Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (77)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Thai, T. H.
Right arrow Articles by Bowcock, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thai, T. H.
Right arrow Articles by Bowcock, A. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular GeneticsPages 195-202


Mutations in the BRCA1-associated RING domain (BARD1) gene in primary breast, ovarian and uterine cancers
Introduction
Results
   Genomic structure of BARD1
   BARD1 mutation screening
   BARD1 polymorphisms
   A germline BARD1 alteration
   Somatic BARD1 alterations
Discussion
Materials And Methods
   Clinical specimens
   Genomic structure of BARD1
   Mutational screening for BARD1 alterations
   SSCP analysis
   DNA sequencing of SSCP variants
   Cloning of BARD1 PCR products for sequence analysis
   PCR/ASO analysis of mutant alleles
   FISH mapping of BARD1
Acknowledgements
References

Footnote

Mutations in the BRCA1-associated RING domain (BARD1) gene in primary breast, ovarian and uterine cancers

Mutations in the BRCA1-associated RING domain (BARD1) gene in primary breast, ovarian and uterine cancers To Hoa Thai1, Fenghe Du1, Julia Tsou Tsan2, Ying Jin2, Anne Phung1, Monique A. Spillman1, Hillary F. Massa5, Carolyn Y. Muller3, Raheela Ashfaq4, J. Michael Mathis3, David S. Miller3, Barbara J. Trask5, Richard Baer2 and Anne M. Bowcock1,*

1Department of Pediatrics and the McDermott Center for Human Growth and Development, 2Department of Microbiology, 3Department of Obstetrics and Gynecology and 4Department of Pathology, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75235, USA and 5Department of Molecular Biotechnology, University of Washington, Box 357730, Seattle, WA 98915, USA

Received August 12, 1997; Revised and Accepted November 12, 1997

DDBJ/EMBL/GenBank accession nos AF038034-AF038042

Germline alterations of BRCA1 result in susceptibility to breast and ovarian cancer. The protein encoded by BRCA1 interacts in vivo with the BRCA1-associated RING domain (BARD1) protein. Accordingly, BARD1 is likely to be a critical factor in BRCA1-mediated tumor suppression and may also serve as a target for tumorigenic lesions in some human cancers. We have now determined the genomic structure of BARD1 and performed a mutational analysis of 58 ovarian tumors, 50 breast tumors and 60 uterine tumors. Seven polymorphisms were detected within the 2.34 kb coding sequence of BARD1. Somatically acquired missense mutations were observed in one breast carcinoma and one endometrial tumor; in at least one of these cases, tumor formation was accompanied by loss of the wild-type BARD1 allele, following the paradigm for known tumor suppressor genes. In addition, a germline alteration of BARD1 was identified in a clear cell ovarian tumor (Gln564His); again, loss of the wild-type BARD1 allele was observed in the malignant cells of this patient. The Gln564His patient was also diagnosed with two other primary cancers: a synchronous lobular breast carcinoma and a stage IA clear cell endometrioid cancer confined to an endometrial polyp 6 years earlier. These findings suggest an occasional role for BARD1 mutations in the development of sporadic and hereditary tumors.

INTRODUCTION

Alterations in the BRCA1 gene (1,2) account for 40-50% of early onset familial breast cancer cases and >75% of cases of familial breast/ovarian cancer (3,4). In families with germline BRCA1 alterations, tumor formation requires loss or alteration of the wild-type allele (5), in keeping with the hypothesis that BRCA1 has tumor suppressor function.

BRCA1 encodes a large polypeptide of 1863 amino acids that contains an amino-terminal RING domain and two carboxy-terminal BRCT domains (2,6). Although the functions of these amino acid motifs are not precisely determined, the RING and BRCT domains of BRCA1 are well conserved phylogenetically and serve as common sites for missense mutations that predispose women to early-onset breast cancer. Therefore, these domains appear to be critical for tumor suppression by BRCA1.

We recently described an interaction between BRCA1 and a protein termed BARD1 (the BRCA1-associated RING-domain protein) (7). BARD1 is structurally related to BRCA1 in that it harbors an amino-terminal RING domain and two carboxy-terminal BRCT motifs. Studies of their subcellular distributions have shown that both proteins co-localize to discrete nuclear structures at defined stages of cell cycle progression (8,9). The in vivo association between BRCA1 and BARD1 is mediated by sequences within their respective RING domains. The fact that disease-related missense mutations within the RING motif of BRCA1 ablate the BRCA1-BARD1 interaction suggests that this protein complex mediates the tumor suppression function ascribed to BRCA1 (7).

If the BRCA1-BARD1 complex is indeed essential for tumor suppressor activity, then it is reasonable to ask if alterations of BARD1 are also involved in oncogenesis. Therefore, we determined the genomic structure of BARD1 and confirmed its localization by fluorescence in situ hybridization (FISH) to 2q34-q35, a region that is not frequently altered in breast or ovarian tumors. We also screened a panel of human tumors for genetic alterations of BARD1. Of these, 1/58 ovarian tumors, 1/50 breast tumors and 1/60 uterine tumors harbored different missense alterations, each of which lies within or close to the BRCT domains of BARD1. The wild-type allele of BARD1 was clearly absent in both the ovarian and uterine tumors, implying that loss of BARD1 function may contribute to oncogenesis. Although the BARD1 mutations in the breast and uterine tumors (Val695Leu and Ser761Asn) were acquired somatically, the ovarian tumor mutation (Gln564His) was of germline derivation. This patient had also developed independent primary cancers of the breast and endometrium. Thus, although further studies are needed, these data imply that loss of BARD1 function may be a contributing factor in the formation of some sporadic and hereditary tumors.

RESULTS

Genomic structure of BARD1

To obtain the genomic DNA encoding BARD1, bacteriophage [lambda] and BAC (bacterial artificial chromosome) libraries of human genomic DNA were screened by hybridization with fragments of BARD1 cDNA (7). Eleven hybridizing [lambda] clones and two hybridizing BAC clones were subjected to nucleotide sequence analysis with oligonucleotide primers derived from the BARD1 cDNA sequence. This analysis revealed that the BARD1-coding sequences are derived from 11 exons distributed over at least 65 kb of genomic DNA [GenBank accession nos AF038034 (exon I), AF038035 (exons II and III), AF038036 (exon IV), AF038037 (exon V), AF038038 (exon VI), AF038039 (exon VII), AF038040 (exon VIII), AF038041 (exon IX) and AF038042 (exon X)]. The chromosomal origin of BARD1 was then established by FISH of normal human metaphase chromosomes with plasmid subclones containing BARD1 genomic sequences. FISH analysis localized BARD1 to bands 2q34-35, consistent with the BARD1 mapping data obtained previously with the Genebridge panel of whole genome radiation hybrid DNAs (7).

BARD1 mutation screening

The primer sets that were used to amplify the 11 coding exons of BARD1 from cDNA or genomic DNA templates are presented in Table 1.

Table 1. PCR primers for the amplification of BARD1 sequences from cDNA or genomic DNA template
Exon Forward primer (5' -> 3') Reverse primer (5' -> 3') PCR product
size (bp)
Template Annealing
temp (°C)
I R135S: CCGAGGAGCCTTTCATCCGA R135AS: CGAGCGCGGCGCGACTGT 154 cDNA/genomic 59
I-III B202-Z1S: ATGGAACCGGATGGTCGCGGT B202-ZAS: TCTTCAAGTCTTGTATCCAGGC 213 cDNA 59
III-IV B202-A: GCCTGGATACAAGACTTGAAG B202-N:AACATCTGCAGGAGGACTTGG 306 cDNA 57
IV B202-B: AAAGCTTCAGTGCAAACCCA B202-BAS: TCCAGATCTTGCAGAAGCC 132 cDNA 53
IV B202-X: CAGATGTTTCTGAGAGGGCT B202-XAS: ATTCCTCTTTGGAGTCAAATTC 138 cDNA/genomic 55
IV B230-A: GAGGCAGAAAAAGAAGATGGT B230-AS: AGGAGCCACTTGCTAGTAAG 136 cDNA/genomic 55
IV B202-Y: ATGGTGAAATAGACTTACTAGC B202-YAS: GCAGACCTTCTCAGGAGTC 149 cDNA/genomic 55
IV B230-B: AAGAGCAGGAATGAAGTAGTG B230-BAS: CTCCACTGGTGCTCAGAATG 163 cDNA/genomic 55
IV B230-C: AGTGGAGATTTTGTTAAGCAA B230-CAS: AGGTGGTGTACCTGGTGAA 159 cDNA/genomic 51
IV B230-D: GGTACACCACCTTCTACATT B230-DAS: GTCTCTCCTCTATGATTTCTT 113 cDNA 53
IV-V B230-PS: CAATGAAGCTGTTGCCCAA B230-P: GTCTTTAACATTTGGATCACT 137 cDNA 51
V-VI B230-E: AGTGATCCAAATGTTAAAGAC B230-EAS: CCCATTCTTGGCTGCATC 162 cDNA 51
VI-VII B230-F: CAAAATGACTCACCACTTCAC B230-FAS: ATCGACAGGCCGCAGACC 120 cDNA 55
VII-IX B230-FF: CCTGTCGATTATACAGATGAT B230-FFAS: AACATGAGTTACTGTACTGTC 234 cDNA 57
VIII-X B230-WS: TATACTGAGTTTGACAGTACAG B230-WAS: CATACTTTTCTTCGTAGACATG 146 cDNA 55
X-XI B230-G: TGGGTAAAAGCATGTCTACGA B230-R: GTAGCATCCATCAAACAGCTT 126 cDNA 55
XI B230-H: GGATGCTACTTCTATTTGTG B230-HAS: GAGTCACGTCACTGTCTG 124 cDNA 51
XI B230-TS: CCTCAGTAGAAAGCCCAAGC B230-TAS: GCCCTGCCGAACCCTCTC 154 cDNA 57
XI B230-US: GAGAGGGTTCGGCAGGGC B230-UAS: TTCAATTTGAAATGTTCATCTGGT 124 cDNA/genomic 57
I R1352S: ACAGTCGCGCCGCGCTCGA R13AAS: CAGAAACTGTGCGACCCGTG 107 genomic 59
II R12AS: AGATGTTTATCTAACAATGACTC R12BAS: AGTTGTACTATATACATCAAACC 146 genomic 55
III R13BS: ATTCTGCTGAATGGGTTGCTT R13CAS: TAACTAAGAGAGATAGGGATAG 226 genomic 55
IV R5C5: GGAGCTCCATGTGGGAGCAA B202-N: AACATCTGCAGGAGGACTTGG 270 genomic 59
IV B230-D: GGTACACCACCTTCTACATT R5DAS: TCTGAGATGGTATTTCAGAGT 170 genomic 53
V R34DS: TGCTTTTTAATTTCCATTTTGTTC R34FAS: AAGAACTGTAAAACACAGAAAGA 163 genomic 55
VI R34FS: TGCTCTTTCTTATCACTTCTTTC R34GAS: CTTGACTCAAGAATATAGGTCC 278 genomic 57
VII FFGS2: TTGAGTCGAGTCACACATTTGA B2305FGAS: CTATTATGTTCCTTTCATAACCA 233 genomic 55
VIII 3FGR: TAATGTCTTTGTCTAGTCGTCTAA WSGAS: GGTAGTTCTCCAAAAGGATCA 264 genomic 55
VIII 3FGR: TAATGTCTTTGTCTAGTCGTCTAA 3F: TTCTGAAGACAGCCCACTGC 123 genomic 55
IX B230IXS: GAGTTATAAGAAGCAGGCCAA B230IXAS: ATTTCTTAATTCTCTCAAATCCAA 199 genomic 55
X R36H5: TAGTGCTCACTTGATACTTAGT R36EAS: CATAATAAGAACAATGAAAGTTGT 187 genomic 55
XI R36E5: TTGATCTGCCTTTAACAAATG B230-TAS: GCCCTGCCGAACCCTCTC 296 genomic 57

Table 2. BARD1 polymorphisms
Altered BARD1 nucleotide Amino acid change Population Allele Frequency No. chromosomes screened
C143T Pro24Ser Caucasian Pro 0.59 22
      Ser 0.41  
    African Pro 0.82 22
      Ser 0.18  
A530G Lys153Glu   Lys n.d. n.d.
      Glu n.d.  
C1121G Silent (Thr351)   C n.d. n.d.
      G n.d.  
1140-1160 (Deletion of CCATTGCCTG- AATGTTCTTCA) 1139del21 (del aa 358-364: PLPECSS) Caucasian WT 0.99 216
      1139del21 0.01  
    African WT 0.88 32
      1139del21 0.12  
A1592G Val507Met   Met n.d. n.d.
      Val n.d.  
G1765C Cys557Ser Caucasian Cys 0.98 80
      Ser 0.02  
C2045T Arg658Cys Caucasian Arg 0.98 138
      Cys 0.02  
    African Arg 1.00 42
      Cys 0  
The BARD1 nucleotide positions are based on the GenBank accession no. U76638.
n.d. not determined.

Table 3. BARD1 alterations in breast/ovarian/uterine tumors
Sample
(age)
Tumor type Codon
change
Nucleotide
change
Effect Loss of wild-
type allele
Germline
or somatic
ov61 (73 years) Ovarian clear cell adenocarcinoma (Stage 3A) CAG -> CAC G1765C Gln564His Yes Germline
ut8 (50 years) Malignant mixed mulleriantumor (Stage 4B) AGC -> AAC G2354A Ser761Asn Yes Somatic
BC64 Intraductal adenocarcinoma of the breast GTC -> CTC G2156C Val695Leu Nonedetectable Somatic
The mutation positions are based on the GenBank entry of BARD1 (accession no. U76638).

We used single-stranded conformational polymorphism (SSCP) analysis (10) to screen genomic DNAs or cDNAs from 50 breast tumors, 58 ovarian tumors, 60 uterine cancers (primarily endometrial), six breast cancer lines and six ovarian cancer lines for genetic alterations in BARD1. Variant bands were excised from the SSCP gel, subjected to a second round of amplification and DNA sequenced.


Figure 1. Schematic diagram of the BARD1 cDNA. The RING domain, ankyrin repeats, BRCT sequences and 5' and 3' untranslated regions are shaded as indicated. The locations of splice sites according to the nucleotide sequence of the gene (GenBank accession no. U76638) are indicated above the diagram. Mutations (italics) and polymorphisms (plain text) are indicated below the cDNA diagram. Designations of amino acid changes are according to the nomenclature proposed by Beaudet and Tsui (1993) (35).

BARD1 polymorphisms

The BARD1 polypeptide is comprised of 777 amino acids and includes an amino-terminal RING domain (residues 46-90), three tandem ankyrin repeats (residues 427-525) and two carboxy-terminal BRCT motifs (residues 605-777) (see Fig. 1). Seven polymorphisms were detected within the 2.34 kb of BARD1-coding sequence (Table 2 and Fig. 1). One of these is an in-frame deletion of seven amino acids between its RING domain and the ankyrin repeats (residues 358-364). This deletion was seen in 1% of Caucasian and 7% of unrelated African chromosomes. Given the low frequency of this allele in Caucasians, it was surprising to find that both the MCF7 breast cancer cell line and the PEO4 ovarian cancer cell line harbored this deletion since they were both derived from Caucasian patients (11,12). However, gene deletions do not necessarily account for disease or cancer susceptibility. For example, a polymorphic stop codon within the 3' end of the coding sequence of BRCA2 results in loss of the 93 most terminal amino acids (Lys3326ter) with as yet no described deleterious effect (13).

A germline BARD1 alteration

When 58 ovarian tumors were analyzed with SSCP, one (ov61) was found to harbor a missense mutation within BARD1 that resulted in a glutamine to histidine (CAG -> CAC; Gln564His) change. This alteration falls between the ankyrin repeats and the BRCT domains of BARD1 (Figs 1 and 2, Table 3). The patient with this tumor was a woman of African-American origin who was diagnosed at age 73 with a clear cell adenocarcinoma of the ovary (stage 3A) and a synchronous infiltrating lobular carcinoma of the breast. SSCP analysis of RT-PCR products indicated that only the mutant transcript was present in the ovarian tumor mRNA from this individual, indicating that the wild-type transcript was either expressed at undetectable levels or was completely absent (Fig. 2).

To examine the BARD1 status in ov61 further, RT-PCR products from the tumor were cloned and sequenced and the fraction of clones with wild-type versus mutant sequence was determined. When 10 subclones were sequenced, all were found to harbor the mutant allele, indicating that the mRNA derived from the wild-type allele was truly absent in the ovarian tumor. When corresponding germline DNA from benign uterine tissue was cloned and sequenced, 4/9 clones harbored the mutant allele and 5/9 clones harbored the wild-type allele, indicating that the alteration in the tumor was of germline origin.

At the time of hysterectomy 6 years earlier, this patient had been diagnosed with an incidental stage IA endometrial clear cell tumor. It is likely that the tumors of the endometrium and ovary were independent primaries since the initial endometrial tumor was a small focus of carcinoma confined to an endometrial polyp.

We used SSCP analysis to examine genomic DNA extracted from paraffin-embedded tissue obtained from the three primary tumors from this patient as well as from benign uterine tissue (Fig. 3). This revealed the variant allele in all samples, including normal uterine tissue, again confirming that this alteration was of germline origin. Moreover, the wild-type allele of BARD1 was reduced in the genomic DNA of the ovarian tumor, explaining the loss of wild-type BARD1 transcripts. We detected both the wild-type and mutant alleles in genomic DNA of both the endometrial and breast cancers; however, a large proportion of the paraffin sections was normal tissue, so that it was not possible to determine if the wild-type allele had been lost in these tumors. Further histological examination indicated that a significant proportion of normal tissue had infiltrated these tumor specimens rendering microdissection of tumor tissue from these samples impossible.


Figure 2. (a) SSCP analysis of cDNA from 12 ovarian tumors after amplification of template cDNA with primers B230-FF and B230-FFAS. The tumor in lane 1 was derived from patient ov61. In this sample, no wild-type allele can be seen. The tumor in lane 12 is heterozygous for the Ser(557)Cys polymorphism. Tumors in lanes 2-11 did not exhibit any alteration in this region. The lower two bands represent non-denatured strands. (b) Sequence analysis of PCR products of SSCP fragments from a1 (patient ov61) (left sequence) and corresponding normal cDNA sequence obtained from variant SSCP fragments in lane a12 (right sequence). Primer B230-FF was used for sequencing. The amino acid sequence is indicated to the right of the DNA sequence. A one-base substitution (C -> G) (Gln564His) was seen in tumor DNA from patient ov61 (the altered base and amino acid are both indicated with an asterisk. The location of the polymorphic change from Ser to Cys (G -> C) is indicated.


Figure 3. SSCP analysis of genomic DNA obtained from paraffin sections of tumors from patient ov61. PCR products for SSCP were obtained with primers 3F/3FGR (Table 1) that flanked the Gln564His change in exon VIII that is seen in this individual. C1, C2: control samples; BN: benign uterus; EN: endometrial tumor; BR: breast tumor; OV: ovarian tumor. A novel SSCP band is seen in all samples from the patient that is not seen in the control samples. The upper wild-type allele is decreased in intensity in the ovarian tumor. This decrease is not seen in the DNA from the endometrial and breast tumor sections that have a substantial amount of contamination of normal tissue.

The Gln564His missense alteration was not seen in >300 individuals examined (>600 chromosomes), suggesting that this alteration is not a polymorphism. Since the patient was African-American we also screened an additional 30 African individuals (60 chromosomes) for this variant and did not see it, indicating that this change is unlikely to be a polymorphism exclusive to the African population. In light of the known interaction of BARD1 with BRCA1 and the observed loss of the wild-type BARD1 allele in the ovarian tumor, it is tempting to speculate that the germline Gln564His alteration resulted in predisposition to endometrial, breast and ovarian cancer in this patient.

Somatic BARD1 alterations

The diagnosis of endometrial cancer in the patient with the Gln564His mutation prompted us to examine an additional 60 uterine cancers for genetic alterations in BARD1. One additional endometrial tumor (ut8) was identified with a novel BARD1 alteration in a patient of European origin who had been diagnosed at age 50 with a stage 4B malignant mixed mullerian tumor (carcinosarcoma) (Table 3). This alteration, a Ser761Asn change in the second BRCT domain, was not seen in >600 other Caucasian chromosomes by allele-specific oligonucleotide (ASO)/dot-blot analysis. Direct sequencing of genomic DNA derived from this tumor only revealed the mutant allele, indicating that the wild-type allele had again been lost. Microdissection of normal DNA from archival sections of this tumor followed by direct sequencing revealed only a wild-type allele indicating that the alteration was somatic in origin.

Finally, a breast tumor (BC64) obtained from a 60-year-old woman, and diagnosed as an invasive ductal carcinoma, was found to harbor a BARD1 alteration (Val695Leu) in one of the BRCT domains. The Val695Leu substitution was not seen in the germline DNA of the patient (Table 3) or in >600 chromosomes, indicating that it arose somatically upon malignant transformation. It was not possible to determine whether the wild-type allele had been lost in the malignant cells of this patient since genomic DNA from microdissected tumor cells was not available.

DISCUSSION

The genomic structure of BARD1 and amplimers described here will enable mutational analysis of this gene in a variety of human tumors and cancer patients. FISH analysis confirms the localization of BARD1 to chromosome 2q, and sub-localizes it to within 2q34-35, a region not shown to be altered frequently in neoplasia.

Screening a panel of primary breast (n = 50), ovarian (n = 58) and uterine (n = 60) tumors revealed three distinct missense alterations in the BARD1-coding sequence. One of these was a clear cell ovarian tumor that harbored a Gln564His mutation of germline origin. Notably, the wild-type allele of BARD1 had been lost from the malignant ovarian cells, but not normal cells, of this patient. The patient was 73 years of age and had developed three independent primary tumors: the aforementioned clear cell ovarian carcinoma, a synchronous lobular breast carcinoma and, 6 years earlier, a clear cell endometrial cancer. Unfortunately, it was not possible to obtain a family history on this patient to determine if other carriers of Gln564His had also developed cancer. Insufficient material was available to rule out conclusively the presence of a germline BRCA1 alteration in this patient. The Gln564Arg alteration is of unknown significance, and it is conceivable that the loss of the wild-type allele in the ovarian tumor was driven by a mutation in a neighboring gene. However, it is of interest that this residue, along with flanking amino acids, is conserved in the mouse ortholog of BARD1 (NTGQR in both species; unpublished data).

The diagnosis of endometrial cancer in this patient 6 years earlier was intriguing and prompted us to investigate the frequency of BARD1 alterations in an additional 60 uterine tumors. This resulted in the identification of a somatic BARD1 alteration (Ser761Asn) in a malignant mixed mullerian tumor (Ut8). Again, the wild-type allele of BARD1 was clearly missing from this tumor. Moreover, the altered residue (Ser761) lies within the 30 amino acid core of the second BRCT domain, adjacent to an invariant tryptophan that is characteristic of the BRCT motif (6,14,15). Finally, a somatic alteration (Val695Leu) was detected in a breast tumor. This change also lies within the region containing the BARD1 BRCT domains.

The three alterations that we describe lie within, or close to, the two tandem BRCT domains of BARD1. While the functions of the BRCT motif are not known, the corresponding region of BRCA1 has been shown to have transactivational potential (16,17). BRCT domains are often found in proteins that function in the cell cycle checkpoints induced by DNA damage, including RAD9, XRCC1 and RAD4 (6,14,15). This, together with the findings that BRCA1 associates with RAD51 (18) and that BRCA1, BARD1 and RAD51 co-localize to nuclear dots in S phase but not in G1 (8,9), suggest that these proteins may be involved in cell cycle checkpoint control in response to DNA damage.

BARD1 is altered in only a small percentage of sporadic breast and ovarian tumors and, in this respect, is similar to BRCA1 and BRCA2. In the case of BRCA1, no genetic alterations have been detected in sporadic breast tumors; however, 10% of ovarian tumors harbor somatic BRCA1 mutations that result in protein truncations. In these tumors there is also loss of the wild type allele (19,20). In the case of BRCA2, four independent studies collectively identified two sporadic missense alterations and one truncating mutation in 281 primary breast cancers and two somatic alterations in 185 ovarian carcinomas (21-26).

The role of BARD1 in the development of uterine cancer is intriguing. BRCA1 alterations have not been described in this type of tumor, although some BRCA1 linked families occasionally have members with a linked BRCA1 mutant haplotype and endometrial cancer [e.g. family 4, (27)]. An analysis of patient ov61 suggests that germline mutations of BARD1 may confer a predisposition to certain neoplastic conditions and that studies of BARD1 mutations in familial cases of breast, ovarian, or uterine carcinoma may be warranted, particularly in those patients that develop synchronous or metachronous tumors of endometrial, breast or ovarian tissues.

MATERIALS AND METHODS

Clinical specimens

Tumor tissue, matched normal tissue and blood specimens were obtained as part of protocols approved by the University of Texas Southwestern Medical Center Human Subjects Review Board, St Paul's Medical Center of Dallas, Medical City of Dallas and The Southern division of the Co-operative Human Tissue network. The breast cancers were primarily infiltrating ductal carcinomas. The ovarian carcinomas were of mixed histology although the majority were papillary serous carcinomas. Of the 60 uterine cancers, 44 were endometrial, 11 were mixed mullerian tumors and five were sarcomas. The following breast and ovarian cancer cell lines were obtained from the American Type Culture Collection: MCF-7, ZR75-1, BT-483, BT-20, T-47D, BT-474, OVCAR3, CAOV-3. BG-1 was kindly provided by Dr E.J. Modest, Boston University, and 2008 and 2774 have been described elsewhere (28,29). The ovarian cancer line PE04 was obtained from Dr Simon Langdon (Medical Oncology Unit, Western General Hospital, Edinburgh, Scotland). Tumors were frozen immediately in liquid nitrogen and stored at -70°C prior to RNA extraction. Buffy coat was prepared from blood. In some cases, DNA was prepared from paraffin-embedded tissue. RNA and cDNA were prepared by standard procedures.

Genomic structure of BARD1

A human genomic library cloned into bacteriophage [lambda] was first screened by hybridization with fragments of BARD1 cDNA (7). Eleven hybridizing [lambda] clones were identified and subjected to nucleotide sequence analysis with oligonucleotide primers derived from the BARD1 cDNA sequence.

This identified exon-intron boundaries for all exons except for VII, VIII and IX. To obtain genomic sequence of this region, three BACs were identified by hybridization with B230EX-1.3, a probe comprised of BARD1 cDNA residues 1229-2530 (accession no. U76638) (Research Genetics). DNA was prepared by standard methods. The same primers were used to sequence two of these BAC DNAs generating exon-intron boundary sequences for this region.

Mutational screening for BARD1 alterations

SSCP was performed as described elsewhere (10) with oligonucleotide primers for BARD1 with cDNA or genomic DNA as shown in Table 1. cDNA was derived from tumor, matched normal tissue or cell lines. Genomic DNA was obtained from tumor tissue, matched normal tissue, cell lines, blood and paraffin-embedded tissue.

SSCP analysis

PCR of tumor or blood DNA/cDNA was performed in 20 µl volumes containing 100 ng of cDNA or genomic DNA template; 1* PCR buffer (Perkin Elmer); 200 µM each dATP, dGTP, dCTP and dTTP; 10 pmol each primer (Gibco BRL); 0.3 µCi of [32P]dCTP (Amersham); and 0.5 U of Taq DNA polymerase (Perkin Elmer). PCR conditions were 30 cycles of 94°C, 30s; 55°C (or as specified for annealing temperatures in Table 1), 30s; 72°C, 30s. A final extension reaction at 72°C was performed for 1 min. Amplified samples were diluted 1:10 in formamide buffer (98% formamide, 10 mM EDTA, pH 8.0, 0.05% bromophenol blue, 0.05% xylene cyanol), denatured at 95°C for 5 min then cooled rapidly to 4°C. For each sample, 4 µl was loaded onto an SSCP gel and run at 8 W (constant power) for 8-16 h in 0.6* TBE at room temperature. Gels contained 0.5* MDE (AT Biochem), 0.6* TBE, 240 µl of 10% ammonium persulfate and 24 µl of TEMED. Duplicate gels were prepared with a supplement of 10% glycerol. Gels were subjected to autoradiography with or without being dried. Film was exposed for 12-24 h with an intensifying screen.

DNA sequencing of SSCP variants

Variant bands were excised from the gel after alignment with the autoradiograph and purified with Qiaquick Gel Extraction kit (Cat #28706). DNA was resuspended in 20 µl of H2O and 5 µl was treated with 10 U of exonuclease I (manufacturer) and 2 U of shrimp alkaline phosphatase (manufacturer) at 37°C for 15 min. Following inactivation of this reaction with heat (80°C for 15 min), the DNA template was subjected to cycle sequencing with Thermosequenase (Amersham Life Science) and [[alpha]-33P]ddNTPs. Sequencing reactions were electrophoresed in 8% acrylamide/bis gels with 1* glycerol tolerant gel buffer at 70 W constant power for 2 h. Gels were dried and subjected to autoradiography.

Cloning of BARD1 PCR products for sequence analysis

Products obtained following PCR amplification were cloned directly into the TA-cloning vector pCR 2.1 (Invitrogen Cat #K2000-01). Cloning and transformation were performed according to the manufacturer's instructions. Colonies with inserts of the correct size were identified by direct amplification of the colony DNA in a PCR reaction with vector-specific primers (M13 forward/M13 reverse). In general, 70% of the colonies had inserts of the correct size; 30% of the colonies had no detectable insert. DNA was prepared from colonies with correct insert sizes according to standard procedures (30) and subjected to DNA sequencing with the M13 forward oligonucleotide primer and ABI DNA sequencing kit (Cat #402112). Sequencing reactions were analyzed with an ABI377.

PCR/ASO analysis of mutant alleles

PCR products were applied to replica Hybond filters as described elsewhere (31), except that instead of UV cross-linking, filters were baked for 2 h at 80°C.

Prehybridization and hybridization was performed as described elsewhere (32). The filters were subjected to a final wash in the Me4NCL solution for 2×20 min at 60°C.

To discriminate between the Ser761 and Asn761 alleles, PCR products were obtained with the US and UAS primers, and hybridized with the following ASOs: Asn761, GCTCCTTCGAACTGGTTTATA; Ser761, GCTCCTTCGAGCTGGTTTATA.

To obtain allele frequencies for the Arg658Cys polymorphism, PCR products obtained with R36H5/R36EAS primers were hybridized with: Cys658, TGAAGGTCCATGCAGAAGCAG; and Arg658, TGAAGGTCCACGCAGAAGCAG.

FISH mapping of BARD1

The cytogenetic location of BARD1 was obtained through FISH of normal human metaphase chromosome spreads with pooled DNA from three plasmid subclones in puc12 of [lambda] clones with inserts of 14, 16 and 13 kbp, representing 5', middle and 3' parts of the gene (R13S-14, R16S-16 and R36S-13) and containing a total of 43 kb of human sequence. Plasmid DNA was labeled with biotin by nick translation and subjected to FISH analysis as described elsewhere (33,34).

ACKNOWLEDGEMENTS

Drs Luca Cavalli-Sforza (Stanford University), Michele Ramsay and Trefor Jenkins (University of the Witwatersrand, South Africa) kindly provided DNA from Africans. Drs Wayne Taylor (Medical City of Dallas) and Jerry Shay (UT Southwestern Medical Center Tissue repository) provided breast tumor samples. Dr Michael Lovett provided thoughtful comments on the manuscript. We are indebted to Dr Vernie Stembridge for valuable support and advice. This work was supported in part by grants CA60650 (A.M.B) and CA76334 (R.B.) from the National Cancer Institute (NCI) and DE-FG03-96ER62173 (BT) from the US Department of energy. M.A.S. was supported in part by a grant from the Perot Family Foundation. Y.J. was supported in part by NCI training grant T32-CA09082.

REFERENCES

1. Hall, J.M., Lee, M.K., Newman, B., Morrow, J.E., Anderson, L.A., Huey, B. and King, M.-C. (1990) Linkage of early-onset familial breast cancer to chromosome 17q21. Science, 250, 1684-1689. MEDLINE Abstract

2. Miki, Y., Swensen, J., Shattuck Eidens, D., Futreal, P.A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L.M., Ding, W., Bell, R., Rosenthal, J., Hussey, C., Tran, T., McClure, M., Frye, C., Hattier, T., Phelps, R., Haugen-Strano, A., Katcher, H., Yakumo, K., Gholami, Z., Shaffer, D., Stone, S., Bayer, S., Wray, C., Bogden, R., Dayananth, P., Ward, J., Tonin, P., Narod, S., Bristow, P.K., Norris, F.H., Helvering, L., Morrison, P., Rosteck, P., Lai, M., Barrett, J.C., Lewis, C., Neuhausen, S., Cannon-Albright, L., Goldgar, D., Wiseman, R., Kamb, A. and Skolnick, M.H. (1994) A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science, 266, 66-71. MEDLINE Abstract

3. Easton, D.F., Bishop, D.T., Ford, D. and Crockford, G.P. (1993) Genetic linkage analysis in familial breast and ovarian cancer: results from 214 families. The Breast Cancer Linkage Consortium. Am. J. Hum. Genet., 52, 678-701. MEDLINE Abstract

4. Ford, D., Easton, D.F. and Peto, J. (1995) Estimates of the gene frequency of BRCA1 and its contribution to breast and ovarian cancer incidence. Am. J. Hum. Genet., 57, 1457-1462. MEDLINE Abstract

5. Smith, S.A., Easton, D.F., Evans, D.G.R. and Ponder, B.A.J. (1992) Allele losses in the region 17q12-21 in familial breast and ovarian cancer involve the wild-type chromosome. Nature Genet., 2, 128-131. MEDLINE Abstract

6. Koonin, E.V., Altschul, S.F. and Bork, P. (1996) BRCA1 protein products: functional motifs. Nature Genet., 13, 266-267. MEDLINE Abstract

7. Wu, L.C., Wang, Z.W., Tsan, J.T., Spillman, M.A., Phung, A., Xu, X.L., Yang, M.-C., Hwang, L.-Y., Bowcock, A.M. and Baer, R. (1996) Identification of a RING protein that can interact in vivo with the BRAC1 gene product. Nature Genet., 14, 430-440. MEDLINE Abstract

8. Jin, Y., Xu, X.L., Yang, M.-C.,W., Wei, F., Ayi, T.C., Bowcock, A.M. and Baer, R. (1997) Cell cycle-dependent colocalization of BARD1 and BRCA1 in discrete nuclear domains. Proc. Natl Acad. Sci. USA, 94, 12075-12080. MEDLINE Abstract

9. Scully, R., Chen, J., Ochs, R.L., Keegan, K., Hoekstra, M., Feunteun, J. and Livingston, D.M. (1997) Dynamic changes of BRCA1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell, 90, 425-435. MEDLINE Abstract

10. Orita, M., Wahana, H., Kanazawa, H., Hayashi, K. and Sekiya, T. (1989) Detection of polymorphisms of human DNA by gel electrophoresis as single-stranded conformation polymorphisms. Proc. Natl Acad. Sci. USA, 86, 2766-2770. MEDLINE Abstract

11. Langdon, S.P., Lawrie, S.S., Hay, F.G., Hawkes, M.M., McDonald, A., Hayward, I.P., Schol, D.J., Hilgers, J., Leonard, R.C. and Smyth, J.F. (1988) Characterization and properties of nine human ovarian adenocarcinoma cell lines. Cancer Res., 48, 6166-6172. MEDLINE Abstract

12. Soule, H.D., Vazquez, J., Long, A., Albert, S. and Brennan, M. (1973) A human cell line from a pleural effusion derived from a breast carcinoma. J. Natl Cancer Inst., 51, 1409-1413. MEDLINE Abstract

13. Mazoyer, S., Dunning, A.M. Serova, O., Dearden, J., Puget, N., Healey, C.S., Gayther, S.A., Mangion, J., Stratton, M.R., Lynch, H.T., Goldgar, D.E., Ponder, B.A. and Lenoir, G.M. (1996) A polymorphic stop codon in BRCA2. Nature Genet., 14, 253-254. MEDLINE Abstract

14. Bork, P., Hofmann, K., Bucher, P., Neuwald, A.F., Altschul, S.F. and Koonin, E.V. (1997) A superfamily of conserved domains in DNA damage-responsive cell cycle checkpoint proteins. FASEB J., 11, 68-76. MEDLINE Abstract

15. Callebaut, I. and Mornon, J.-P. (1997) From BRCA1 to RAP1: a widespread BRCT module closely associated with DNA repair. FEBS Lett., 400, 25-30. MEDLINE Abstract

16. Chapman, M.S. and Verma, I.M. (1996) Transcriptional activation by BRCA1. Nature, 382, 678-679. MEDLINE Abstract

17. Monteiro, A.N.A., August, A. and Hanafusa, H. (1996) Evidence for a transcriptional activation function of BRCA1 C-terminal region. Proc. Natl Acad. Sci. USA, 93, 13595-13599.

18. Scully, R., Chen, J., Plug, A., Xiao, Y., Weaver, D., Feunteun, J., Ashley, T. and Livingston, D.M. (1997) Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell, 88, 265-275. MEDLINE Abstract

19. Merajver, S.D., Pham, T.M., Caduff, R.F., Chen, M., Poy, E.L., Cooney, K.A., Weber, B.L., Collins, F.S., Johnston, C. and Frank, T.S. (1995) Somatic mutations in the BRCA1 gene in sporadic ovarian tumours. Nature Genet., 9, 439-443. MEDLINE Abstract

20. Hosking, L., Trowsdale, J., Nicolai, H., Solomon, E., Foulkes, W., Stemp, G., Signer, E. and Jeffreys, A. (1995) A somatic BRCA1 mutation in an ovarian tumour. Nature Genet., 9, 343-344. MEDLINE Abstract

21. Miki, Y., Katagiri, T., Kasumi, F., Yoshimoto, T. and Nakamura, Y. (1996) Mutation analysis in the BRCA2 gene in primary breast cancers. Nature Genet., 13, 245-247. MEDLINE Abstract

22. Lancaster, J., Wooster, R., Mangion, J., Phelan, C., Cochran, C., Gumbs, C., Seal, S., Barfoot, R., Collins, N., Bignell, G., Patel, S., Hamoudi, R., Larsson, C., Wiseman, R., Berchuck, A., Iglehart, J., Marks, J., Ashworth, A., Stratton, M.R. and Futreal, P.A. (1996) BRCA2 mutations in primary breast and ovarian cancers. Nature Genet., 13, 238-240. MEDLINE Abstract

23. Phelan, C., Lancaster, J.M., Tonin, P., Gumbs, C., Cochran, C., Carter, R., Ghadirian, P., Perret, C., Moslehi, R., Dion, F., Faucher, M., Dole, K., Karimi, S., Foulkes, W., Lounis, H., Watner, E., Goss, P., Anderson, D., Larsson, C., Narod, S. and Futreal, P.A. (1966) Mutation analysis of the BRCA2 gene in 49 site-specific breast cancer families. Nature Genet., 13, 120-122.

24. Takahashi, H., Chiu, H.-C., Bandera, C.A., Behbakht, K., Liu, P.C., Couch, F.J., Weber, B.L., LiVolsi, V.A., Furusato, M., Rebane, B.A., Cardonick, A., Benjamin, I., Morgan, M.A., King, S.A., Mikuta, J.J., Rubin, S.C. and Boyd, J. (1996) Mutations of the BRCA2 gene in ovarian carcinomas. Cancer Res., 56, 2738-2741. MEDLINE Abstract

25. Teng, D.H.F., Bogden, R., Mitchell, J., Baumgard, M., Bell, R., Berry, S., Davis, T., Ha, P.C., Kehrer, R., Jammulapati, S., Chen, Q., Offit, K., Skolnick, M.H., Tavtigian, S.V., Jhanwar, S., Swedlund, B., Wong, A.K.C. and Kamb, A. (1996) Low incidence of BRCA2 mutations in breast carcinoma and other cancers. Nature Genet., 13, 241-244.

26. Weber, B.H.F., Brohm, M., Stec, I., Backe, J. and Caffier, H. (1996) A somatic truncating mutation in BRCA2 in a sporadic breast tumor. Am. J. Hum. Genet., 59, 962-964. MEDLINE Abstract

27. Bowcock, A.M., Anderson, L.A., Friedman, L.S., Black, D.M., Osborne-Lawrence, S., Rowell, S.E., Hall, J.M. and King, M.-C. (1993) THRA1 and D17S183 flank an interval of <4 cM for the breast-ovarian cancer gene (BRCA1) on chromosome 17q21. Am. J. Hum. Genet., 52, 718-722. MEDLINE Abstract

28. DiSaia, P.J., Sinkovics, J.G., Rutledge, F.N. and Smith, J.P. (1972) Cell-mediated immunity to human malignant cells. Am. J. Gynecol., 114, 979-989.

29. Freedman, R.S., Pihl, E., Kusyk, C., Gallager, H.S. and Rutledge, F. (1978) Characterization of an ovarian carcinoma cell line. Cancer, 42, 2352-2359. MEDLINE Abstract

30. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

31. Kurth, J.H., Bowcock, A.M., Erlich, H.A., Nevo, S. and Cavalli-Sforza. (1991) Km typing with PCR: application to population screening. Am. J. Hum. Genet. 48, 613-620. MEDLINE Abstract

32. Wood, W.I., Gitschier, J., Lasky, L.A. and Lawn, R.M. (1985) Base composition-independent hybridization in tetramethylammonium chloride: a method for oligonucleotide screening of highly complex gene libraries. Proc. Natl Acad. Sci. USA, 82, 1585-1588. MEDLINE Abstract

33. Trask, B.J. (1998) Fluorescence in situ hybridization. In Birren, B., Green, E., Hieter, P. and Myers, R., eds. Genome Analysis: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

34. Wise, C.A., Clines, G.A., Massa, H., Trask, B.J. and Lovett, M. (1997) Identification and localization of the gene for EXTL, a third member of the multiple exostoses gene family. Genome Res., 7, 10-16. MEDLINE Abstract

35. Beaudet, A.L. and Tsui, L.-C. (1993) A suggested nomenclature for designating mutations. Hum. Mutat., 2, 245-248. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +1 214 648 1675; Fax: +1 214 648 1666; Email: bowcock@ryburn.swmed.edu


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 6 Jan 1998
Copyright© Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
D. Fox III, I. Le Trong, P. Rajagopal, P. S. Brzovic, R. E. Stenkamp, and R. E. Klevit
Crystal Structure of the BARD1 Ankyrin Repeat Domain and Its Functional Consequences
J. Biol. Chem., July 25, 2008; 283(30): 21179 - 21186.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Shakya, M. Szabolcs, E. McCarthy, E. Ospina, K. Basso, S. Nandula, V. Murty, R. Baer, and T. Ludwig
The basal-like mammary carcinomas induced by Brca1 or Bard1 inactivation implicate the BRCA1/BARD1 heterodimer in tumor suppression
PNAS, May 13, 2008; 105(19): 7040 - 7045.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Li, S. Ryser, E. Dizin, D. Pils, M. Krainer, C. E. Jefford, F. Bertoni, R. Zeillinger, and I. Irminger-Finger
Oncogenic BARD1 Isoforms Expressed in Gynecological Cancers
Cancer Res., December 15, 2007; 67(24): 11876 - 11885.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Laufer, S. V. Nandula, A. P. Modi, S. Wang, M. Jasin, V. V. V. S. Murty, T. Ludwig, and R. Baer
Structural Requirements for the BARD1 Tumor Suppressor in Chromosomal Stability and Homology-directed DNA Repair
J. Biol. Chem., November 23, 2007; 282(47): 34325 - 34333.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Xie, O. Kerscher, M. B. Kroetz, H. F. McConchie, P. Sung, and M. Hochstrasser
The Yeast Hex3{middle dot}Slx8 Heterodimer Is a Ubiquitin Ligase Stimulated by Substrate Sumoylation
J. Biol. Chem., November 23, 2007; 282(47): 34176 - 34184.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Tembe and B. R. Henderson
BARD1 Translocation to Mitochondria Correlates with Bax Oligomerization, Loss of Mitochondrial Membrane Potential, and Apoptosis
J. Biol. Chem., July 13, 2007; 282(28): 20513 - 20522.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S-M Karppinen, R B Barkardottir, K Backenhorn, T Sydenham, K Syrjakoski, J Schleutker, T Ikonen, K Pylkas, K Rapakko, H Erkko, et al.
Nordic collaborative study of the BARD1 Cys557Ser allele in 3956 patients with cancer: enrichment in familial BRCA1/BRCA2 mutation-negative breast cancer but not in other malignancies
J. Med. Genet., November 1, 2006; 43(11): 856 - 862.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Sankaran, L. M. Starita, A. M. Simons, and J. D. Parvin
Identification of Domains of BRCA1 Critical for the Ubiquitin-Dependent Inhibition of Centrosome Function.
Cancer Res., April 15, 2006; 66(8): 4100 - 4107.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M K Sauer and I L Andrulis
Identification and characterization of missense alterations in the BRCA1 associated RING domain (BARD1) gene in breast and ovarian cancer
J. Med. Genet., August 1, 2005; 42(8): 633 - 638.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. D. Choudhury, H. Xu, A. P. Modi, W. Zhang, T. Ludwig, and R. Baer
Hyperphosphorylation of the BARD1 Tumor Suppressor in Mitotic Cells
J. Biol. Chem., July 1, 2005; 280(26): 24669 - 24679.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Schuchner, V. Tembe, J. A. Rodriguez, and B. R. Henderson
Nuclear Targeting and Cell Cycle Regulatory Function of Human BARD1
J. Biol. Chem., March 11, 2005; 280(10): 8855 - 8861.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. Feki, C.-E. Jefford, P. Durand, J. Harb, H. Lucas, K.-H. Krause, and I. Irminger-Finger
BARD1 Expression During Spermatogenesis Is Associated with Apoptosis and Hormonally Regulated
Biol Reprod, November 1, 2004; 71(5): 1614 - 1624.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S-M Karppinen, K Heikkinen, K Rapakko, and R Winqvist
Mutation screening of the BARD1 gene: evidence for involvement of the Cys557Ser allele in hereditary susceptibility to breast cancer
J. Med. Genet., September 1, 2004; 41(9): e114 - e114.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Rodriguez, X. Yu, J. Chen, and Z. Songyang
Phosphopeptide Binding Specificities of BRCA1 COOH-terminal (BRCT) Domains
J. Biol. Chem., December 26, 2003; 278(52): 52914 - 52918.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
U. K. Westermark, M. Reyngold, A. B. Olshen, R. Baer, M. Jasin, and M. E. Moynahan
BARD1 Participates with BRCA1 in Homology-Directed Repair of Chromosome Breaks
Mol. Cell. Biol., November 1, 2003; 23(21): 7926 - 7936.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
T I Orban and E Olah
Emerging roles of BRCA1 alternative splicing
Mol. Pathol., August 1, 2003; 56(4): 191 - 197.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. E. McCarthy, J. T. Celebi, R. Baer, and T. Ludwig
Loss of Bard1, the Heterodimeric Partner of the Brca1 Tumor Suppressor, Results in Early Embryonic Lethality and Chromosomal Instability
Mol. Cell. Biol., July 15, 2003; 23(14): 5056 - 5063.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Xia, G. M. Pao, H.-W. Chen, I. M. Verma, and T. Hunter
Enhancement of BRCA1 E3 Ubiquitin Ligase Activity through Direct Interaction with the BARD1 Protein
J. Biol. Chem., February 7, 2003; 278(7): 5255 - 5263.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Fabbro, J. A. Rodriguez, R. Baer, and B. R. Henderson
BARD1 Induces BRCA1 Intranuclear Foci Formation by Increasing RING-dependent BRCA1 Nuclear Import and Inhibiting BRCA1 Nuclear Export
J. Biol. Chem., June 7, 2002; 277(24): 21315 - 21324.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Chen, F. E. Kleiman, J. L. Manley, T. Ouchi, and Z.-Q. Pan
Autoubiquitination of the BRCA1{middle dot}BARD1 RING Ubiquitin Ligase
J. Biol. Chem., June 7, 2002; 277(24): 22085 - 22092.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. R. Morris, N. H. Keep, and E. Solomon
Identification of Residues Required for the Interaction of BARD1 with BRCA1
J. Biol. Chem., March 8, 2002; 277(11): 9382 - 9386.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Gautier, I. Irminger-Finger, M. Grégoire, K. Meflah, and J. Harb
Identification of an Apoptotic Cleavage Product of BARD1 as an Autoantigen: A Potential Factor in the Antitumoral Response Mediated by Apoptotic Bodies
Cancer Res., December 1, 2000; 60(24): 6895 - 6900.
[Abstract] [Full Text]


Home page
ScienceHome page
D. H. Ly, D. J. Lockhart, R. A. Lerner, and P. G. Schultz
Mitotic Misregulation and Human Aging
Science, March 31, 2000; 287(5462): 2486 - 2492.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
W. Bruening, A. H. Prowse, D. C. Schultz, M. Holgado-Madruga, A. Wong, and A. K. Godwin
Expression of OVCA1, a Candidate Tumor Suppressor, Is Reduced in Tumors and Inhibits Growth of Ovarian Cancer Cells
Cancer Res., October 1, 1999; 59(19): 4973 - 4983.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
F. E. Kleiman and J. L. Manley
Functional Interaction of BRCA1-Associated BARD1 with Polyadenylation Factor CstF-50
Science, September 3, 1999; 285(5433): 1576 - 1579.
[Abstract] [Full Text]


Home page
JCBHome page
I. Irminger-Finger, J. V. Soriano, G. Vaudan, R. Montesano, and A.-P. Sappino
In Vitro Repression of Brca1-associated RING Domain Gene, Bard1, Induces Phenotypic Changes in Mammary Epithelial Cells
J. Cell Biol., November 30, 1998; 143(5): 1329 - 1339.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Hashizume, M. Fukuda, I. Maeda, H. Nishikawa, D. Oyake, Y. Yabuki, H. Ogata, and T. Ohta
The RING Heterodimer BRCA1-BARD1 Is a Ubiquitin Ligase Inactivated by a Breast Cancer-derived Mutation
J. Biol. Chem., April 27, 2001; 276(18): 14537 - 14540.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Houvras, M. Benezra, H. Zhang, J. J. Manfredi, B. L. Weber, and J. D. Licht
BRCA1 Physically and Functionally Interacts with ATF1
J. Biol. Chem., November 10, 2000; 275(46): 36230 - 36237.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Joukov, J. Chen, E. A. Fox, J. B. A. Green, and D. M. Livingston
Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development
PNAS, October 9, 2001; 98(21): 12078 - 12083.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (77)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Thai, T. H.
Right arrow Articles by Bowcock, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thai, T. H.
Right arrow Articles by Bowcock, A. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?