Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Stairs, D. B.
Right arrow Articles by Chodosh, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stairs, D. B.
Right arrow Articles by Chodosh, L. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 2157-2166  

Cloning and characterization of Krct, a member of a novel subfamily of serine/threonine kinases
Introduction
Results
   Isolation of cDNA clones encoding Krct
   Homology to previously isolated protein kinases
   Krct encodes a functional protein kinase
   Chromosomal localization
   Analysis of Krct mRNA expression
Discussion
Materials And Methods
   Krct cloning
   Tissue preparation
   Northern analysis
   In vitro transcription/translation
   Kinase assay
   In situ hybridization
   Sequence analysis
   Interspecific mouse backcross mapping
Acknowledgements
Note Added In Proof
References

Cloning and characterization of Krct, a member of a novel subfamily of serine/threonine kinases

Cloning and characterization of Krct, a member of a novel subfamily of serine/threonine kinases

Douglas B. Stairs1, Heather Perry Gardner1, Seung I. Ha1, Neal G. Copeland3, Debra J. Gilbert3, Nancy A. Jenkins3 and Lewis A. Chodosh1,2,*

1Department of Molecular and Cellular Engineering and 2Division of Endocrinology, Diabetes and Metabolism, Stellar-Chance Laboratories, Room 309A, University of Pennsylvania School of Medicine, 422 Curie Boulevard, Philadelphia, PA 19104-6100, USA and 3Mammalian Genetic Laboratory, ABL-Basic Research Program, NCI-Frederick Cancer Research and Development Center, Frederick, MD 21702-1201, USA

Received September 3, 1998; Revised and Accepted October 1, 1998

Protein kinases frequently play key roles in the normal regulation of growth and development in eukaryotic organisms. As a consequence, aberrant expression or mutations in this family of molecules frequently result in transformation. Previously, we have conducted a screen to identify protein kinases that are expressed in the mouse during mammary gland development and in breast cancer cell lines. We now describe the molecular cloning, characterization and expression of Krct, a novel serine/threonine protein kinase unrelated to previously defined families of protein kinases. At the mRNA level, Krct is widely expressed throughout murine development and in adult tissues. Despite its ubiquitous expression, Krct is expressed preferentially within specific cellular compartments in multiple tissues, in particular within the testis and gastrointestinal tract. At the amino acid level, Krct is most closely related to four previously undescribed kinases in Saccharomyces cerevisiae, Arabidopsis thaliana and Caenorhabditis elegans. Together, these kinases appear to define a novel subfamily of serine/threonine protein kinases. Krct possesses an unusually long 5[prime]-untranslated region containing multiple upstream initiation codons and, in this regard, is similar to many proto-oncogenes that regulate normal growth and differentiation. In addition, Krct is located on mouse chromosome 11 closely linked to the epidermal growth factor receptor and, therefore, is likely to be co-amplified in a variety of human tumors.

INTRODUCTION

Epidemiologic evidence strongly suggests that breast cancer risk is intrinsically related to the manner in which the breast normally develops during fetal life, puberty and pregnancy (1-3). The close relationship between development and carcinogenesis in the mammary gland is exemplified by the biological properties of protein kinases. Studies in a variety of model systems have demonstrated that members of this family of regulatory molecules frequently modulate the normal growth, differentiation and development of eukaryotic organisms (4). As would be predicted from this, alterations in the regulated expression or function of protein kinases frequently have been found to result in cellular transformation and neoplasia (4-7). Indeed, several members of the protein kinase family have been shown to contribute to the development of breast cancer both in humans and in rodent model systems, including c-erbB-2/Neu, the epidermal growth factor (EGF) receptor, the insulin-like growth factor 1 (IGF1) receptor, the fibroblast growth factor (FGF) receptor family, Met and c-Src (8-12). Consistent with this, overexpression of an activated form of c-erbB2/Neu and of several other protein kinases in transgenic mice results in malignant transformation of the mammary epithelium. Moreover, some protein kinases have been shown to provide prognostic information relevant to clinical outcome and response to chemotherapy. In particular, amplification of c-erbB2/Neu in primary breast cancers has been reported to correlate with an aggressive tumor phenotype and a poor clinical prognosis (13-17).

To explore the role played by protein kinases in development and carcinogenesis in the mammary gland, we previously performed an RT-PCR-based screen to isolate cDNA fragments of protein kinases expressed during mammary gland development and in breast cancer cell lines. A total of 43 kinases were identified, three of which have not been described previously. One of the three cDNA fragments isolated encodes a portion of a novel protein kinase, Krct (kinase related to cerevisiae and thaliana), whose identification defines a novel subfamily of serine/threonine kinases within which Krct represents the first member to be identified in vertebrates. Here we describe the cloning, expression and initial characterization of murine Krct.

RESULTS

In order to identify molecules involved in regulating mammary gland development and carcinogenesis, we used a degenerate PCR approach to amplify catalytic subdomains of protein kinases expressed in breast cancer cell lines and in the mammary gland during its development. Poly(A)+ RNA was prepared from murine mammary glands harvested at different developmental stages as well as from three non-transformed murine mammary epithelial cell lines and four breast cancer cell lines derived from different transgenic mouse models of breast cancer. First-strand cDNA from each of these sources was prepared independently and amplified using two sets of degenerate PCR primers encoding amino acid motifs within subdomains VIb and IX that are highly conserved among protein kinases (18-20). PCR products from each cDNA source were subcloned individually and screened by a combination of DNA sequencing and colony lift hybridization. Screening of ~1500 cDNA clones using this approach resulted in the identification of 43 protein kinases, including a single clone containing a 215 bp cDNA fragment, referred to as Bstk2, from the catalytic domain of a novel putative serine/threonine kinase (L.A. Chodosh et al., in preparation). This cDNA fragment was isolated from amplified cDNA prepared from the mammary glands of mice that had undergone a single pregnancy followed by 21 days of lactation and 2 days of post-lactational regression.

Isolation of cDNA clones encoding Krct

In order to isolate a full-length cDNA clone encompassing the catalytic domain fragment Bstk2, this initial 215 bp RT-PCR product was used to screen cDNA libraries prepared either from murine mammary glands at day 7 of pregnancy, or from AC816, a mammary epithelial cell line derived from an adenocarcinoma arising in an MMTV-H-ras transgenic mouse. A total of 13 cDNA clones were obtained containing inserts ranging from 1.1 to 2 kb in size. The nucleotide sequence of clones M1-1 and M2A from the mammary gland cDNA library and clones D1 and G3 from the AC816 cDNA library was determined by automated sequencing of both strands. The composite 1512 nucleotide cDNA clone encoding Krct contains the entire 215 bp RT-PCR fragment Bstk2 from position 743 to 957. This clone also contains an open reading frame (ORF) of 915 nucleotides beginning with an AUG at nucleotide 291 (Fig. 1). Comparison of the nucleotide sequence surrounding this putative initiation codon with the Kozak consensus sequence, GCCA/GCCAUGG, reveals matches at each of the most highly conserved positions: -6, -4, -3 and +4 (21,22). Multiple stop codons are present in all three frames upstream of the putative initiation codon. These data suggest that the initiation codon of Krct is the AUG at nucleotide 291. The 5[prime]-untranslated region 5[prime]-UTR of Krct is unusually long, relatively GC-rich (67%), and contains three upstream AUG codons, the closest of which is located 14 nucleotides upstream of the putative initiation codon. This upstream AUG initiates an ORF of 40 amino acids that overlaps the main Krct ORF. The 3[prime]-UTR is 306 nucleotides in length and contains a polyadenylation signal and poly(A) tract. Additional cDNA clones were isolated containing small insertions and deletions within the coding region, the significance of which currently is under study.


Figure 1. Nucleotide/amino acid sequence of Krct. The composite nucleic acid sequence and conceptual translation for Krct is shown. Nucleotide coordinates are shown on the left. Amino acid coordinates are shown in bold on the right. A light shaded box indicates the putative catalytic domain. Dark shaded boxes denote amino acid motifs characteristic of serine/threonine kinases. Upstream AUGs located in the 5[prime]-UTR are indicated by shaded boxes. Stop codons present in the 5[prime]-UTR and the polyadenylation sequence in the 3[prime]-UTR are underlined. An asterisk denotes the stop codon for the Krct ORF.

The conceptual ORF of Krct comprises 305 amino acids and can be divided into an N-terminal domain of 19 amino acids, a 276 amino acid putative catalytic domain, and a 10 amino acid C-terminal domain. Each of the amino acids known to be invariant among protein kinases is present in the putative catalytic domain of Krct (23). Among the sequence elements that distinguish tyrosine kinases from serine/threonine kinases, Krct is most similar to the latter, in particular with regard to the LKPXN motif in subdomain VIb and the APE motif in subdomain VIII (Fig. 1). In addition, several amino acids in subdomains I, VII, VIII, X and XI that are conserved in tyrosine kinases are absent from the Krct ORF.

In order to confirm the coding potential of the Krct, in vitro transcription/translation (IVT) of the full-length cDNA clone was performed. This generated a predominant 35 kDa labeled polypeptide species, consistent with the predicted 34.4 kDa size of the protein (Fig. 2). Deletion of the entire 291 nucleotide 5[prime]-UTR containing all three upstream AUGs resulted in the same 35 kDa labeled polypeptide. These observations strongly suggest that the predicted initiation codon at nucleotide 291 is indeed the site of translation initiation. Programing of reticulocyte lysates with the full-length Krct cDNA also generated two lesser species at 45 and 27 kDa. These species were also generated by IVT of a 5[prime]-UTR-deleted form of Krct, demonstrating that these polypeptides do not result from translation initiation at upstream AUGs followed by readthough into the Krct ORF.


Figure 2. In vitro transcription/translation of Krct. [35S]methionine-labeled Krct protein was generated using rabbit reticulocyte lysates programed with 500 ng of full-length Krct cDNA or 500 ng of pKrct-[Delta]5[prime], lacking the 291 nucleotide 5[prime]-UTR. pGem11Zf plasmid was used as a control. The relative migration of molecular weight markers is indicated.

Homology to previously isolated protein kinases

Alignment of the predicted Krct ORF with GenBank sequences reveals that Krct displays highest homology to a small group of unpublished kinases found in lower eukaryotes. The two kinases demonstrating highest homology to Krct are atpk3 (GenBank accession no. U97568), a serine/threonine kinase of unknown function identified in Arabidopsis thaliana, and YPL236c (GenBank accession no. Z73592), a hypothetical protein recognized as a kinase following analysis of the complete Saccharomyces cerevisiae DNA sequence (24,25). Amino acid alignment of Krct to YPL236c and atpk3 reveals 35 and 34% overall identity to Krct, respectively, with significant homology over the length of the Krct N-terminal and kinase catalytic domains (Fig. 3A). In comparison, amino acid alignment of the catalytic domain of Krct to those of serine/threonine kinases from other kinase families in S.cerevisiae such as MekI and CaMKII reveals levels of identity on the order of 17-21%. YPL236c has no residues C-terminal to the catalytic domain, and atpk3 has only four, preventing analysis of similarities to Krct in this region. Krct also displays significant homology to a putative cyclin G-associated kinase identified in A.thaliana (GenBank accession no. AC003033), and to a putative serine/threonine protein kinase, D2045.7, identified in Caenorhabditis elegans (GenBank accession no. Z35639). Alignment of the C-terminus of the putative cyclin G-associated kinase to Krct reveals that four of the 10 C-terminal residues of Krct are conserved. Placement of Krct and its most closely related kinases into an evolutionary tree on the basis of amino acid similarities within their catalytic domains demonstrates that these kinases are more closely related to each other than to any previously described group of kinases (Fig. 3B). This suggests that Krct, YPL236c, atpk3, D2045.7 and AC003033 represent a novel subfamily of protein kinases, of which Krct is the first member identified in vertebrates.


Figure 3. Krct defines a novel subfamily of serine/threonine kinases. (A) Schematic representation of amino acid homology between Krct, YPL236c, atpk3 and AC003033. Results of the pairwise analysis using the ClustalW alignment program of the N-terminus, catalytic domain and C-terminus of Krct, YPL236c, atpk3, AC003033 and Mek1 are listed. The percentage identity to Krct within each of these domains is indicated for each kinase. N-terminal, catalytic and C-terminal domains are indicated by open boxes, shaded boxes and black boxes, respectively. NS, not significant. (B) Phylogenetic tree illustrating the relationship of Krct with other serine/threonine kinases in the GenBank database. Analysis and depiction of results was performed using the ClustalX multisequence alignment program and DendroMaker 4.0.

Krct encodes a functional protein kinase

In order to demonstrate that Krct encodes a functional kinase, a fusion protein consisting of the entire coding sequence of Krct fused to glutathione-S-transferase (GST) was generated. In vitro kinase assays were performed with purified recombinant GST-Krct fusion protein using histone H1 and myelin basic protein (MBP) as substrates (Fig. 4). GST-fused Krct was able to phosphorylate both histone H1 and MBP in vitro. Autophosphorylation of the GST-Krct fusion protein was also observed. These findings confirm that Krct encodes a functional protein kinase.


Figure 4. Krct encodes a functional protein kinase. Histone H1 and myelin basic protein (MBP) were used as in vitro kinase substrates for purified GST-Krct fusion protein. Histone H1 and MBP were incubated in the absence or presence of purified GST-Krct, as indicated. Reactions were performed using either 2 µg (lanes 3, 4 and 6) or 7 µg (lanes 5 and 7) of GST-Krct. Arrowheads indicate the relative migration of GST-Krct (top), histone H1 (middle) and MBP (bottom). The relative migration of molecular weight markers is indicated.

Chromosomal localization

The mouse chromosomal localization of Krct was determined by interspecific backcross analysis using progeny derived from matings of [(C57BL/6J × Mus spretus)F1 × C57BL/6J] mice (26). This interspecific backcross mapping panel has been typed for >2700 loci that are well distributed among all the autosomes as well as the X chromosome. C57BL/6J and M.spretus DNAs were digested with several enzymes and analyzed by Southern blot hybridization for informative restriction fragment length polymorphisms (RFLPs) using a mouse cDNA Krct probe. The 5.0 kb HincII and 2.5 kb BamHI M.spretus RFLPs (see Materials and Methods) were used to follow the segregation of the Krct locus in backcrossed mice. The mapping results indicated that Krct is located in the proximal region of mouse chromosome 11 linked to Ikaros, Egfr and Rel. Although 125 mice were analyzed for every marker and are shown in the segregation analysis (Fig. 5), up to 174 mice were typed for some pairs of markers. Each locus was analyzed in pairwise combinations for recombination frequencies using the additional data. The ratios of the total number of mice exhibiting recombinant chromosomes to the total number of mice analyzed for each pair of loci and the most likely gene order are: centromere-Ikaros (1/174)-Egfr (0/164)-Krct (6/133)-Rel. The recombination frequencies [expressed as genetic distances in centiMorgans (cM) ± standard error] are Ikaros (0.6 ± 0.6)-(Egfr, Krct) (4.5 ± 1.8). No recombinants were detected between Egfr and Krct in 164 animals typed in common, suggesting that the two loci are within 1.8 cM of each other (upper 95% confidence limit).


Figure 5. Krct maps in the proximal region of mouse chromosome 11. Krct was placed on mouse chromosome 11 by interspecific backcross analysis. The segregation patterns of Krct and flanking genes in 125 backcrossed animals that were typed for all loci are shown at the top of the figure. For individual pairs of loci, >125 animals were typed (see text). Each column represents the chromosome identified in the backcross progeny that was inherited from the (C57BL/6J × M.spretus) F1 parent. The shaded boxes represent the presence of a C57BL/6J allele and white boxes represent the presence of an M.spretus allele. The number of offspring inheriting each type of chromosome is listed at the bottom of each column. A partial chromosome 11 linkage map showing the location of Krct in relation to linked genes is shown at the bottom of the figure. Recombination distances between loci in cM are shown to the left of the chromosome, and the positions of the loci in human chromosomes, where known, are shown to the right. References for the human map positions of loci cited in this study can be obtained from the Genome Data Base, a computerized database of human linkage information maintained by The William H. Welch Medical Library of the Johns Hopkins University (Baltimore, MD).

We have compared our interspecific map of chromosome 11 with a composite mouse linkage map that reports the map location of many uncloned mouse mutations (provided by the Mouse Genome Database, a computerized database maintained at the Jackson Laboratory, Bar Harbor, ME). Krct mapped in a region of the composite map that lacks mouse mutations with a phenotype that might be expected for an alteration in this locus (data not shown). The proximal region of mouse chromosome 11 shares homology with human chromosomes 7p and 2p (summarized in Fig. 5). In particular, Egfr has been mapped to 7p12. The close linkage between Egfr and Krct in mouse suggests that the human homolog of Krct will map to 7p as well.

Analysis of Krct mRNA expression

In order to begin to analyze the biological role played by Krct, the spatial and temporal pattern of mRNA expression of this gene was determined during fetal development and in adult tissues in the mouse. Northern hybridization analysis of RNA isolated from FVB embryos at embryonic days E6.5, E13.5 and E18.5 using a Krct cDNA probe revealed an abundantly expressed 1.5 kb mRNA species at each of these developmental time points (Fig. 6A). The size of this message matches that predicted based on the size of the isolated cDNA clones, suggesting that the 1512 nucleotide Krct cDNA sequence represents the full-length message. In situ hybridization performed on E13.5 and E18.5 embryos using an antisense Krct cDNA probe revealed widespread Krct expression in most tissues of the developing mouse, with particularly high levels of expression observed in the fetal liver, dorsal root ganglia and cortical regions of the kidney at E13.5 and E18.5 (Fig. 6B). High levels of Krct expression were also observed in salivary gland, brown adipose tissue and hair follicles at E18.5.


Figure 6. Expression of Krct during murine embryogenesis. (A) Northern hybridization analysis of 1 µg of poly(A)+ RNA from day E6.5, E13.5 and E18.5 embryos hybridized with a cDNA probe specific for Krct. The blot was stripped and reprobed with Gapdh as a loading control. The relative migration of RNA size markers is indicated. (B) In situ hybridization analysis of Krct mRNA expression. Bright-field (a and c) and dark-field (b and d) photomicrographs of E13.5 (a and b) and E18.5 (c and d) FVB embryo sections hybridized with a Krct antisense cDNA probe. No signal over background was detected in serial sections hybridized with sense Krct probes. Magnification: 8× (a and b); 6.3× (c and d). bf, brown adipose tissue; cx, cortex; drg, dorsal root ganglia; hf, hair follicles; ht, heart; ki, kidney; li, liver; lu, lung; lv, lateral ventricle; sg, salivary gland; st, stomach.

Krct expression was also determined at the mRNA level in tissues of the adult mouse. Northern hybridization revealed that Krct is expressed in all organs examined, with highest levels of expression present in the mammary gland, ovary, liver, kidney and small intestine (Fig. 7). In situ hybridization analysis of Krct mRNA expression revealed that although Krct is widely expressed in tissues of the adult mouse, Krct expression within these tissues occurs preferentially in certain cell types. In the gastrointestinal tract, Krct is highly expressed in epithelial compartments of the stomach, duodenum and colon, and is expressed at significantly lower levels in the mesenchymal compartments of these tissues (Fig. 8). Similarly, Krct is expressed at higher levels in the glandular epithelium of the prostate than in its stromal component. In the mammary gland, Krct is expressed at high levels in the alveolar and ductal epithelium and at moderate though somewhat lower levels in the stroma. In the testis, Krct is expressed at high levels in the peripheral regions of seminiferous tubules that are populated principally by Sertoli cells, spermatogonia and primary spermatocytes. Krct is expressed at lower levels in Leydig cells within the interstitial compartment of the testis and in the central region of seminiferous tubules populated by the more differentiated spermatids and spermatozoa. All regions of the brain were found to express Krct, although expression was particularly high in the hippocampus and dentate gyrus (Fig. 9).


Figure 7. Northern hybridization analysis of Krct in tissues of the adult mouse. A northern blot containing 1 µg of poly(A)+ RNA isolated from the indicated murine tissues was hybridized with a cDNA probe specific for Krct. The hybridization patterns for the same blot probed with a b-actin cDNA fragment, and a blot containing the same RNA samples probed with a Gapdh cDNA fragment, are shown. The 28S rRNA band is shown from the ethidium bromide-stained nitrocellulose blot.


Figure 8. Spatial localization of Krct expression in the gastrointestinal tract. Bright-field (a, c and e) and dark-field (b, d and f) photomicrographs of in situ hybridization analysis performed on sections of stomach (a and b), duodenum (c and d) and colon (e and f) hybridized with a Krct antisense probe. No signal over background was detected in serial sections hybridized with a sense Krct probe. Magnification: 100× (a and b); 200× (c-f). c, intestinal crypts; lp, lamina propria; mu, mucosa; se, serosa; su, submucosa.


Figure 9. Spatial localization of Krct expression in tissues of the adult mouse. Bright-field (a, c, e and g) and dark-field (b, d, f and h) photomicrographs of in situ hybridization analysis performed on sections of dorsolateral prostate (a and b), number four mammary gland of a day 7 pregnant mouse (c and d), testis (e and f) and brain (g and h) hybridized with a Krct antisense probe. Arrows indicate Krct-expressing stromal cells in the mammary gland. No signal over background was detected in serial sections hybridized with a sense Krct probe. Magnification: 200× (a-f); 63× (g and h). al, alveoli; cx, cortex; d, duct; dg, dentate gyrus; ep; epithelium; hc, hippocampus; in; interstitium; st; stroma; se; seminiferous tubules.

DISCUSSION

The novel serine/threonine kinase, Krct, was isolated initially as a cDNA fragment in a degenerate oligonucleotide PCR screen designed to identify protein kinases potentially involved in mammary gland development and carcinogenesis. Herein we describe the molecular cloning and analysis of a full-length murine cDNA clone encoding Krct. Krct is widely expressed in the mouse at the mRNA level and encodes a 35 kDa protein with proven phosphotransferase capabilities. Amino acid sequence analysis indicates that Krct is most closely related to a group of unpublished kinases identified in S.cerevisiae, A.thaliana and C.elegans of unknown function. Comparison of the amino acid sequence of this group of genes with those from each of the major branches of the kinase superfamily suggests that these genes represent a novel subfamily of serine/threonine protein kinases, of which Krct represents the first member to be described in vertebrates.

Krct is expressed in the mouse in a broad range of tissues and at high levels throughout fetal development as well as in the adult mouse. In contrast to the widespread expression of Krct as determined by northern hybridization, in situ hybridization analysis reveals that Krct is expressed preferentially in specific cell types within these tissues. In particular, Krct is expressed preferentially in epithelial as compared with mesenchymal compartments of the prostate, stomach, duodenum, colon and, to a lesser extent, mammary gland. Similarly, Krct is expressed in the testis and brain in a cell type-specific pattern, being expressed at the highest levels in the testis in spermatogonia and primary spermatocytes, and in the brain in the hippocampus and dentate gyrus.

The 5[prime]-UTR of Krct is 291 nucleotides in length. Interestingly, of 346 vertebrate mRNAs studied by Kozak, only 7.8% were longer than 200 nucleotides and only 2.3% were longer than 300 nucleotides (21). Long 5[prime]-UTRs are generally associated with poor translational efficiency and/or translational regulation (21,22). Moreover, the 5[prime]-UTR of Krct contains three upstream AUG codons, the most proximal of which lies only 14 nucleotides upstream of the initiation codon and initiates an ORF with an overlapping reading frame. Excluding proto-oncogenes, <10% of vertebrate mRNAs contain upstream AUGs, and the majority of those which do contain only one (21,22). In contrast, two-thirds of proto-oncogenes as well as a high percentage of growth factors, signal transduction proteins and transcription factors contain at least one upstream AUG. The unusual length of the 5[prime]-UTR, as well as the presence and location of upstream initiation codons, suggest that Krct expression may be regulated at the level of translational initiation, and are consistent with a role for Krct in regulating normal growth and differentiation.

Our data indicate that Krct is located within 1.8 cM of the Egfr locus on mouse chromosome 11. Egfr is amplified and overexpressed in a variety of human tumors including glioblastomas and squamous cell carcinomas of the head and neck. Previous studies have demonstrated that additional genes located within 2 cM of Egfr are also amplified and overexpressed in glioblastomas (27). These data suggest that Krct may be contained on the Egfr amplicon and may be overexpressed in human cancers. Whether such overexpression could contribute to the biological behavior of these tumors remains to be tested.

When considered with its cell type-specific pattern of expression, the cDNA structure and apparent conservation of this novel subfamily of protein kinases during evolution suggest that Krct may play a significant role in vital cellular processes. As such, it will be important to identify the signaling pathways in which Krct participates. In this regard, insights into these pathways may be gained through analysis of the functions of Krct family members in lower eukaryotes.

MATERIALS AND METHODS

Krct cloning

Poly(A)+ RNA isolated from a H-ras transgenic mammary epithelial tumor cell line, AC816, and from the mammary glands of FVB mice at day 7 of pregnancy were each used to generate independent cDNA libraries in [lambda]ZAP using the ZAP-cDNA synthesis kit and ZAP-cDNA Gigapack II Gold packaging kit according to the manufacturer's instructions (Stratagene). A total of 5 × 105 plaques from each library were screened by standard methods using a [32P]dCTP-labeled random-primed cDNA fragment (BMB Random Prime) corresponding to nucleotides 921-1135 of Krct. Hybridization was performed at a concentration of 106 c.p.m./ml in 48% formamide, 10% Dextran sulfate, 4.8× SSC, 20 mM Tris (pH 7.5), 10× Denhart's solution, 20 µg/ml salmon sperm DNA and 0.1% SDS at 42°C overnight. Following hybridization, washes were performed in 2× SSC/0.1% SDS. Filters were washed in 2× SSC/0.1% SDS at room temperature for 30 min (×2), followed by one 30 min wash at 50°C, and subjected to autoradiography (Kodak XAR-5). A total of 13 phage clones were plaque purified and plasmids liberated by in vivo excision according to the manufacturer's instructions (Stratagene). The nucleotide sequence of two clones from each library was determined by automated sequencing of both strands using an ABI Prism 377 DNA sequencer. The full-length Krct cDNA sequence has been deposited in the GenBank database (accession no. AF089869).

Tissue preparation

FVB mice were housed under barrier conditions with a 12 h light/dark cycle. Mouse embryos and mammary gland tissue were harvested at specified time points following timed matings. Day 0.5 p.c. was defined as noon of the day on which a vaginal plug was observed. Organs were harvested from 15- to 16-week-old virgin mice. Tissues used for RNA preparation were snap-frozen on dry ice. Tissues used for in situ hybridization analysis were either embedded in OCT medium and frozen in a dry ice/isopentane bath or fixed in neutral buffered formalin for 24 h followed by paraffin embedding.

Northern analysis

RNA was prepared by homogenization of cultured cells or snap-frozen tissue samples in guanidinium isothiocyanate followed by ultracentrifugation through cesium chloride as previously described (28,29). Poly(A)+ RNA was selected using oligo(dT) cellulose (Pharmacia). Northern hybridization was performed as described (28). Probes used for analysis were generated by random-primed labeling of cDNA fragments and included nucleotides 624-1234 of Krct, 1142-1241 of b-actin and 466-1056 of Gapdh. Hybridization was performed overnight at 42°C. Following hybridization, washes were performed in 2× SSC/0.1% SDS at room temperature for 30 min (×2), followed by one 30 min wash at 50°C, and subjected to autoradiography (Kodak XAR-5).

In vitro transcription/translation

In vitro transcription/translation was performed on 500 ng of DNA using rabbit reticulocyte lysates and [35S]methionine according to the manufacturer's instructions (Promega). Samples were electrophoresed on a 17% SDS-PAGE gel and subjected to autoradiography. Krct was subcloned into pGem11Zf (Promega) by EcoRI and ApaI digestion of the Krct D1 clone in pBS SK(+/-) and ligation of the purified Krct cDNA fragment (nucleotides 11-1512) into the EcoRI and ApaI sites of pGem11Zf. Deletion of the 5[prime]-UTR was performed by PCR-based mutagenesis. Oligonucleotide primers CTGAATTCACTGAGACGTTATGGGCCACG, containing an EcoRI site, and CCCCTCATCACCAAGC were used to amplify nucleotides 280-767 of the D1 Krct cDNA clone using Taq polymerase (BMB). PCR was performed in a Perkin Elmer GeneAmp PCR System 9600 thermocycler under the following conditions: initial denaturation at 95°C for 5 min followed by 30 s at 94°C, 30 s at 55°C and 2 min at 72°C for 10 cycles. A final extension was performed at 72°C for 5 min. The PCR product generated contained an EcoRI restriction site at the 5[prime] end and an internal BamHI site at nucleotide 428 of Krct. This EcoRI-BamHI fragment was purified and ligated into the D1 clone in pGem11Zf following digestion with EcoRI and BamHI to yield a 5[prime]-deleted form of Krct.

Kinase assay

The full-length Krct ORF was subcloned in-frame in pGEX6P-1 (Pharmacia) and expressed in bacterial strain BL21 by induction with 100 µM isopropyl-[beta]-d-thiogalactopyranoside (IPTG) at 30°C for 3 h. Protein was purified by passage over glutathione-Sepharose 4B beads according to the manufacturer's instructions (Pharmacia). In vitro kinase activity was assayed under final reaction conditions consisting of 20 mM Tris (pH 7.5), 5 mM MgCl2 and 100 µM ATP, using 3 µg of either histone H1 or MBP (Sigma) as a substrate, and either 2 or 7 µg of the purified bound GST-Krct fusion protein. Following a 30 min incubation at 30°C, samples were electrophoresed on a 15% SDS-PAGE gel and subjected to autoradiography.

In situ hybridization

In situ hybridization was performed as described (28). Antisense and sense probes were synthesized with the Promega in vitro transcription system using [35S]UTP and [35S]CTP from the T7 and SP6 RNA polymerase promoters of a PCR template containing sequences corresponding to nucleotides 624-1234 of Krct. Exposure times were: 4 weeks for OCT sections of colon, prostate, duodenum, brain and E18.5 embryo; 4 weeks 5 days for OCT sections of stomach, E13.5 embryo and mammary gland at day 7 of pregnancy; and 8 weeks 6 days for paraffin sections of testis.

Sequence analysis

Sequence analysis including predicted ORFs and calculation of the molecular weight of Krct was performed using MacVector. Pairwise sequence alignments were performed using the ClustalW alignment program. Multiple sequence alignment and phylogenetic calculations were performed using the ClustalX multisequence alignment program. DendroMaker 4.0 was used to draw a phylogenetic tree.

Interspecific mouse backcross mapping

Interspecific backcross progeny were generated by mating (C57BL/6J × M.spretus)F1 females and C57BL/6J males as described. In total, 205 N2 mice were used to map the Krct locus (see text for details). DNA isolation, restriction enzyme digestion, agarose gel electropheresis, Southern blot transfer and hybridization were performed essentially as described. All blots were prepared with Hybond-N+ nylon membrane (Amersham). The probe, an ~575 bp EcoRI fragment of mouse cDNA was labeled with [32P]dCTP using a nick translation labeling kit (BMB); washing was carried out to a final stringency of 1× SSCP, 0.1% SDS, 65°C. Fragments of 6.0 and 3.6 kb were detected in HincII-digested C57BL/6J (B) DNA, and fragments of 5.0 and 3.6 kb were detected in HincII-digested M.spretus (S) DNA. Inaddition, BamHI digestion produced fragments of 5.3 and 4.6 kb (B) and 5.3 and 2.5 kb (S). The presence or absence of theM.spretus-specific fragments, which co-segregated, was followed in the backcrossed mice. The HincII and BamHI data were combined.

A description of the probes and RFLPs for the loci linked to Krct including Ikaros, Egfr and Rel have been reported previously. Recombination distances were calculated using Map Manager, version 2.6.5. Gene order was determined by minimizing the number of recombination events to explain the allele distribution patterns.

ACKNOWLEDGEMENTS

The authors thank members of the Chodosh laboratory for helpful discussions, Deborah B. Householder for excellent technical assistance, and Celina D'Cruz, L. Julie Huber, Stephen Master, Gerald Wertheim and Thomas Yang for critical reading of the manuscript. This work was supported by NIH grants CA71513 (L.A.C.) from the National Cancer Institute and CA78410 (L.A.C.) from the National Cancer Institute and the National Institute of Diabetes and Digestive and Kidney Diseases, the National Cancer Institute under contract with ABL, US Army Breast Cancer Research Program grants DAMD17-96-1-6112 (H.P.G.), DAMD17-98-1-8235 (D.B.S.) and DAMD17-98-1-8226 (L.A.C.), the Elsa U. Pardee Foundation (L.A.C.) and the Charles E. Culpeper Foundation (L.A.C.). L.A.C. is a Charles E. Culpeper Medical Scholar.

NOTE ADDED IN PROOF

While this manuscript was under review, a kinase with nucleotide sequence nearly identical to that of Krct was described by J.M. Ligos, N. Gerwin, P. Fernandez, J.C. Gutierrez-Ramos and A. Bernad (1998) Cloning, expression analysis, and functional characterization of PKL12, a member of a new subfamily of ser/thr kinases. Biochem. Biophys. Res. Commun., 249, 380-384.

REFERENCES

1. Henderson, B.E., Ross, R.K. and Pike, M.C. (1991) Toward the primary prevention of cancer. Science, 254, 1131-1138. MEDLINE Abstract

2. Key, T.J. and Pike, M.C. (1988) The role of oestrogens and progestagens in the epidemiology and prevention of breast cancer. Eur. J. Cancer Clin. Oncol., 24, 29-43. MEDLINE Abstract

3. Kelsey, J.L., Gammon, M.D. and John, E.M. (1993) Reproductive factors and breast cancer. Epidemiol. Rev., 15, 36-47. MEDLINE Abstract

4. Wilks, A.F. (1993) Protein tyrosine kinase growth factor receptors and their ligands in development, differentiation, and cancer. Adv. Cancer Res., 60, 43-73. MEDLINE Abstract

5. Birchmeier, C. and Birchmeier, W. (1993) Molecular aspects of mesenchymal-epithelial interactions. Annu. Rev. Cell Biol., 9, 511-540. MEDLINE Abstract

6. Birchmeier, C., Sonnenberg, E., Weidner, K.M. and Walter, B. (1993) Tyrosine kinase receptors in the control of epithelial growth and morphogenesis during development. BioEssays, 15, 185-190. MEDLINE Abstract

7. Fantl, W.J., Johnson, D.E. and Williams, L.T. (1993) Signalling by receptor tyrosine kinases. Annu. Rev. Biochem., 62, 453-481. MEDLINE Abstract

8. Guy, C.T., Muthuswamy, S.K., Cardiff, R.D., Soriano, P. and Muller, W.J. (1994) Activation of the c-Src tyrosine kinase is required for the induction of mammary tumors in transgenic mice. Genes Dev., 8, 23-32. MEDLINE Abstract

9. Guy, C.T., Webster, M.A., Schaller, M., Parsons, T.J., Cardiff, R.D. and Muller, W.J. (1992) Expression of the c-neu proto-oncogene in the mammary epithelium of transgenic mice induces metastatic disease. Proc. Natl Acad. Sci. USA, 89, 10578-10582. MEDLINE Abstract

10. Levay, Y.B., Imagawa, W., Wallace, D.R. and Nandi, S. (1989) Basic fibroblast growth factor stimulates the growth and inhibits casein accumulation in mouse mammary epithelial cells in vitro. Mol. Cell. Endocrinol., 62, 327-336. MEDLINE Abstract

11. Peters, G., Brookes, S., Smith, R. and Dickson, C. (1983) Tumorigenesis by mouse mammary tumor virus: evidence for a common region for provirus integration in mammary tumors. Cell, 33, 369-377. MEDLINE Abstract

12. Walker, R.A. and Varley, J.M. (1993) The molecular pathology of human breast cancer. In Lemoine, N.R. and Wright, N.A. (eds), The Molecular Pathology of Cancer. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 31-57.

13. Wen, D., Peles, E., Cupples, R., Suggs, S.V., Bacus, S.S., Luo, Y., Trail, G., Hu, S., Silbiger, S.M., Levy, R.B., Koski, R.A., Lu, H.S. and Yarden, Y. (1992) Neu differentiation factor: a transmembrane glycoprotein containing an EGF domain and an immunoglobulin homology unit. Cell, 69, 559-572. MEDLINE Abstract

14. Slamon, D.J., Clark, G.M. and Wong, S.G. (1987) Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science, 235, 177-182. MEDLINE Abstract

15. Slamon, D.J., Godolphin, W., Jones, L.A., Holt, J.A., Wong, S.G., Keith, D.E., Levin, W.J., Stuart, S.G., Udove, J., Ullrich, A. et al). (1989) Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science, 244, 707-712. MEDLINE Abstract

16. Slamon, D.J. (1990) Studies of the HER-2/neu proto-oncogene in human breast cancer. Cancer Invest., 8, 253. MEDLINE Abstract

17. Klijn, J., Berns, E. and Foekens, J. (1993) Prognostic factors and response to therapy in breast cancer. In Fentiman, I. and Taylor-Papadimitriou, J. (eds), Breast Cancer. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 165-198.

18. Wilks, A.F. (1989) Two putative protein-tyrosine kinases identified by application of the polymerase chain reaction. Proc. Natl Acad. Sci. USA, 86, 1603-1607. MEDLINE Abstract

19. Wilks, A.F., Kurban, R.R., Hovens, C.M. and Ralph, S.J. (1989) The application of the polymerase chain reaction to cloning members of the protein tyrosine kinase family. Gene, 85, 67-74. MEDLINE Abstract

20. Hanks, S.K., Quinn, A.M. and Hunter, T. (1988) The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science, 241, 42-52. MEDLINE Abstract

21. Kozak, M. (1987) An analysis of 5[prime]-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res., 15, 8125-8132. MEDLINE Abstract

22. Kozak, M. (1991) An analysis of vertebrate mRNA sequences: intimations of translational control. J. Cell Biol., 115, 887-903. MEDLINE Abstract

23. Hanks, S. and Quinn, A. (1991) Protein kinase catalytic domain sequence database: identification of conserved features of primary structure and classification of family members. Methods Enzymol., 200, 38-79. MEDLINE Abstract

24. Bonham-Smith, P.C. (1997) Molecular cloning of the cDNA for a C-terminal-truncated serine/threonine protein kinase from Arabidopsis thaliana. Plant Physiol., 114, 748.

25. Hunter, T. and Plowman, G. (1997) The protein kinases of budding yeast: six score and more. Trends Biochem. Sci., 22, 18-22. MEDLINE Abstract

26. Copeland, N.G. and Jenkins, N.A. (1991) Development and applications of a molecular genetic linkage map of the mouse genome. Trends Genet., 7, 113-118. MEDLINE Abstract

27. Wang, X.-Y., Smith, D.I., Frederick, L. and James, C.D. (1998) Analysis of EGF receptor amplicons reveals amplfication of multiple expressed sequences. Oncogene, 16, 191-195. MEDLINE Abstract

28. Marquis, S.T., Rajan, J.V., Wynshaw-Boris, A., Xu, J., Yin, G.-Y., Abel, K.J., Weber, B.L. and Chodosh, L.A. (1995) The developmental pattern of Brca1 expression implies a role in differentiation of the breast and other tissues. Nature Genet., 11, 17-26. MEDLINE Abstract

29. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry, 18, 5294-5299. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +1 215 898 1321; Fax: +1 215 573 8590; Email: chodosh@mail.med.upenn.edu

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 13 Nov 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
A. O. Gramolini, M. G. Trivieri, G. Y. Oudit, T. Kislinger, W. Li, M. M. Patel, A. Emili, E. G. Kranias, P. H. Backx, and D. H. MacLennan
Cardiac-specific overexpression of sarcolipin in phospholamban null mice impairs myocyte function that is restored by phosphorylation
PNAS, February 14, 2006; 103(7): 2446 - 2451.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. M. Ligos, T. L. de Lera, S. Hinderlich, B. Guinea, L. Sanchez, R. Roca, A. Valencia, and A. Bernad
Functional Interaction between the Ser/Thr Kinase PKL12 and N-Acetylglucosamine Kinase, a Prominent Enzyme Implicated in the Salvage Pathway for GlcNAc Recycling
J. Biol. Chem., February 15, 2002; 277(8): 6333 - 6343.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
H. P. Gardner, S. I. Ha, C. Reynolds, and L. A. Chodosh
The CaM Kinase, Pnck, Is Spatially and Temporally Regulated during Murine Mammary Gland Development and May Identify an Epithelial Cell Subtype Involved in Breast Cancer
Cancer Res., October 1, 2000; 60(19): 5571 - 5577.
[Abstract] [Full Text]

Home page
 DevelopmentHome page
H. Gardner, G. Belka, G. Wertheim, J. Hartman, S. Ha, P. Gimotty, S. Marquis, and L. Chodosh
Developmental role of the SNF1-related kinase Hunk in pregnancy-induced changes in the mammary gland
Development, January 10, 2000; 127(20): 4493 - 4509.
[Abstract] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Stairs, D. B.
Right arrow Articles by Chodosh, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stairs, D. B.
Right arrow Articles by Chodosh, L. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?