Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (156)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Strom, T. M.
Right arrow Articles by Meitinger, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Strom, T. M.
Right arrow Articles by Meitinger, T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 2021-2028  

Diabetes insipidus, diabetes mellitus, optic atrophy and deafness (DIDMOAD) caused by mutations in a novel gene (wolframin) coding for a predicted transmembrane protein
Introduction
Results
   Analysis of candidate genes
   wolframin mutations
   Characterization of wolframin
   Mouse homolog of wolframin
Discussion
Materials And Methods
   Patients
   Sequence analysis
   RT-PCR and RACE
   Northern blot analysis
   Mutation analysis
Acknowledgements
References

Diabetes insipidus, diabetes mellitus, optic atrophy and deafness (DIDMOAD) caused by mutations in a novel gene (wolframin) coding for a predicted transmembrane protein

Diabetes insipidus, diabetes mellitus, optic atrophy and deafness (DIDMOAD) caused by mutations in a novel gene (wolframin) coding for a predicted transmembrane protein

Tim M. Strom1, Konstanze Hörtnagel1, Sabine Hofmann1,3, Florian Gekeler1,5, Curt Scharfe1, Wolfgang Rabl4, Klaus D. Gerbitz2,3 and Thomas Meitinger1,*

1Abteilung Medizinische Genetik, Klinikum Innenstadt, Ludwig-Maximilians-Universität, Goethestraße 29, 80336 München, Germany, 2Institute für Klinische Chemie, 3Diabetesforschung and 4Kinderklinik, Akademisches Lehrkrankenhaus München-Schwabing, 80804 München, Germany and 5Neurologische Klinik, Klinikum Grosshadern, Ludwig-Maximilians-Universität, 81377 München, Germany

Received September 7, 1998; Revised and Accepted September 29, 1998

DDBJ/EMBL/GenBank accession nos Y18064, AJ011971

Wolfram syndrome is an autosomal recessive disorder characterized by juvenile diabetes mellitus, diabetes insipidus, optic atrophy and a number of neurological symptoms including deafness, ataxia and peripheral neuropathy. Mitochondrial DNA deletions have been described in a few patients and a locus has been mapped to 4p16 by linkage analysis. Susceptibility to psychiatric illness is reported to be high in affected individuals and increased in heterozygous carriers in Wolfram syndrome families. We screened four candidate genes in a refined critical linkage interval covered by an unfinished genomic sequence of 600 kb. One of these genes, subsequently named wolframin, codes for a predicted transmembrane protein which was expressed in various tissues, including brain and pancreas, and carried loss-of-function mutations in both alleles in Wolfram syndrome patients.

INTRODUCTION

The first description of Wolfram syndrome (MIM 222300) is attributed to the physician D.J. Wolfram (1), who reported four cases in 1938. The acronym DIDMOAD summarizes the most frequent findings: diabetes insipidus, diabetes mellitus, optic atrophy and deafness. The minimal criteria for diagnosis are diabetes mellitus and optic atrophy. Diabetes insipidus, sensorineuronal deafness, urinary tract atony, ataxia, peripheral neuropathy, mental retardation and psychiatric illness are additional symptoms seen in the majority of patients. Diabetes mellitus is usually the first symptom, with the age of onset in the second half of the first decade (range 1-26 years). The mean onset of optic atrophy is in the first half of the second decade (range 6 weeks to 30 years). The prevalence has been estimated to be 1/770 000 in the UK and 1/100 000 in the North American population (2,3). The syndrome is best described as a neurodegenerative disorder involving the central nervous system, peripheral nerves and neuroendocrine tissue. Affected siblings with unaffected parents, often consanguineous, suggests a recessive mode of inheritance (4,5). The similarity in phenotype between patients with Wolfram syndrome and those with certain types of respiratory chain diseases led to the investigation of mitochondrial DNA (mtDNA) mutations in Wolfram syndrome patients. Deletions in mtDNA and morphological mitochondrial abnormalities were reported in some sporadic and familial cases (6-8). However, the mitochondrial tRNALeu (3243) mutation (2) and deletions in the mitochondrial genome have been excluded in >20 patients (9-11).

Linkage analysis in families with autosomal recessive Wolfram syndrome has shown significant lod scores for a locus on chromosome 4p16 between D4S432 and D4S431 (12,13). In two families in whom linkage has been demonstrated to this locus, multiple mtDNA deletions were found in both homozygous and heterozygous family members, suggesting a nuclear disease gene which interacts deleteriously with the mitochondrial genome (6). Although the phenotype in Wolfram syndrome is highly variable, no distinct clinical subgroups have been described so far. Psychiatric manifestations are particularly diverse and an increased predisposition for psychiatric disorders has been proposed for heterozygous carriers (14).

Table 1. Clinical manifestations in patients with Wolfram syndrome
Family Patient Gender Agea
(years)		 Diabetes
mellitus		 Progressive
optic atrophy		 Abnormal
audiogram		 Diabetes
insipidus		 Renal tract
abnormalities		 Neurological
abnormalities		 Other complications Consanguinity
1 5519 f 22 6 y + + 6 y + Ataxia, nystagmus Retarded sexual maturation, depression -
13883 f 11 4 y - - - + - - -
2 13775 f 20 9 y 12 y 17 y 15 y - - - -
13776 m 17 10 y 14 y 13 y 15 y + - Retarded sexual maturation -
3 13766 f 26 13 y 7 y 13 y - - - - +
4 13070 f 22 4 y 9 y 19 y - + Abnormal EEG Psychiatric illness -
5 13885 f 35 8 y + + - + - Cataract -
6 13062 f 25 7 y 9 y 22 y 7 y 24 y Ataxia, nystagmus    
7 13076 m 26 11 y 17 y 17 y 17 y - - Retarded sexual maturation, mental retardation -
8 13073 f 35 6 y 5 y + - 15 y Ataxia Cataract, psychiatric illness, ragged red fibers  
9 13781 m 19 4 y 10 y 6 y 14 y 10 y Abnormal EEG Retarded sexual maturation +
10 13782 m 16 14 y 15 y 15 y - 15 y - - -
11 13783 f 12 11 y 6 y 6 y - - Ataxia -  
12 12131 m   + + +          
12132 m   + + +          
aAge at time of the study.

We used unfinished genomic sequences from a chromosome 4 sequencing project to identify candidate genes for mutation screening in patients with Wolfram syndrome. Segregation analysis in autosomal recessive families led to a refined critical interval of 600 kb which was shown to contain at least four genes. One of them, a novel gene coding for a predicted 100 kDa transmembrane protein, harbored mutations in eight patients with Wolfram syndrome.

RESULTS

Analysis of candidate genes

We investigated DNA samples from three familial and nine sporadic patients with a clinical diagnosis of Wolfram syndrome. Minimum ascertainment criteria were juvenile diabetes mellitus and progressive optic atrophy (Table 1). mtDNA mutations and deletions were excluded in all affected individuals. In seven index cases (families 1-7, Table 1), an extensive screen for mtDNA mutations has been reported, including single-stranded conformation polymorphism (SSCP) analysis of all mitochondrial ND and tRNA genes (11). In five further cases, a deletion screen by Southern blotting of mtDNA was performed. In addition, the three primary LHON mutations (3460, 11778 and 14484) and three MELAS mutations (3243, 3271 and 3251) were not detected on screening.

We performed segregation analysis with 4p markers in three families in which at least two siblings were affected. Assuming that the disease locus in these families was linked to the reported interval between D4S432 and D4S431, we screened for single recombination events in this region. Haplotype analysis in pedigree 02 with two affected and two unaffected siblings revealed a crossover event between D4S2354 and D4S431 in an affected individual (Fig. 1). This provisionally mapped the disease locus proximal to marker D4S2354 and led to a refined critical interval between this marker and D4S431.

The Stanford Human Genome Center constructed a BAC contig between D4S842 and D4S611, which included the markers D4S2354 and D4S431, and made unfinished sequences available electronically to all investigators (http://www-shgc.stanford.edu/Seq ). We analyzed the DNA sequences from six BACs falling into the interval between D4S2354 and D4S431 (Fig. 2). All six BAC clones harbored gaps which, given the total length of the clones, should constitute <5% of the complete genomic sequences. Assembly of the BAC sequences with the program FALCON allowed the construction of larger contigs. The contigs were ordered by the known position of genetic markers and overlapping cDNAs and ESTs. According to this assembly, the physical distance between the two flanking markers was ~600 kb.


Figure 1. Refined interval for the Wolfram syndrome locus. (a) The critical interval in 4p is marked with a bar. (b) Chromosome 4p16 haplotypes for family 02 exclude D4S412 and D4S2354 from the critical region assuming that the disease locus in this family was linked to the reported interval between D4S432 and D4S431. Mutation analysis in the wolframin gene confirmed that individuals 13779 and 13780 are heterozygous carriers.


Figure 2. Physical map of the Wolfram syndrome critical region. In the lower part, the position of DNA markers and BACs are drawn to scale as estimated by the unfinished sequence data (Stanford Human Genome Center). The positions of genes in this region are indicated by boxes. The upper part of the figure shows the genomic structure of the wolframin gene (WM1). The gene covers a region of ~33 kb. The genomic sequence contained a gap between exons 1 and 2 and between exons 7 and 8. Only the first half of exon 1 and 800 bp upstream of the cDNA were covered by genomic sequence. WM1, WM3 and WM4, candidate genes for mutations in Wolfram syndrome patients; DRP-1, dihydropyriminidase related protein-1; BRg, [gamma] isoform of the B regulatory subunit of protein phosphatase 2A.

Screening of EST and non-redundant DNA databases with BLAST, combined with the use of exon prediction programs, revealed at least four known or predicted genes in this region (Fig. 2): (i) the gene for dihydropyriminidase-related protein-1 (DRP-1, GenBank accession no. D78012); (ii) the human homolog of the rat mRNA for the [gamma] isoform of the B regulatory subunit of protein phosphatase 2A (BRg, GenBank accession no. D38261); (iii) WM3, a novel gene partially covered by ESTs detected in brain and retinal tissue and with an overall amino acid identity of 58% (similarity 74%) over 397 amino acids to the KIAA0555 protein (GenBank accession no. 3043634) of unknown function; (iv) WM1, also partially covered by ESTs, which showed no significant homology to published DNA or protein sequences. A potential fifth gene, WM4, was defined by gene prediction programs only. For this gene, at least 6 exons spread over a genomic region of 40 kb were predicted by at least two programs used. No significant homology could be retrieved in a database search with sequences encompassing WM4.

Primers were designed for a total of 36 exons belonging to the above genes, with the exception of WM4, and a mutation screen was performed by SSCP in all 12 Wolfram syndrome index patients. Aberrant migration patterns suggesting mutations in the DRP-1, BRg and WM3 genes were few and sequencing revealed intronic nucleotide substitutions, a silent mutation in exon 8 of BRg and an arginine/histidine and a proline/threonine polymorphism in exon 6 of DRP-1. In contrast, screening of WM1 resulted in a significant number of gel shifts, some of which turned out to be due to homozygous deletions in Wolfram syndrome patients. WM1 was therefore named wolframin and characterized further.

Overlapping RT-PCR and 5[prime]-RACE was performed with adult brain tissue as template to establish the cDNA sequence of WM1. The cDNA consists of 3628 bp encompassing seven small exons and a large last exon of 2609 bp. Exons 3-5, 7 and 8 were predicted by GENSCAN (15), GRAIL (16) and GENEFINDER, exon 6 by GENSCAN and GRAIL and exon 2 by GENSCAN only. Sequence analysis of the cDNA predicted an ORF of 2670 bp. The sequences around the putative ATG translation start site (cgggccggcaggatgg) contained the -3 purine and +4 guanine residues of the Kozak consensus sequence. No in-frame stop codon was present upstream of the predicted start site. A possible promotor was predicted (TSSW program) at the beginning of the composite cDNA with a TATA box 34 bp upstream of the putative transcription start site. The 3[prime]-UTR consisted of 797 bp with a polyadenylation signal (AATAAA) 771 bp downstream of the stop codon.

wolframin mutations

To assess the possible role of this candidate gene in Wolfram syndrome, exons 2-7 were amplified from affected individuals with primer pairs based on exon-intron boundaries (Table 2) and screened for mutations using SSCP. Exon 8 was divided into eight overlapping parts of ~300 bp for SSCP screening. Sequencing of exons with aberrant migration patterns (Fig. 3) revealed mutations in the three familial cases and in five of the nine sporadic cases (Table 3). The mutations included stop, frameshift and amino acid deletions and insertions, suggesting wolframin loss-of-function mutations as the cause of Wolfram syndrome.

Table 2. (a) Intron-exon organization of wolframin
Exon Exon length (bp) Donor splice site Intron length (bp) Acceptor splice site
1 157   >6700 ttgacttttcttccaggcag/GATGGACTCC
2 233 GACGGCACCG/gtaagggagcaggctgggaa 9405 ttgtttcttctgtgttaaag/GGCCTACAAA
3 83 ACAGACTGAG/gtgaggactgcggtgccggc 1811 gactggtgtctggcttgcag/GTGGGGAAGC
4 145 GACAGAAGAG/gtgggtctgtgtgaggctta 2065 gaccacatcctatccctcag/GCATCACGTC
5 171 AACGAGCACG/gtgcgaggattcaccctggg 549 atccaccctgtcccctgcag/ATGGAGGGGC
6 81 GGCAGCGAGT/gtgagtgcagcccctgcccc 3043 tgttttctctcatgcttcag/CCAAGAACTA
7 149 GCGTCTGAAG/gtgagtgaccaagaccccgg >6000 acgtaccatctttcccccag/GTGGTCAAGT
8 2609 GGAACCTGCA    
The exonic and intronic sequences are indicated in upper case and lower case letters, respectively.

Table 2. (b) Primers for PCR amplification and sequencing of wolframin exons
Exon Sense primer Antisense primer PCR product size (bp)
2 CTGGATGTGCCTGACCTTG CCTGAACATCCCCAGCCTG 311
3 GAAGACCCTCATGCCTTGTC ATCTCAGGCACCGACACTTC 272
4 CGGAGAATCTGGAGGCTGAC CAACCCTCCAGAGGCTGTTC 234
5 ACAAGGCCTTTGACCACATC GTGCCCAGGGTGAATCCTC 225
6 CTGTTAATCCACCCTGTCCC GAGTCGCACAGGAAGGAGAG 186
7 CCTCCACCTGAACCCACTCA ACCGGGGTCTTGGTCACTC 301
8-1 TTCCCACGTACCATCTTTCC CACATCCAGGTTGGGCTC 334
8-2 AGAACTTCCGCACCCTCAC TCAGGTAGGGCCAATTCAAG 330
8-3 CTATCGCTGCTGCCCTCC GGGCAAAGAGGAAGAGGAAG 307
8-4 GTGAGCTCTCCGTGGTCATC CCCTCTGAGCGGTACACATAG 346
8-5 ATCCTGGTGTGGCTCACG GTAGAGGCAGCGCATCCAG 300
8-6 GCGTGACTGACATCGACAAC GCTGAACTCGATGAGGCTG 356
8-7 CAGCAGCGAGTTCAAGAGC CCTCATGGCAACATGCAC 300

Table 3. Mutations in nine families with Wolfram syndrome
Family Patient Mutationa Type Exon
1 5519 1380del9b 9 bp deletion 8
2 13775 460+1G->Ab 5[prime] splice signal 4
4 13070 599delTb Frameshift 5
5 13885 Q366X, 1096C->T Stop 8
6 13062 Q226X, 676C->T Stop 6
    Q819X, 2455C->T Stop 8
7 13076 599delT Frameshift 5
    Y669C Missense 8
8 13073 Q366X, 1096C->T Stop 8
    Q520X, 1558C->T Stop 8
9 13781 1523delATb Frameshift 8
12 12131 2164ins24b 24 bp insertion 8
aNucleotide positions are given counting from the first base of the start codon.
bHomozygous mutations.

Sequencing of aberrant bands also revealed several intronic and eight exonic polymorphisms. Six of the exonic polymorphisms are silent substitutions (PM684 C/G, PM1185 C/T, PM1500 C/T, PM2433 A/G, PM2469 C/T and PM2565 A/G). Two exonic polymorphisms are characterized by either valine or isoleucine at amino acid position 333 (PM997 A/G) and by either histidine or arginine at amino acid position 611 (PM1832 A/G).


Figure 3. Northern blot analysis of wolframin. A multiple tissue blot (Clontech) was hybridized with probe wm1E7-2-5 (exposure 4 h) and rehybridized with [beta]-actin cDNA as control (exposure 30 min). An ~3.6 kb transcript was observed under stringent washing conditions in heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas.


Figure 4. Mutation analysis in family 02. (a) Co-segregation of Wolfram syndrome with SSCP band shifts. Affected and unaffected individuals are presented by standard symbols. (b) Identification of a homozygous G->A transition at nucleotide position 460+1 at the donor splice site of intron 4.


Characterization of wolframin

The 890 amino acid wolframin protein corresponded to a predicted molecular weight of 100 kDa. BLAST and FASTA searches showed no significant homology to published DNA or protein sequences. Protein structure prediction programs (17,18) identified a hydrophobic central domain (amino acids 330-650) comprising nine helical transmembrane segments. Both programs preferentially predicted the N-terminal hydrophilic part to lie extracytoplasmically and the C-terminal part to lie intracytoplasmically. PSORT (19) computed a probability of 65% for a localization in the plasma membrane, 26% for endoplasmatic reticulum and 4% for a mitochondrial or nuclear localization. These features suggested wolframin encodes a transmembrane protein.

Hybridization of a PCR-derived exon 8 fragment (wm1E7-2-5) against a Southern blot containing EcoRI- and PstI-digested genomic DNA revealed a single band per digest and no cross-hybridization signals. The bands corresponded to the expected EcoRI fragment of 16.4 kb and the expected PstI fragment of 4.4 kb. Probe wm1E7-2-5 was also used to hybridize a Zoo blot and specific signals were observed in mammals (data not shown). No cross-hybridization was observed with genomic DNA from Drosophila and yeast. Hybridization of the probe to a multi-tissue northern blot revealed a signal of ~3.6 kb in all tissues (Fig. 4). The signal was strong in heart, intermediate in brain, placenta, lung and pancreas and weak in liver, skeletal muscle and kidney. The 3.6 kb band corresponded to the length of the assembled wolframin cDNA.

Mouse homolog of wolframin

Primers derived from mouse EST sequences were used to amplify the mouse homolog of wolframin by RT-PCR. 5[prime]-Sequences corresponding to human exons 3 and 4 and 3[prime]-sequences corresponding to exon 8 were covered by the mouse IMAGE clones 526533 and 1152973, respectively. IMAGE clone 526533 was presumably mis-spliced and, in addition to exons 3 and 4, contained sequences corresponding to the 3[prime]-UTR of wolframin. A sequence was amplified which corresponds to the human cDNA sequence starting at nucleotide position 316. 5[prime]-RACE was used to amplify an additional 206 bp resulting in a composite sequence which covers the entire ORF of mouse wolframin. Human and murine sequences are highly homologous, with 83% identity at the nucleotide level and 87% at the amino acid level (Fig. 5).


Figure 5. Alignment of the human wolframin protein sequence and its mouse homolog. Predicted transmembrane regions (17) are indicated by bars under the sequence. The numbers above the sequence correspond to the family numbers in Table 3 and indicate the positions of the mutations.

DISCUSSION

We have identified a gene mutated in patients with Wolfram syndrome by a positional cloning approach. Loss-of-function mutations on both alleles were demonstrated in five out of 12 families studied and we conclude that lack of the putative gene product (wolframin) is causative for the disease. The mutation status of a heterozygous missense mutation (Y669C), and of two homozygous in-frame mutations (1380del9 and 2164ins24) remains unclear pending functional studies. These sequence alterations were not found in 200 control chromosomes.

In one of the families (family 05) only a heterozygous stop mutation was found. No mutations in either of the two alleles were detected in three families (families 03, 10 and 11). One of these (family 03) was reported to be consanguineous. Mutations in exon 1, which was not included in the mutation screen, intronic mutations including deletions or mutations in the regulatory flanking regions of the gene could be pathogenic in these families. Non-allelic heterogeneity provides an alternative explanation (12).

Wolfram syndrome is a rare autosomal recessive disorder and, accordingly, a high proportion of homozygous mutations (five out of eight) were observed, although consanguinity was recorded in only one of the five families. The mutations were distributed along the entire gene and there was no evidence for a founder mutation in the seven families. No obvious genotype-phenotype relationship emerged. For example, diabetes insipidus was absent in the index patient of family 04 with a proximal frameshift mutation, but present in the index patient of family 06 with the most distal stop mutation.

This cloning project was greatly aided by the unfinished genomic sequences made available from the Stanford Human Genome Center. With no chromosomal aberration present in our panel of patient samples, gene identification relied on exon prediction and the identification of ESTs in the critical linkage interval. For refining this interval, we relied on a recombination event in a family with only two affected members. Mutation analysis in this family (family 02) has shown that there was indeed a homozygous splice site mutation present in the wolframin gene. The five genes predicted by EST clusters and exon prediction programs occupy ~225 kb of the 600 kb refined interval. ESTs derived from the gene coding for DRP-1 (GenBank accession no. D78012) and WM3 (SHGC-25149) had already been localized to this region. The gene encoding BRg (GenBank accession no. D38261) is located tail-to-tail only 17 kb proximal of wolframin. It has been shown to be highly expressed in brain and in spinal cord (20). The 5[prime]-end of wolframin was not fully represented on genomic sequences. It is known from large-scale sequencing projects that promoter regions are under-represented due to GC-rich regions at upstream regulatory sequences. According to the human/mouse synteny map, the highly homologous mouse wolframin gene should be located on mouse chromosome 5. Flanking markers include the mouse genes Msx1 and Drd5. No mouse mutants with degenerative disease map to this region.

mtDNA deletions have been excluded in peripheral leukocytes of the 12 index patients investigated in the present study. In particular, no mtDNA mutation was found in skeletal muscle from a patient with a homozygous wolframin mutation (family 08). This argues against a mechanism in which wolframin mutations trigger a pathogenic mechanism involving both the nuclear and the mitochondrial genome. Nonetheless, the clinical signs of the disease favor a disease mechanism which involves a mitochondrial protein. This reasoning gains support from the finding of mitochondrial pathology in one of the patients (family 08), in whom we found two compound heterozygous wolframin mutations. Wolframin is expressed in all tissues tested. Notably, the band observed in the skeletal muscle lane was of low intensity compared with the high intensity band seen in heart muscle. It is known that expression levels of genes coding for mitochondrial proteins do not solely reflect the number of mitochondria in a cell or tissue. Secondary structure prediction revealed the signature of a typical membrane protein: a central hydrophobic domain flanked by two hydrophilic domains. The number of helical domains crossing the membrane is predicted to be nine, positioning the N- and C-termini of wolframin on different sides of the membrane. The low score given for a mitochondrial sublocalization is explained by the absence of a typical import signal. With no significant homologies found in the databases, this defines a novel membrane protein, which may eventually provide a new means for studying neurodegenerative processes. Determination of its subcellular localization will reveal the first clues to its functional role.

The pleiotropic effects caused by wolframin mutations include a spectrum of psychiatric disorders. In three patients with mutations described in this study, psychiatric illness has been recorded. A locus for a dominant bipolar disorder has been mapped to 4p (21). These linkage studies were repeated in other patient samples with bipolar disorder (22). The interval defined by these studies includes markers which flank the wolframin gene. Combined with the observation that heterozygous carriers in recessive Wolfram syndrome families are predisposed to psychiatric illness, haploinsufficiency of wolframin could predispose to psychiatric illness (14). The gene structure presented here provides the tools to test this hypothesis.

MATERIALS AND METHODS

Patients

A summary of clinical details available from 12 families with Wolfram syndrome is given in Table 1. Histochemical analysis of a muscle biopsy in patient 13073 (family 08) was compatible with the diagnosis of ragged red fibres. The families were of German (families 3-7, 10 and 11), Turkish (families 1, 2 and 8), Yugoslavian (family 9) and Portuguese (family 12) descent.

Sequence analysis

Homology searches against the non-redundant and EST databases were performed using BLAST and FASTA. GENSCAN (15), GRAIL (16) and GENEFINDER (C. Wilson, L. Hillier and P. Green, personal communication) were used as exon prediction programs. Genome-wide repeats were identified using the REPEATMASKER program. GENOTATOR was used to display the results of the exon predictions programs, BLAST and repeats searches (23). Sequence alignments were performed using the Global Alignment Program (GAP) and CLUSTALW.

RT-PCR and RACE

RT-PCR was performed using 1-2 ng of human or mouse adult brain cDNA (Clontech) as templates. RACE was done using the Marathon cDNA Amplification Kit (Clontech). Primers designed from the predicted cDNA sequence were used for amplification of 0.2-2 kb products and are available on request. The probe wm1E7-2-5 was obtained with the following primer pair: wm1E7-2F, 5[prime]-AGAACTTCCGCACCCTCAC-3[prime]; wm1E7-5R, 5[prime]-GTAGAGGCAGCGCATCCAG-3[prime].

Northern blot analysis

The multiple tissue northern blot contained 2 µg poly(A)+ RNA each from heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas (Clontech). Hybridization with probe wm1E7-2-5 (see RT-PCR above) was performed in Church buffer at 65°C; washing was with 0.01× SSC at 60°C.

Mutation analysis

mtDNA deletions were screened by Southern blotting and mtDNA point mutations at positions 3460, 11778 and 14484 (LHON mutations) and 3243, 3271 and 3251 (MELAS mutations) were analyzed by RFLP methods as previously described (11). wolframin exons were amplified with intronic primers (Table 2). Amplified fragments were analyzed by SSCP using Hydrolink (AT Biochemical) gels at 20°C with and without glycerol. Staining was performed with VistraGreen and detection performed with a FluorImager (Molecular Dynamics). Variant bands were reamplified and used for direct sequencing with both the sense and antisense primer using a Taq DyeDeoxy Terminator Cycle sequencing kit (ABI). Sequences were determined with an Applied Biosystems 377 automated sequencer (accession nos Y18064, AJ011971).

ACKNOWLEDGEMENTS

We are grateful to the patients and their families for their participation in this study and the Stanford Human Genome Center for their generation and open dissemination of human genomic sequence data. We thank W. Burger, M. Dreyer, K.J. Eßer, H.J. Hartmann, W. Hecker, H. Muhle, R. Mühlenberg, K. Schlecht, W. Vorhoff, U. Wendel and D. Wenzel for sending DNA samples and D. Pongratz for histological analysis. We also thank K.B. Jedele for help in manuscript preparation and J. Murken for his support. MRI scans were kindly provided by K. Seelos, Department of Neuroradiology, Klinikum Grosshadern, LMU, München. This work was supported by the German Federal Ministry for Education, Research and Technology (BMBF 01KW9605).

REFERENCES

1. Wolfram, D.J. and Wagener, H.P. (1938) Diabetes mellitus and simple optic atrophy among siblings: report of four cases. Mayo Clin. Proc., 1, 715-718.

2. Barrett, T.G., Bundey, S.E. and Macleod, A.F. (1995) Neurodegeneration and diabetes: UK nationwide study of Wolfram (DIDMOAD) syndrome. Lancet, 346, 1458-1463. MEDLINE Abstract

3. Kinsley, B.T., Swift, M., Dumont, R.H. and Swift, R.G. (1995) Morbidity and mortality in the Wolfram syndrome. Diabetes Care, 18, 1566-1570. MEDLINE Abstract

4. Fraser, F.C. and Gunn, T. (1977) Diabetes mellitus, diabetes insipidus and optic atrophy. An autosomal recessive syndrome? J. Med. Genet., 14, 190-193. MEDLINE Abstract

5. Gunn, T., Bortolussi, R., Little, J.M., Andermann, F., Fraser, F.C. and Belmonte, M.M. (1976) Juvenile diabetes mellitus, optic atrophy, sensory nerve deafness and diabetes insipidus-a syndrome. J. Pediat., 89, 565-570. MEDLINE Abstract

6. Barrientos, A., Volpini, V., Casademont, J., Genis, D., Manzanares, J.M., Ferrer, I., Corral, J., Cardellach, F., Urbano-Marquez, A., Estivill, X. and Nunes, V. (1996) A nuclear defect in the 4p16 region predisposes to multiple mitochondrial DNA deletions in families with Wolfram syndrome. J. Clin. Invest., 97, 1570-1576. MEDLINE Abstract

7. Rötig, A., Cormier, V., Chatelain, P., Francois, R., Saudubray, J.M., Rustin, P. and Munnich, A. (1993) Deletion of mitochondrial DNA in a case of early-onset diabetes mellitus, optic atrophy and deafness (Wolfram syndrome, MIM 222300). J. Clin. Invest., 91, 1095-1098. MEDLINE Abstract

8. Bundey, S., Poulton, K., Whitwell, H., Curtis, E., Brown, I.A. and Fielder, A.R. (1992) Mitochondrial abnormalities in the DIDMOAD syndrome. J. Inherit. Metab. Dis., 15, 315-319. MEDLINE Abstract

9. Seyrantepe, V., Topaloglu, H., Simsek, E., Ozguc, M. and Yordam, N. (1996) Mitochondrial DNA studies in Wolfram (DIDMOAD) syndrome. Lancet, 347, 695-696. MEDLINE Abstract

10. Jackson, M.J., Bindoff, L.A., Weber, K., Wilson, J.N., Ince, P., Alberti, K.G. and Turnbull, D.M. (1994) Biochemical and molecular studies of mitochondrial function in diabetes insipidus, diabetes mellitus, optic atrophy and deafness. Diabetes Care, 17, 728-733. MEDLINE Abstract

11. Hofmann, S., Bezold, R., Jaksch, M., Obermaier-Kusser, B., Mertens, S., Kaufhold, P., Rabl, W., Hecker, W. and Gerbitz, K.D. (1997) Wolfram (DIDMOAD) syndrome and Leber hereditary optic neuropathy (LHON) are associated with distinct mitochondrial DNA haplotypes. Genomics, 39, 8-18. MEDLINE Abstract

12. Collier, D.A., Barrett, T.G., Curtis, D., Macleod, A., Arranz, M.J., Maassen, J.A. and Bundey, S. (1996) Linkage of Wolfram syndrome to chromosome 4p16.1 and evidence for heterogeneity. Am. J. Hum. Genet., 59, 855-863. MEDLINE Abstract

13. Polymeropoulos, M.H., Swift, R.G. and Swift, M. (1994) Linkage of the gene for Wolfram syndrome to markers on the short arm of chromosome 4. Nature Genet., 8, 95-97. MEDLINE Abstract

14. Swift, R.G., Polymeropoulos, M.H., Torres, R. and Swift, M. (1998) Predisposition of Wolfram syndrome heterozygotes to psychiatric illness. Mol. Psychiat., 3, 86-91.

15. Burge, C. and Karlin, S. (1997) Prediction of complete gene structures in human genomic DNA. J. Mol. Biol., 268, 78-94. MEDLINE Abstract

16. Uberbacher, E.C. and Mural, R.J. (1992) Locating protein-coding regions in human DNA-sequences by a multiple sensor neural network approach. Proc. Natl Acad. Sci. USA, 88, 11261-11265.

17. Rost, B., Casadio, R., Fariselli, P. and Sander, C. (1995) Transmembrane helices predicted at 95% accuracy. Protein Sci., 4, 521-533. MEDLINE Abstract

18. Hofmann, K. and Stoffel, W. (1993) TMbase-a database of membrane spanning protein segments. Biol. Chem. Hoppe-Seyler, 347, 166.

19. Nakai, K. and Kanehisa, M. (1992) A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics, 14, 897-911. MEDLINE Abstract

20. Akiyama, N., Shima, H., Hatano, Y., Osawa, Y., Sugimura, T. and Nagao, M. (1995) cDNA cloning of BR gamma, a novel brain-specific isoform of the B regulatory subunit of type-2A protein phosphatase. Eur. J. Biochem., 230, 766-772. MEDLINE Abstract

21. Blackwood, D.H., He, L., Morris, S.W., McLean, A., Whitton, C., Thomson, M., Walker, M.T., Woodburn, K., Sharp, C.M., Wright, A.F., Shibasaki, Y., St Clair, D.M., Porteous, D.J. and Muir, W.J. (1996) A locus for bipolar affective disorder on chromosome 4p. Nature Genet., 12, 427-430. MEDLINE Abstract

22. Kennedy, J.L. and Macciaroli, M. (1998) Chromosome 4 workshop. Psychiat. Genet., 8, 67-71.

23. Harris, N.L. (1997) Genotator: a workbench for sequence annotation. Genome Res., 7, 754-762. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +49 89 5160 4466; Fax: +49 89 5160 4780; Email: thomas@pedgen.med.uni-muenchen.de

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 13 Nov 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Genes Dev.Home page
Y.-F. Chen, C.-H. Kao, Y.-T. Chen, C.-H. Wang, C.-Y. Wu, C.-Y. Tsai, F.-C. Liu, C.-W. Yang, Y.-H. Wei, M.-T. Hsu, et al.
Cisd2 deficiency drives premature aging and causes mitochondria-mediated defects in mice
Genes & Dev., May 15, 2009; 23(10): 1183 - 1194.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
S. Koks, U. Soomets, J. L. Paya-Cano, C. Fernandes, H. Luuk, M. Plaas, A. Terasmaa, V. Tillmann, K. Noormets, E. Vasar, et al.
Wfs1 gene deletion causes growth retardation in mice and interferes with the growth hormone pathway
Physiol Genomics, May 13, 2009; 37(3): 249 - 259.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
M. R. R Gasparin, F. Crispim, S. L Paula, M. B. S Freire, I. S Dalbosco, T. D. Manna, J. E. N Salles, F. Gasparin, A. Guedes, J. M Marcantonio, et al.
Identification of novel mutations of the WFS1 gene in Brazilian patients with Wolfram syndrome
Eur. J. Endocrinol., February 1, 2009; 160(2): 309 - 316.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
P. A. Zalloua, S. T. Azar, M. Delepine, N. J. Makhoul, H. Blanc, M. Sanyoura, A. Lavergne, K. Stankov, A. Lemainque, P. Baz, et al.
WFS1 mutations are frequent monogenic causes of juvenile-onset diabetes mellitus in Lebanon
Hum. Mol. Genet., December 15, 2008; 17(24): 4012 - 4021.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
M. Zatyka, C. Ricketts, G. da Silva Xavier, J. Minton, S. Fenton, S. Hofmann-Thiel, G. A Rutter, and T. G. Barrett
Sodium-potassium ATPase 1 subunit is a molecular partner of Wolframin, an endoplasmic reticulum protein involved in ER stress
Hum. Mol. Genet., January 15, 2008; 17(2): 190 - 200.
[Abstract] [Full Text] [PDF]

Home page
 Diabetes CareHome page
S. Swaminathan, V. A. Fonseca, M. G. Alam, and S. V. Shah
The Role of Iron in Diabetes and Its Complications
Diabetes Care, July 1, 2007; 30(7): 1926 - 1933.
[Full Text] [PDF]

Home page
 Physiol. Rev.Home page
S. J. Marciniak and D. Ron
Endoplasmic reticulum stress signaling in disease.
Physiol Rev, October 1, 2006; 86(4): 1133 - 1149.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
T. Yamada, H. Ishihara, A. Tamura, R. Takahashi, S. Yamaguchi, D. Takei, A. Tokita, C. Satake, F. Tashiro, H. Katagiri, et al.
WFS1-deficiency increases endoplasmic reticulum stress, impairs cell cycle progression and triggers the apoptotic pathway specifically in pancreatic {beta}-cells
Hum. Mol. Genet., May 15, 2006; 15(10): 1600 - 1609.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
H Eiberg, L Hansen, B Kjer, T Hansen, O Pedersen, M Bille, T Rosenberg, and L Tranebjaerg
Autosomal dominant optic atrophy associated with hearing impairment and impaired glucose regulation caused by a missense mutation in the WFS1 gene.
J. Med. Genet., May 1, 2006; 43(5): 435 - 440.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
J R Porter and T G Barrett
Monogenic syndromes of abnormal glucose homeostasis: clinical review and relevance to the understanding of the pathology of insulin resistance and {beta} cell failure
J. Med. Genet., December 1, 2005; 42(12): 893 - 902.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. G. Fonseca, M. Fukuma, K. L. Lipson, L. X. Nguyen, J. R. Allen, Y. Oka, and F. Urano
WFS1 Is a Novel Component of the Unfolded Protein Response and Maintains Homeostasis of the Endoplasmic Reticulum in Pancreatic {beta}-Cells
J. Biol. Chem., November 25, 2005; 280(47): 39609 - 39615.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
K. Ueda, J. Kawano, K. Takeda, T. Yujiri, K. Tanabe, T. Anno, M. Akiyama, J. Nozaki, T. Yoshinaga, A. Koizumi, et al.
Endoplasmic reticulum stress induces Wfs1 gene expression in pancreatic {beta}-cells via transcriptional activation
Eur. J. Endocrinol., July 1, 2005; 153(1): 167 - 176.
[Abstract] [Full Text] [PDF]

Home page
 British Journal of Diabetes & Vascular DiseaseHome page
D. J Wake, V. Jadhav, L. R Whittome, and I. W Campbell
Wolfram syndrome: DIDMOAD
The British Journal of Diabetes & Vascular Disease, July 1, 2005; 5(4): 236 - 237.
[PDF]

Home page
 Arch. Dis. Child.Home page
J R Porter and T G Barrett
Acquired non-type 1 diabetes in childhood: subtypes, diagnosis, and management
Arch. Dis. Child., December 1, 2004; 89(12): 1138 - 1144.
[Abstract] [Full Text] [PDF]

Home page
 J. Mol. Diagn.Home page
I. Schrijver
Hereditary Non-Syndromic Sensorineural Hearing Loss: Transforming Silence to Sound
J. Mol. Diagn., November 1, 2004; 6(4): 275 - 284.
[Abstract] [Full Text] [PDF]

Home page
 Diabetes CareHome page
C. J.A. Smith, P. A. Crock, B. R. King, C. J. Meldrum, and R. J. Scott
Phenotype-Genotype Correlations in a Series of Wolfram Syndrome Families
Diabetes Care, August 1, 2004; 27(8): 2003 - 2009.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
H. Ishihara, S. Takeda, A. Tamura, R. Takahashi, S. Yamaguchi, D. Takei, T. Yamada, H. Inoue, H. Soga, H. Katagiri, et al.
Disruption of the WFS1 gene in mice causes progressive {beta}-cell loss and impaired stimulus-secretion coupling in insulin secretion
Hum. Mol. Genet., June 1, 2004; 13(11): 1159 - 1170.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. A. Osman, M. Saito, C. Makepeace, M. A. Permutt, P. Schlesinger, and M. Mueckler
Wolframin Expression Induces Novel Ion Channel Activity in Endoplasmic Reticulum Membranes and Increases Intracellular Calcium
J. Biol. Chem., December 26, 2003; 278(52): 52755 - 52762.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
S. Hofmann, C. Philbrook, K.-D. Gerbitz, and M. F. Bauer
Wolfram syndrome: structural and functional analyses of mutant and wild-type wolframin, the WFS1 gene product
Hum. Mol. Genet., August 15, 2003; 12(16): 2003 - 2012.
[Abstract] [Full Text] [PDF]

Home page
 J. Mol. Diagn.Home page
J. M. W. Van Den Ouweland, K. Cryns, R. J. E. Pennings, I. Walraven, G. M. C. Janssen, J. A. Maassen, B. F. E. Veldhuijzen, A. B. Arntzenius, D. Lindhout, C. W. R. J. Cremers, et al.
Molecular Characterization of WFS1 in Patients with Wolfram Syndrome
J. Mol. Diagn., May 1, 2003; 5(2): 88 - 95.
[Abstract] [Full Text] [PDF]

Home page
 Arch Otolaryngol Head Neck SurgHome page
M. M. Lesperance, J. W. Hall III, T. B. San Agustin, and S. M. Leal
Mutations in the Wolfram Syndrome Type 1 Gene (WFS1) Define a Clinical Entity of Dominant Low-Frequency Sensorineural Hearing Loss
Arch Otolaryngol Head Neck Surg, April 1, 2003; 129(4): 411 - 420.
[Abstract] [Full Text] [PDF]

Home page
 Arch Otolaryngol Head Neck SurgHome page
R. J. E. Pennings, S. J. H. Bom, K. Cryns, K. Flothmann, P. L. M. Huygen, H. Kremer, G. Van Camp, and C. W. R. J. Cremers
Progression of Low-Frequency Sensorineural Hearing Loss (DFNA6/14-WFS1)
Arch Otolaryngol Head Neck Surg, April 1, 2003; 129(4): 421 - 426.
[Abstract] [Full Text] [PDF]

Home page
 Nephrol Dial TransplantHome page
G. B. Piccoli, E. Mezza, A. Jeantet, and G. P. Segoloni
An uncommon genetic syndrome with acute renal failure in a 30-year-old diabetic patient
Nephrol. Dial. Transplant., January 1, 2003; 18(1): 206 - 208.
[Full Text] [PDF]

Home page
 DiabetesHome page
H. P. Harding and D. Ron
Endoplasmic Reticulum Stress and the Development of Diabetes: A Review
Diabetes, December 1, 2002; 51(90003): S455 - 461.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
C. C. Morton
Genetics, genomics and gene discovery in the auditory system
Hum. Mol. Genet., May 15, 2002; 11(10): 1229 - 1240.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
P. Eller, B. Foger, R. Gander, T. Sauper, M. Lechleitner, G. Finkenstedt, and J. R Patsch
Wolfram syndrome: a clinical and molecular genetic analysis
J. Med. Genet., November 1, 2001; 38 (11): e37 - e37.
[Full Text] [PDF]

Home page
 Hum Mol GenetHome page
I. N. Bespalova, G. Van Camp, S. J.H. Bom, D. J. Brown, K. Cryns, A. T. DeWan, A. E. Erson, K. Flothmann, H. P.M. Kunst, P. Kurnool, et al.
Mutations in the Wolfram syndrome 1 gene (WFS1) are a common cause of low frequency sensorineural hearing loss
Hum. Mol. Genet., October 1, 2001; 10(22): 2501 - 2508.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
T.-L. Young, E. Ives, E. Lynch, R. Person, S. Snook, L. MacLaren, T. Cator, A. Griffin, B. Fernandez, M. K. Lee, et al.
Non-syndromic progressive hearing loss DFNA38 is caused by heterozygous missense mutation in the Wolfram syndrome gene WFS1
Hum. Mol. Genet., October 1, 2001; 10(22): 2509 - 2514.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
K. Takeda, H. Inoue, Y. Tanizawa, Y. Matsuzaki, J. Oba, Y. Watanabe, K. Shinoda, and Y. Oka
WFS1 (Wolfram syndrome 1) gene product: predominant subcellular localization to endoplasmic reticulum in cultured cells and neuronal expression in rat brain
Hum. Mol. Genet., March 1, 2001; 10(5): 477 - 484.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
T. G BARRETT, M. SCOTT-BROWN, A. SELLER, A. BEDNARZ, K. POULTON, and J. POULTON
The mitochondrial genome in Wolfram syndrome
J. Med. Genet., June 1, 2000; 37(6): 463 - 466.
[Full Text]

Home page
 Genome ResHome page
L. Z. Strichman-Almashanu, R. S. Lee, P. O. Onyango, E. Perlman, F. Flam, M. B. Frieman, and A. P. Feinberg
A Genome-Wide Screen for Normally Methylated Human CpG Islands That Can Identify Novel Imprinted Genes
Genome Res., April 1, 2002; 12(4): 543 - 554.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (156)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Strom, T. M.
Right arrow Articles by Meitinger, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Strom, T. M.
Right arrow Articles by Meitinger, T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?