. Castellvi, R. Queralt, P. Santacruz, P. Pastor, J. L. Molinuevo, R. Blesa, and R. Oliva
A Novel Mutation in the PSEN2 Gene (T430M) Associated With Variable Expression in a Family With Early-Onset Alzheimer Disease
Arch Neurol, August 1, 2003; 60(8): 1149 - 1151.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
J-C Lambert, E Luedecking-Zimmer, S Merrot, A Hayes, U Thaker, P Desai, A Houzet, X Hermant, D Cottel, A Pritchard, et al.
Association of 3'-UTR polymorphisms of the oxidised LDL receptor 1 (OLR1) gene with Alzheimer's disease
J. Med. Genet., June 1, 2003; 40(6): 424 - 430.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Theuns, J. Remacle, R. Killick, E. Corsmit, K.'l Vennekens, D. Huylebroeck, M. Cruts, and C. V. Broeckhoven
Alzheimer-associated C allele of the promoter polymorphism -22C>T causes a critical neuron-specific decrease of presenilin 1 expression
Hum. Mol. Genet., April 15, 2003; 12(8): 869 - 877.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
J.C. Janssen, J.A. Beck, T.A. Campbell, A. Dickinson, N.C. Fox, R.J. Harvey, H. Houlden, M.N. Rossor, and J. Collinge
Early onset familial Alzheimer's disease: Mutation frequency in 31 families
Neurology, January 28, 2003; 60(2): 235 - 239.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
A. Lleo, R. Blesa, R. Queralt, M. Ezquerra, J. L. Molinuevo, J. Pena-Casanova, A. Rojo, and R. Oliva
Frequency of Mutations in the Presenilin and Amyloid Precursor Protein Genes in Early-Onset Alzheimer Disease in Spain
Arch Neurol, November 1, 2002; 59(11): 1759 - 1763.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
N. R. Graff-Radford, R. C. Green, R. C. P. Go, M. L. Hutton, T. Edeki, D. Bachman, J. L. Adamson, P. Griffith, F. B. Willis, M. Williams, et al.
Association Between Apolipoprotein E Genotype and Alzheimer Disease in African American Subjects
Arch Neurol, April 1, 2002; 59(4): 594 - 600.
[Abstract] [Full Text] [PDF]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
R Queralt, M Ezquerra, A Lleo, M Castellvi, J Gelpi, I Ferrer, N Acarin, L Pasarin, R Blesa, and R Oliva
A novel mutation (V89L) in the presenilin 1 gene in a family with early onset Alzheimer's disease and marked behavioural disturbances
J. Neurol. Neurosurg. Psychiatry, February 1, 2002; 72(2): 266 - 269.
[Abstract] [Full Text] [PDF]


Home page
Br. J. PsychiatryHome page
C. HOLMES
Genotype and phenotype in Alzheimer's disease
The British Journal of Psychiatry, February 1, 2002; 180(2): 131 - 134.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
B. Dermaut, S. Kumar-Singh, C. De Jonghe, M. Cruts, A. Lofgren, U. Lubke, P. Cras, R. Dom, P. P. De Deyn, J. J. Martin, et al.
Cerebral amyloid angiopathy is a pathogenic lesion in Alzheimer's disease due to a novel presenilin 1 mutation
Brain, December 1, 2001; 124(12): 2383 - 2392.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
A. Lleo, R. Blesa, J. Gendre, M. Castellvi, P. Pastor, R. Queralt, and R. Oliva
A novel presenilin 2 gene mutation (D439A) in a patient with early-onset Alzheimer's disease
Neurology, November 27, 2001; 57(10): 1926 - 1928.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
E. S. Athan, J. Williamson, A. Ciappa, V. Santana, S. N. Romas, J. H. Lee, H. Rondon, R. A. Lantigua, M. Medrano, M. Torres, et al.
A Founder Mutation in Presenilin 1 Causing Early-Onset Alzheimer Disease in Unrelated Caribbean Hispanic Families
JAMA, November 14, 2001; 286(18): 2257 - 2263.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
K.A. Johnson, F. Lopera, K. Jones, A. Becker, R. Sperling, J. Hilson, J. Londono, I. Siegert, M. Arcos, S. Moreno, et al.
Presenilin-1-associated abnormalities in regional cerebral perfusion
Neurology, June 12, 2001; 56(11): 1545 - 1551.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
J.-C. Lambert, D. M A Mann, J. M Harris, M.-C. Chartier-Harlin, A. Cumming, J. Coates, H. Lemmon, D. StClair, T. Iwatsubo, and C. Lendon
The {-}48 C/T polymorphism in the presenilin 1 promoter is associated with an increased risk of developing Alzheimer's disease and an increased A{beta} load in brain
J. Med. Genet., June 1, 2001; 38(6): 353 - 355.
[Abstract] [Full Text]


Home page
BrainHome page
A. B. Singleton, R. Hall, C. G. Ballard, R. H. Perry, J. H. Xuereb, D. C. Rubinsztein, C. Tysoe, P. Matthews, B. Cordell, S. Kumar-Singh, et al.
Pathology of early-onset Alzheimer's disease cases bearing the Thr113-114ins presenilin-1 mutation
Brain, December 1, 2000; 123(12): 2467 - 2474.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
L. J. Whalley, J. M. Starr, R. Athawes, D. Hunter, A. Pattie, and I. J. Deary
Childhood mental ability and dementia
Neurology, November 28, 2000; 55(10): 1455 - 1459.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Kumar-Singh, C. De Jonghe, M. Cruts, R. Kleinert, R. Wang, M. Mercken, B. De Strooper, H. Vanderstichele, A. Lofgren, I. Vanderhoeven, et al.
Nonfibrillar diffuse amyloid deposition due to a {gamma}42-secretase site mutation points to an essential role for N-truncated A{beta}42 in Alzheimer's disease
Hum. Mol. Genet., November 1, 2000; 9(18): 2589 - 2598.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Theuns and C. Van Broeckhoven
Transcriptional regulation of Alzheimer's disease genes: implications for susceptibility
Hum. Mol. Genet., October 1, 2000; 9(16): 2383 - 2394.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Tanahashi and T. Tabira
Alzheimer's disease-associated presenilin 2 interacts with DRAL, an LIM-domain protein
Hum. Mol. Genet., September 1, 2000; 9(15): 2281 - 2289.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
M. Ezquerra, C. Carnero, R. Blesa, and R. Oliva
A Novel Presenilin 1 Mutation (Leu166Arg) Associated With Early-Onset Alzheimer Disease
Arch Neurol, April 1, 2000; 57(4): 485 - 488.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
A. Verkkoniemi, M. Somer, J. O. Rinne, L. Myllykangas, R. Crook, J. Hardy, M. Viitanen, H. Kalimo, and M. Haltia
Variant Alzheimer's disease with spastic paraparesis: Clinical characterization
Neurology, March 14, 2000; 54(5): 1103 - 1109.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
T. D. Bird
Sporadic Cases of Possible Genetic Diseases: To Test or Not to Test?
Arch Neurol, March 1, 2000; 57(3): 309 - 310.
[Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Theuns, J. Del-Favero, B. Dermaut, C. M. v. Duijn, H. Backhovens, M. V. d. Broeck, S. Serneels, E. Corsmit, C. V. Broeckhoven, and M. Cruts
Genetic variability in the regulatory region of presenilin 1 associated with risk for Alzheimer's disease and variable expression
Hum. Mol. Genet., February 12, 2000; 9(3): 325 - 331.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Leissring, I. Parker, and F. M. LaFerla
Presenilin-2 Mutations Modulate Amplitude and Kinetics of Inositol 1,4,5-Trisphosphate-mediated Calcium Signals
J. Biol. Chem., November 12, 1999; 274(46): 32535 - 32538.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
J. A. Johnston, C. L. Ward, and R. R. Kopito
Aggresomes: A Cellular Response to Misfolded Proteins
J. Cell Biol., December 28, 1998; 143(7): 1883 - 1898.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
M. G. Marrosu, G. Floris, G. Costa, L. Schirru, G. Spinicci, M. V. Cherchi, M. Mura, M. G. Mascia, and E. Cocco
Dementia, pyramidal system involvement, and leukoencephalopathy with a presenilin 1 mutation
Neurology, January 10, 2006; 66(1): 108 - 111.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (200)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cruts, M.
Right arrow Articles by Van Broeckhoven, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cruts, M.
Right arrow Articles by Van Broeckhoven, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?