Generalized glycogen storage and cardiomegaly in a knockout mouse model of Pompe disease
Generalized glycogen storage and cardiomegaly in a knockout mouse model of Pompe diseaseAgnes G.A. Bijvoet1,2, Esther H.M. van de Kamp2, Marian A. Kroos1, Jia-Huan Ding3,+, Bing Z. Yang3,+, Pim Visser4, Cathy E. Bakker1, Martin Ph. Verbeet5, Ben A. Oostra1, Arnold J.J. Reuser1,* and Ans T. van der Ploeg2
1Department of Clinical Genetics and 4Department of Cell Biology and Genetics, Erasmus University, P.O. Box 1738, 3000 DR Rotterdam, The Netherlands, 2Department of Paediatrics, Sophia Children's Hospital, P.O. Box 2060, 3000 CB Rotterdam, The Netherlands, 3Department of Pediatrics, Division of Genetics and Metabolism, Duke University Medical Centre, P.O. Box 14991, Durham, NC 27709, USA and 5Metalloprotein and Protein Engineering Group, Leiden Institute of Chemistry, Leiden University, P.O. Box 9502, 2300 RA Leiden, The Netherlands
Received August 1, 1997;Revised and Accepted October 2, 1997
Glycogen storage disease type II (GSDII; Pompe disease), caused by inherited deficiency of acid [alpha]-glucosidase, is a lysosomal disorder affecting heart and skeletal muscles. A mouse model of this disease was obtained by targeted disruption of the murine acid [alpha]-glucosidase gene (Gaa) in embryonic stem cells. Homozygous knockout mice (Gaa -/-) lack Gaa mRNA and have a virtually complete acid [alpha]-glucosidase deficiency. Glycogen-containing lysosomes are detected soon after birth in liver, heart and skeletal muscle cells. By 13 weeks of age, large focal deposits of glycogen have formed. Vacuolar spaces stain positive for acid phosphatase as a sign of lysosomal pathology. Both male and female knockout mice are fertile and can be intercrossed to produce progeny. The first born knockout mice are at present 9 months old. Overt clinical symptoms are still absent, but the heart is typically enlarged and the electrocardiogram is abnormal. The mouse model will help greatly to understand the pathogenic mechanism of GSDII and is a valuable instrument to explore the efficacy of different therapeutic interventions.
Heart disease and skeletal muscle disorders are life threatening and often incurable. They have become the subject of a gamut of therapeutic studies in which animal models play a crucial role, be it for the development of drug, transplantation, enzyme or gene therapy. Here, we report on the generation of a knockout mouse model of glycogen storage disease type II (GSDII; Pompe disease) with obvious involvement of heart and skeletal muscle.
GSDII is a fatal disorder with a characteristic progressive loss of skeletal and/or heart muscle function (1 ). Early and late onset subtypes are distinguished. The infantile or generalized form of the disease presents in the first few months of life with cardiomyopathy and hypotonia. There is moderate enlargement of the liver, without serious impairment of liver function. Patients die before the age of 2 years by cardiorespiratory failure (2 ,3 ). Milder forms of the disease are characterized by skeletal muscle weakness in the absence of cardiac symptoms and are easily misdiagnosed as muscular dystrophy or limb girdle dystrophy (4 ). Most patients become wheelchair bound and/or dependent on artificial ventilation. There is no effective therapy for any form of this disease.
GSDII is inherited in an autosomal recessive mode. At the very basis of this disease are mutations in the acid [alpha]-glucosidase gene (GAA) (5 ,6 ) that fully or in part prohibit the biosynthesis of acid [alpha]-glucosidase and thereby the degradation of lysosomal glycogen. The clinical phenotype is largely determined by the combination of mutant alleles and the resulting level of residual acid [alpha]-glucosidase activity (7 ,8 ). Infantile patients show virtually no activity, whereas older and more mildly affected patients have enzyme activity levels up to 25% of the control value (8 ).
The extent of lysosomal glycogen storage is concordantly different. Infantile patients have massive storage in many tissues including heart, skeletal muscle, smooth muscle, liver, kidney and the peripheral and central nervous system (1 ,3 ,9 -12 ). In late onset GSDII, there is minimal to no storage of glycogen in tissues other than skeletal muscle (13 ).
Despite the fact that this disease has been known for many years, questions concerning its pathogenesis have remained. This was one reason for us to invest in the generation of a laboratory mouse model. A second reason was the need to have a versatile animal model for testing the efficacy of innovative therapeutic developments such as enzyme and gene therapy.
The rationale for making a mouse model of GSDII via targeted disruption of the acid [alpha]-glucosidase (Gaa) gene is the 84% identity of the murine and human acid [alpha]-glucosidase amino acid sequences (14 ) indicating conservation of enzyme function. For this purpose, a 6.8 kb Asp718 fragment containing exon 5-14 of the murine Gaa gene was isolated from a 129 genomic library. To disrupt the murine Gaa gene, a neo cassette was inserted in the unique EagI site in exon 13 of the genomic fragment. The tk cassette for counter selection was positioned at the 5' end. Both cassettes are orientated in the same direction as the Gaa gene (Fig. 1 A). The construct was introduced into the E14 embryonic stem (ES) cell line by electroporation, and 137 clones were picked after positive and negative selection. Twenty-two clones were positive for homologous recombination according to PCR analysis as described in Materials and Methods (targeting frequency of 16%). Seven of these were tested further by Southern blotting, after NcoI digestion. The blot was hybridized with the neo sequence as probe resulting in a 2.6 kb fragment indicative of homologous recombination (data not shown). The clones were karyotyped. Three clones were euploid and had correct homologous recombination. Two of these (15.1D and 17.5D) were injected into blastocysts. Six chimeric mice were identified by coat colour, five males and one female. The males were mated with C57BL/6 and FVB females. Four males appeared to be germline transmitters. The heterozygous offspring were intercrossed, and their offspring were tested by PCR analysis with primers m8-m9 and nested PCR to discriminate between homozygous knockout (-/-), heterozygous knockout (+/-) and wild-type (+/+) offspring (Fig. 1 B). Genotyping of 274 offspring from heterozygous crosses revealed a frequency of 22.6% for homozygous knockout mice compatible with the expected Mendelian frequency (25%). The [alpha]-glucosidase knockout mice, both females and males, are fertile and produce normal litter sizes. No differences were observed between mice derived from the two different clones or the different inbred strains.A
No correct Gaa mRNA is produced by cultured cells of homozygous knockout mice as illustrated by reverse transcription-PCR analysis using primer set m8-m4 (Fig. 1 C). Instead, there is an abnormal messenger in which acid [alpha]-glucosidase sequences are linked to sequences of the neo cassette (Fig. 1 C; primer set n2-m4). RT-PCR with primers RT2 in exon 4 and n1 in the neo cassette revealed expression of a correctly spliced recombinant messenger (data not shown). For each RT reaction, the amplification of [alpha]-actin mRNA was performed as control. In accordance with the absence of a normal acid [alpha]-glucosidase transcript, the enzyme activity is virtually fully deficient in the cultured cells and in the organs of knockout mice, the exception is the intestine due to the sucrase-isomaltase activity in this tissue (Table 1 ). Cells and tissues of heterozygous mice have intermediate activity levels. The data in Table 1 are activities measured withthe artificial substrate 4-methylumbelliferyl-[alpha]-d-glucopyranoside (4MU) at a suboptimal pH of 3.6 (instead of 4.3) to reduce the interference of neutral [alpha]-glucosidase isozymes. The deficiency of acid [alpha]-glucosidase in organs of homozygous knockout mice was confirmed by Western blotting. Figure 1 D shows expression of a 65 kDa acid [alpha]-glucosidase (arrow) in all tissues of wild-type mice and an additional 70 kDa form in skeletal muscle, brain and intestine. No trace of acid [alpha]-glucosidase is detectable in tissues of homozygous knockout mice, while the method is sensitive enough to detect 3% of wild-type activity. The cultured cells are also devoid of acid [alpha]-glucosidase, as demonstrated by immunofluorescence microscopy (Fig. 2 A and B).
Clinical signs. At birth, the homozygous knockout mice were indistinguishable from their normal littermates in terms of physical appearance. Up until the present time (9 months after birth), this situation has not changed. The mice still lack overt clinical symptoms, but there is evidence of a developing cardiomyopathy. Several knockout mice had an abnormal electrocardiogram at 32 weeks of age with a high voltage QRS complex, as seen in human infantile GSDII (not shown). Radioscopy revealed cardiac enlargement which was confirmed at autopsy (Fig. 3 ). The heart of a knockout mouse (right) is round, swollen and pale compared with the smaller, oval and darker stained heart of an unaffected littermate (left). A dilatation of both ventricles was observed in cross-section. The pale colour of the heart was described earlier for Corriedale sheep with GSDII (15 ). The condition is called round heart disease in affected Nicholas turkeys (16 ).
Animal models of human diseases have proven their value for obtaining insight into pathogenic mechanisms and for testing therapeutic drugs and innovative treatment protocols. It was for use in these two applications that we set out to generate a mouse model of GSDII by targeted disruption of the acid [alpha]-glucosidase gene. The naturally occurring animal models of GSDII are less suitable for this purpose because of the physical dimension of the animal, the long generation time and the small littersize (cattle) (17 -19 ) or the evolutionary distance from humans (quail) (20 ). Strains of sheep (15 ), dogs (21 ,22 ), cats (23 ) and turkeys (16 ) with the disease have to our knowledge not been established.
Evidence that the knockout mouse described in this study stands as a model for human GSDII is based on the following findings. Analysis of genomic DNA demonstrates the presence of the disrupted Gaa gene and the absence of the normal gene. The normal messenger is not present either. Instead, there is a messenger in which neo sequences are linked to acid [alpha]-glucosidase sequences. Furthermore, tissues and cultured cells of homozygous knockout mice are fully deficient in acid [alpha]-glucosidase as judged by immunoblotting or immunocytochemistry. Acid [alpha]-glucosidase activity is profoundly deficient in all organs except intestine. The residual activity in the latter organ is explained by the presence of the intestinal enzymes sucrase and isomaltase, which share structural homology with acid [alpha]-glucosidase. They act on the same artificial substrate with maximal activity at neutral pH, but exhibit residual activity at pH 3.6 (24 ). Heterozygous knockout mice have 50% of the normal acid [alpha]-glucosidase activity, as expected for an autosomal recessive trait. The best evidence that this knockout mouse represents a model of human GSDII is the progressive lysosomal glycogen storage and the ensuing cellular pathology.
There are several arguments to classify this mouse model as representative for the early-onset infantile form of GSDII. mRNA synthesis is not detectable, the acid [alpha]-glucosidase deficiency is virtually complete and the heart muscle is evidently involved. The tissue pathology of the mice also points to infantile GSDII. Knockout mice have, from birth onwards, a generalized and progressive lysosomal storage of glycogen. At 13 weeks of age, many muscle fibres show structural abnormalities. Large PAS-positive vacuoles have formed between the contractile elements. These vacuoles are in essence expanded lysosomes as evidenced by the fact that they are acid phosphatase positive. Moreover, there is accumulation of glycogen in motor neurons and Schwann cells, as only observed in tissue specimens of patients with infantile GSDII (11 -13 ). However, in contrast to most babies born with infantile GSDII, the knockout mice do not develop overt clinical symptoms before adulthood.
The knockout mouse model resembles in biochemical, pathological and clinical aspects the naturally occurring animal models of GSDII. Afflicted Brahman and Shorthorn cattle (17 -19 ), Corriedale sheep (15 ), Lapland dog (21 ,22 ,25 ), Japanese quail (20 ,26 ,27 ) and Nicholas turkey (16 ) have both skeletal muscle and heart muscle involvement, like the knockout mice. Also, lysosomal glycogen storage in neurons and Schwann cells was described for all species, except turkey (28 ). Biochemical data are only available for cattle, dog and quail. Afflicted cattle and dogs have a complete acid [alpha]-glucosidase deficiency like the knockout mouse model (29 ,30 ). For quail, it is unclear to what extent lysosomal acid [alpha]-glucosidase activity contributes to the total measured [alpha]-glucosidase activity (31 -33 ).
Clinical parameters are more difficult to compare due to the great diversity of the species, but it is interesting to compare the clinical course of the disease in relation to the duration of the gestation period, the time to maturity and the normal life span of the species (Table 2 ). There is evidently no correlation between the length of the clinical course and the time to maturity or the life span. However, there is a striking similarity between all species including humans, with regard to the length of the pathologic process, which in Table 2 is defined as the arithmetic sum of the duration of the gestation period and the life expectancy of the affected individual. Perhaps this is not completely unexpected if one considers that the pathological process starts for inherited lysosomal storage disease in principle at the (one cell) embryonic stage. If the absolute rather than the relative age of the species is counted when comparing clinical phenotypes, it can be concluded that all animal models resemble the human infantile form of GSDII. This principle may hold in a similar way for animal models of other lysosomal storage diseases, with a comparatively late onset of symptoms (34 -36 ). For our Gaa knockout mouse model, it implies that clinical symptoms are likely to emerge at around 1 year of age.
Meanwhile, the mouse model can be used for the development of therapeutic regimens. Approaches to consider are diet, drugs, transplantation, enzyme and gene therapy. The combination of easy to measure glycogen concentration and acid [alpha]-glucosidase activity gives the GSDII mouse model a wider applicability. It can serve to test the effectiveness of various gene targeting vectors for diseases of heart and skeletal muscle in general.
The mouse Gaa cDNA (GenBank accession No. U449351) was isolated from a mouse liver cDNA library using human acid [alpha]-glucosidase cDNA as probe. With the murine cDNA as probe, 11 kb of the mouse Gaa gene consisting of exons 3-16 was isolated subsequently from a mouse 129 genomic library. A 6.8 kb Asp718 genomic fragment, including exons 5-14, was then cloned into the KpnI site of pBluescript with an adapted polylinker, containing ClaI, SalI, KpnI, ClaI, SacI restriction sites. A neo expression cassette with a length of 1.6 kb was isolated from pPGKneopA (37 ) by digestion with EcoRI and XhoI, blunt ends were generated and the fragment was inserted in the blunted unique EagI site in exon 13 of the Gaa gene. The HSV-tk expression cassette, isolated from pHA140 (38 ) by digestion with SalI, was introduced in the SalI site 5' of the construct. Both cassettes were inserted in the sense orientation with respect to the transcriptional orientation of the Gaa gene. The structure of the targeting vector is shown in Figure 1 A.
After ClaI digestion, the targeting construct (15-20 µg) was separated from the vector by agarose gel electrophoresis and isolated via electroelution. It was introduced into E14 ES cells by electroporation, essentially as described by Bakker et al. (39 ). Briefly, transfected cells were cultured in conditioned medium, and double selection with G418 (200 µg/ml) and FIAU (2 µM) was started 24 h after electroporation. Clones were picked 10-14 days after electroporation and screened for homologous recombination by nested PCR amplification. Two primer sets were used to amplify a 1.6 kb fragment that includes the 3' recombination junction. The first PCR (35 cycles, each consisting of 45 s at 94°C, 1 min at 59°C and 2.5 min at 68°C) was performed with primers n4 (sense, GACGAGTTCTTCTGAGGGGATCA), complementary to a sequence in the neo cassette, and m3 (antisense, GCCTTCCTCATGGCCTGCTG), complementary to a sequence in exon 15 immediately downstream of the Asp718 restriction site. In the nested PCR (25 cycles, with the same temperature program) primers n2 (sense, GTGGGCTCTATGGCTTCTGAGG) and m2 (antisense, GCTGAACCTGTACGGCTCCTG) were used (Fig. 1 A). Correctly recombined clones were karyotyped according to standard procedures and tested by Southern blotting. Genomic DNA was digested with NcoI and a neo fragment was used as probe.
Two positive clones were injected into C57BL/6 blastocysts. Chimeric mice were bred to C57BL/6 and FVB females, and the offspring with agouti and grey coats were tested for the transmission of the disrupted allele by the PCR described above. Homozygous mice (-/-) were obtained by interbreeding the heterozygotes (+/-). DNA from the tail was analysed using a PCR (35 cycles, following the same temperature program as described above) with primer m8 (sense, CCTCACTGAAGCTATCGCCTCC) in exon 12 and m9 (antisense, GCAAGATGCTCCCAAGAGCTCC) in exon 13 in combination with the nested PCR described above.
Tails were cut into small pieces, and the tissue was dissociated for 15 min at 37°C in 10 mM sodium phosphate, 150 mM NaCl (pH 7.1), containing 0.05% trypsin and 0.02% EDTA. After low speed centrifugation, a fresh solution of trypsin/EDTA was added for another 15 min. Cells and softened tissue were then resuspended in Dulbecco's modified Eagle's medium (DMEM) with 15% fetal calf serum (FCS) and antibiotics and seeded in 25 cm2 tissue culture flask, pre-coated with FCS and 1 ml of medium. Clonal outgrowth of cells was observed 3 weeks later, and stable cell lines were obtained after 2 months of growth.
RNA was isolated from cultured cells with RNAzol· according to the manufacturer's directions (Tel-Test). cDNA synthesis was carried out using the SuperscriptT pre-amplification system and random hexamer-primers (Gibco BRL). The cDNA was PCR-amplified with several primer combinations: m8 with m4 (antisense, TGGGTCCAGCGCACACACAGCT in exon 14) amplifying a fragment including the neo cassette in the knockout allele, n2 in the neo cassette in combination with m4 amplifying the 3' junction of the neo cassette and the Gaa gene, RT2 (GAACCAGTTCCTTCAGCTGT sense in exon 4) in combination with n1 (GTGTAGCGCCAAGTGCCAGCG antisense, in the neo cassette). Primers AGGTCATCACCATCGGCAATG (sense) and CGTCGTACTCCTGCTTGGTG (antisense) were used for amplifying [alpha]-actin, a non-relevant control gene.
Mouse tissues were homogenized in phosphate-buffered saline using an ultra turrax (TP 18-10, 20 000 Upm; 170 W, Janke & Kunkel KG). After removal of the large debris at 10 000 g twice for 15 min, the supernatant was stored at -20°C. The supernatants were assayed for [alpha]-glucosidase activity with 4MU as substrate (40 ). The protein content of the supernatant was determined using the bicinchoninic acid (BCA) protein assay (Pierce).
Acid [alpha]-glucosidase was immunoprecipitated from the homogenates with rabbit antibodies raised against human placental acid [alpha]-glucosidase complexed to protein A-Sepharose 4B as described (41 ). The Sepharose beads with the enzyme-immunoglobulin complex bound to them were boiled in sample buffer and applied to 10% SDS-PAGE. The proteins subsequently were blotted onto nitrocellulose filters and visualized on these filters with rabbit anti-human placental acid [alpha]-glucosidase antibodies using the ECL detection kit (Amersham).
Acid [alpha]-glucosidase in cultured cells was visualized with rabbit polyclonal antiserum raised against human placental acid [alpha]-glucosidase in combination with goat anti rabbit IgG conjugated to fluorescein isothiocyanate (FITC).
For routine histological examination, tissues were either frozen in 2-methylbutane chilled by liquid nitrogen or fixed in 2.5% glutaraldehyde in 0.15 M cacodylate buffer and embedded in glycolmethacrylate (GMA). Cryostat sections (6 µm) were stained with haematoxylin-eosin (HE), PAS and acid phosphatase. Alternatively, sections (2 µm) from GMA-embedded tissues were PAS stained. For electron microscopy, glutaraldehyde-fixed tissues specimens were post-fixed in 1% OsO4 with K3Fe(CN)6 in 0.1 M cacodylate buffer according to De Bruijn (42 ). Standard procedures were used for epon embedding. Semi-thin (1 µm) and ultrathin sections were cut on an LKB Nova ultratome and stained with methylene blue (semi-thin) and uranylactate in combination with Sato's lead citrate (43 ) (ultrathin). Ultrathin sections were examined in a Philips CM100 electron microscopy.
Mice were anaesthetized with ether and pulsed radioscopies were made (25/s) with a Siemens radiography apparatus. A surface electrocardiogram (standard Einthoven) was obtained by subcutaneous placement of 27-gauge needles in two front and one hind limb. A 300 Hz filter was used. Data were recorded, digitized on-line using a data acquisition program (WinDaq/ex; Dataq Instrument, Inc., USA) and stored for post-acquisition off-line analysis. The mice were killed with an overdose of hypnodil (Janssen Pharmaceutica B.V.) for ex vivo comparison of gross cardiac morphology.
The authors wish to thank Professor Dr H. F. M. Busch and Dr Rob Willemsen for their help with judging pathological tissue specimens, Rien van Haperen and Marjolein van Helmond for performing blastocyst injections, Dr Monique Hermans, Dik van Leenen and Onard Schoneveld for mRNA and DNA analysis, Rob van Bremen and René Stubenitsky for X-ray analysis and electrocardiography, Tom de Vries Lentsch and Ruud Koppenol for photography and Jeannette Lokker for secretarial assistance. Pharming B.V. and Bio Cell Technology are acknowledged for technology sharing. This study was supported by grants from the Prinses Beatrix Fonds and the Sophia Foundation for Medical Research.
1 Hirschhorn, R. (1995) In Scriver, C.R., Beaudet, A.L., Sly, W.S. and Valle, D. (eds), The Metabolic and Molecular Basis of Inherited Disease. McGraw-Hill, New York, Vol. 1, pp. 2443-2464.
3 Hers, H.G. and De Barsy, T. (1973) In Hers, H.G. and Van Hoof, F. (eds), Lysosomes and Storage Diseases. Academic Press, New York, pp. 197-216.
4 Engel, A.G. (1970) Acid maltase deficiency in adults: studies in four cases of a syndrome which may mimic muscular dystrophy or other myopathies. Brain, 93, 599-616.MEDLINE Abstract
5 Hoefsloot, L.H., Hoogeveen-Westerveld, M., Reuser, A.J.J. and Oostra, B.A. (1990) Characterization of the human lysosomal [alpha]-glucosidase gene. Biochem. J., 272, 493-497.MEDLINE Abstract
6 Martiniuk, F., Bodkin, M., Tzall, S. and Hirschhorn, R. (1991) Isolation and partial characterization of the structural gene for human acid [alpha]-glucosidase. DNA Cell Biol., 10, 283-292.MEDLINE Abstract
7 Raben, N., Nichols, R.C., Boerkoel, C. and Plotz, P. (1995) Genetic defects in patients with glycogenosis type II (acid maltase deficiency). Muscle Nerve, 3, S70-S74.MEDLINE Abstract
8 Reuser, A.J.J., Kroos, M.A., Hermans, M.M.P., Bijvoet, A.G.A., Verbeet, M.P., Van Diggelen, O.P., Kleijer, W.J. and Van der Ploeg, A.T. (1995) Glycogenosis type II (acid maltase deficiency). Muscle Nerve, 3, S61-S69.
9 Cardiff, R.D. (1966) A histochemical and electron microscopic study of skeletal muscle in a case of Pompe's disease (glycogenosis II). Pediatrics, 37, 249-259.MEDLINE Abstract
10 Hug, G. and Schubert, W.K. (1967) Glycogenosis type II. Glycogen distribution in tissues. Arch. Pathol., 84, 141-152.
11 Gambetti, P., DiMauro, S. and Baker, L. (1971) Nervous system in Pompe's disease. Ultrastructure and biochemistry. J. Neuropathol. Exp. Neurol., 30, 412-430.MEDLINE Abstract
12 Martin, J.J., De Barsy, T., Van Hoof, F. and Palladini, G. (1973) Pompe's disease: an inborn lysosomal disorder with storage of glycogen. A study of brain and striated muscle. Acta Neuropathol., 23, 229-244.MEDLINE Abstract
13 Engel, A.G., Gomez, M.R., Seybold, M.E. and Lambert, E.H. (1973) The spectrum and diagnosis of acid maltase deficiency. Neurology, 23, 95-106.MEDLINE Abstract
14 Ding, J.H., Yang, B.Z., Liu, H.M. and Reuser, A.J.J. (1994) Cloning the mouse homologue of the human lysosomal acid [alpha]-glucosidase gene. Am. J. Hum. Genet., 55, A325.
15 Manktelow, B.W. and Hartley, W.J. (1975) Generalized glycogen storage disease in sheep. J. Comp. Pathol., 85, 139-145.MEDLINE Abstract
16 Czarnecki, C.M. and Jankus, E.F. (1974) Observations on cardiac glycogen in spontaneous round heart disease. Avian Dis., 18, 614-618.MEDLINE Abstract
17 Jolly, R.D., Van-de-Water, N.S., Richards, R.B. and Dorling, P.R. (1977) Generalized glycogenosis in beef shorthorn cattle-heterozygote detection. Aust. J. Exp. Biol. Med. Sci., 55, 141-150.
20 Murakami, H., Takagi, A., Nanaka, S., Ishiura, S. and Sugita, H. (1980) Glycogenosis II in Japanese quails. Exp. Anim., 29, 475-485.
21 Mostafa, I.E. (1970) A case of glycogenic cardiomegaly in a dog. Acta Vet. Scand., 11, 197-208.MEDLINE Abstract
22 Walvoort, H.C., Slee, R.G. and Koster, J.F. (1982) Canine glycogen storage disease type II. A biochemical study of an acid [alpha]-glucosidase-deficient Lapland dog. Biochim. Biophys. Acta, 715, 63-69.MEDLINE Abstract
23 Sandstrom, B., Westman, J. and Ockerman, P.A. (1969) Glycogenosis of the central nervous system in the cat. Acta Neuropathol., 14, 194-200.MEDLINE Abstract
24 Hoefsloot, L.H., Hoogeveen-Westerveld, M., Kroos, M.A., Van Beeumen, J., Reuser, A.J.J. and Oostra, B.A. (1988) Primary structure and processing of lysosomal [alpha]-glucosidase; homology with the intestinal sucrase-isomaltase complex. EMBO J., 7, 1697-1704.MEDLINE Abstract
25 Walvoort, H.C., Dormans, J.A.M.A. and van den Ingh, T.S.G.A.M. (1985) Comparative pathology of the canine model of glycogen storage disease type II (Pompe's disease). J. Inherit. Metab. Dis., 8, 38-46.MEDLINE Abstract
26 Nunoya, T., Tajima, M. and Mizutani, M. (1983) A new mutant of Japanese quail (Coturnix coturnix japonica) characterized by generalized glycogenosis. Lab. Anim., 17, 138-142.MEDLINE Abstract
27 Matsui, T., Kuroda, S., Mizutani, M., Kiuchi, Y., Suzuki, K. and Ono, T. (1983) Generalized glycogen storage disease in Japanese quail (Coturnix coturnix japonica). Vet. Pathol., 20, 312-321.MEDLINE Abstract
28 Walvoort, H.C. (1983) Glycogen storage diseases in animals and their potential value as models of human disease. J. Inherit. Metab. Dis., 6, 3-16.MEDLINE Abstract
29 Wisselaar, H.A., Hermans, M.M.P., Visser, W.J., Kroos, M.A., Oostra, B.A., Aspden, W., Harrison, B., Hetzel, D.J.S., Reuser, A.J.J. and Drinkwater, R.D. (1993) Biochemical genetics of glycogenosis type II in Brahman cattle. Biochem. Biophys. Res. Commun., 190, 941-947.MEDLINE Abstract
30 Healy, P.J., Nicholls, P.J., Martiniuk, F., Tzall, S., Hirschhorn, R. and Howell, J.M. (1995) Evidence of molecular heterogeneity for generalized glycogenosis between and within breeds of cattle. Aust. Vet. J., 72, 309-311.MEDLINE Abstract
31 Usuki, F., Ishiura, S. and Sugita, H. (1986) Isolation and characterization of three alpha-glucosidases from the Japanese quail. J. Biochem., 99, 985-988.MEDLINE Abstract
32 Usuki, F., Ishiura, S., Higuchi, I. and Sugita, H. (1988) Reappearance of embryonic neutral [alpha]-glucosidase isoenzyme in acid maltase deficient muscle of Japanese quail. Exp. Neurol., 100, 394-402.MEDLINE Abstract
33 Suhara, Y., Ishiura, S., Tsukahara, T. and Sugita, H. (1989) Mature 98,000 dalton acid [alpha]-glucosidase is deficient in Japanese quails with acid maltase deficiency. Muscle Nerve, 12, 670-678.MEDLINE Abstract
34 Zhou, X.Y., Morreau, H., Rottier, R., Davis, D., Bonten, E., Gillemans, N., Wenger, D., Grosveld, F.G., Doherty, P., Suzuki, K., Grosveld, G.C. and d'Azzo, A. (1995) Mouse model for the lysosomal disorder galactosialidosis and correction of the phenotype with overexpressing erythroid precursor cells. Genes Dev., 9, 2623-2634.MEDLINE Abstract
35 Hess, B., Saftig, P., Hartmann, D., Coenen, R., Lullmann-Rauch, R., Goebel, H.H., Evers, M., von Figura, K., D'Hooge, R., Nagels, G., De Deyn, P., Peters, C. and Gieselmann, V. (1996) Phenotype of arylsulfatase A-deficient mice: relationship to human metachromatic leukodystrophy. Proc. Natl Acad. Sci. USA, 93, 14821-14826.MEDLINE Abstract
36 Hahn, C.N., del Pilar Martin, M., Schröder, M., Vanier, M.T., Hara, Y., Suzuki, K., Suzuki, K. and d'Azzo, A. (1997) Generalized CNS disease and massive GM1-ganglioside accumulation in mice defective in lysosomal acid [beta]-galactosidase. Hum. Mol. Genet., 6, 205-211.MEDLINE Abstract
37 Soriano, P., Montgomery, C., Geske, R. and Bradley, A. (1991) Targeted disruption of the c-src proto-oncogene leads to osteopetrosis in mice. Cell, 64, 693-702.MEDLINE Abstract
38 Clarke, A.R., Robanus Maandag, E., Van Roon, M., Van der Lugt, N.M.T., Van der Valk, M., Hooper, M.L., Berns, A. and Te Riele, H. (1992) Requirement for a functional Rb-1 gene in murine development. Nature, 359, 328-330.MEDLINE Abstract
39 Bakker, C.E., Verheij, C., Willemsen, R., Van der Helm, R., Oerlemans, F., Vermey, M., Bygrave, A., Hoogeveen, A.T., Oostra, B., Reyniers, E., De Boulle, K., D'Hooge, R., Cras, P., Van Vlezen, S., Nagels, G., Marin, J.J., De Deyn, P.P., Darby, J.K. and Willems, P.J. (1994) Fmr1 knockout mice: a model to study fragile X mental retardation. Cell, 78, 23-33.
40 De Jonge, A.J.R., De Smit, S., Kroos, M.A. and Reuser, A.J.J. (1985) Cotransfer of syntenic human genes into mouse cells using isolated metaphase chromosomes or cellular DNA. Hum. Genet., 69, 32-38.
41 Bijvoet, A.G.A., Kroos, M.A., Pieper, F.R., De Boer, H.A., Reuser, A.J.J., Van der Ploeg, A.T. and Verbeet, M.P. (1996) Expression of cDNA-encoded human acid [alpha]-glucosidase in milk of transgenic mice. Biochim. Biophys. Acta, 1308, 93-96.
42 De Bruijn, W.C. (1973) Glycogen, its chemistry and morphologic appearance in the electron microscope. I. A modified OsO4 fixative which selectively contrasts glycogen. J. Ultrastruct. Res., 42, 29-50.
43 Hanaichi, T., Sato, T., Iwamoto, T., Malavasi-Yamashiro, J., Hoshino, M. and Mizuno, N. (1986) A stable lead by modification of Sato's method. J. Electron Microsc., 35, 304-306.
*To whom correspondence should be addressed. Tel: +31 10 4087153; Fax: +31 10 4362536; Email: reuser@ikg.fgg.eur.nl +Present address: Kimberly H. Courtwright & Joseph W. Summers Institute of Metabolic Disease, Baylor University Medical Centre, 3812 Elm Street, Dallas, TX 75226, USA
R. H. Hubner, P. L. Leopold, M. Kiuru, B. P. De, A. Krause, and R. G. Crystal Dysfunctional Glycogen Storage in a Mouse Model of {alpha}1-Antitrypsin Deficiency
Am. J. Respir. Cell Mol. Biol.,
February 1, 2009;
40(2):
239 - 247.
[Abstract][Full Text][PDF]
G. Douillard-Guilloux, N. Raben, S. Takikita, L. Batista, C. Caillaud, and E. Richard Modulation of glycogen synthesis by RNA interference: towards a new therapeutic approach for glycogenosis type II
Hum. Mol. Genet.,
December 15, 2008;
17(24):
3876 - 3886.
[Abstract][Full Text][PDF]
R. J. Moreland, X. Jin, X. K. Zhang, R. W. Decker, K. L. Albee, K. L. Lee, R. D. Cauthron, K. Brewer, T. Edmunds, and W. M. Canfield Lysosomal Acid {alpha}-Glucosidase Consists of Four Different Peptides Processed from a Single Chain Precursor
J. Biol. Chem.,
February 25, 2005;
280(8):
6780 - 6791.
[Abstract][Full Text][PDF]
C. M. Lynch, J. Johnson, C. Vaccaro, and B. L. Thurberg High-resolution Light Microscopy (HRLM) and Digital Analysis of Pompe Disease Pathology
J. Histochem. Cytochem.,
January 1, 2005;
53(1):
63 - 73.
[Abstract][Full Text][PDF]
A. J. T. Schuldt, T. J. Hampton, V. Chu, C. A. Vogler, N. Galvin, M. D. Lessard, and J. E. Barker Electrocardiographic and other cardiac anomalies in {beta}-glucuronidase-null mice corrected by nonablative neonatal marrow transplantation
PNAS,
January 13, 2004;
101(2):
603 - 608.
[Abstract][Full Text][PDF]
M. T. Johnson, S. Mahmood, and M. S. Patel Intermediary Metabolism and Energetics during Murine Early Embryogenesis
J. Biol. Chem.,
August 22, 2003;
278(34):
31457 - 31460.
[Full Text][PDF]
M. Arad, I. P. Moskowitz, V. V. Patel, F. Ahmad, A. R. Perez-Atayde, D. B. Sawyer, M. Walter, G. H. Li, P. G. Burgon, C. T. Maguire, et al. Transgenic Mice Overexpressing Mutant PRKAG2 Define the Cause of Wolff-Parkinson-White Syndrome in Glycogen Storage Cardiomyopathy
Circulation,
June 10, 2003;
107(22):
2850 - 2856.
[Abstract][Full Text][PDF]
S. Cherqui, C. Sevin, G. Hamard, V. Kalatzis, M. Sich, M. O. Pequignot, K. Gogat, M. Abitbol, M. Broyer, M.-C. Gubler, et al. Intralysosomal Cystine Accumulation in Mice Lacking Cystinosin, the Protein Defective in Cystinosis
Mol. Cell. Biol.,
November 1, 2002;
22(21):
7622 - 7632.
[Abstract][Full Text][PDF]
K. Umapathysivam, J. J. Hopwood, and P. J. Meikle Determination of Acid {alpha}-Glucosidase Activity in Blood Spots as a Diagnostic Test for Pompe Disease
Clin. Chem.,
August 1, 2001;
47(8):
1378 - 1383.
[Abstract][Full Text][PDF]
J. H. J. KAMPHOVEN, R. STUBENITSKY, A. J. J. REUSER, A. T. VAN DER PLOEG, P. D. VERDOUW, and D. J. DUNCKER Cardiac remodeling and contractile function in acid {{alpha}}-glucosidase knockout mice
Physiol Genomics,
April 27, 2001;
5(4):
171 - 179.
[Abstract][Full Text][PDF]
K. Umapathysivam, A. M. Whittle, E. Ranieri, C. Bindloss, E. M. Ravenscroft, O. P. van Diggelen, J. J. Hopwood, and P. J. Meikle Determination of Acid {alpha}-Glucosidase Protein: Evaluation as a Screening Marker for Pompe Disease and Other Lysosomal Storage Disorders
Clin. Chem.,
September 1, 2000;
46(9):
1318 - 1325.
[Abstract][Full Text][PDF]
D. D. Belke, T. S. Larsen, G. D. Lopaschuk, and D. L. Severson Glucose and fatty acid metabolism in the isolated working mouse heart
Am J Physiol Regulatory Integrative Comp Physiol,
October 1, 1999;
277(4):
R1210 - R1217.
[Abstract][Full Text][PDF]
A. Amalfitano, A. J. McVie-Wylie, H. Hu, T. L. Dawson, N. Raben, P. Plotz, and Y. T. Chen Systemic correction of the muscle disorder glycogen storage disease type II after hepatic targeting of a modified adenovirus vector encoding human acid-alpha -glucosidase
PNAS,
August 3, 1999;
96(16):
8861 - 8866.
[Abstract][Full Text][PDF]
E. Ponce, D. P. Witte, R. Hirschhorn, M. L. Huie, and G. A. Grabowski Murine Acid {alpha}-Glucosidase : Cell-Specific mRNA Differential Expression during Developmentand Maturation
Am. J. Pathol.,
April 1, 1999;
154(4):
1089 - 1096.
[Abstract][Full Text][PDF]
N. Raben, K. Nagaraju, E. Lee, P. Kessler, B. Byrne, L. Lee, M. LaMarca, C. King, J. Ward, B. Sauer, et al. Targeted Disruption of the Acid alpha -Glucosidase Gene in Mice Causes an Illness with Critical Features of Both Infantile and Adult Human Glycogen Storage Disease Type II
J. Biol. Chem.,
July 24, 1998;
273(30):
19086 - 19092.
[Abstract][Full Text][PDF]
CiteULike 
Connotea 
Del.icio.us What's this?
