Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (164)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wada, M.
Right arrow Articles by Kuwano, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wada, M.
Right arrow Articles by Kuwano, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular GeneticsPages 203-207

Mutations in the canalicular multispecific organic anion transporter (cMOAT) gene, a novel ABC transporter, in patients with hyperbilirubinemia II/Dubin-Johnson syndrome
Introduction
Results And Discussion
Materials And Methods
   Subjects
   RT-PCR
   Sequencing and identification of mutations
   Amplification of genomic DNA
Acknowledgements
References
Footnote

Mutations in the canalicular multispecific organic anion transporter (cMOAT) gene, a novel ABC transporter, in patients with hyperbilirubinemia II/Dubin-Johnson syndrome

Mutations in the canalicular multispecific organic anion transporter ( cMOAT ) gene, a novel ABC transporter, in patients with hyperbilirubinemia II/Dubin-Johnson syndrome Morimasa Wada1,*, Satoshi Toh1, Ken Taniguchi1, Takanori Nakamura1, Takeshi Uchiumi1, Kimitoshi Kohno2, Ichiro Yoshida3, Akihiko Kimura3, Shotaro Sakisaka4, Yukihiko Adachi5 and Michihiko Kuwano1

1Department of Biochemistry, Kyushu University School of Medicine, Fukuoka 812-82, Japan, 2Department of Molecular Biology, University of Occupational and Environmental Health, Kitakyushu 807, Japan, 3Department of Pediatrics and Child Health and 4Second Department of Medicine, Kurume University School of Medicine, Kurume 830, Japan and 5Third Department of Internal Medicine, Mie University School of Medicine, Mie 514, Japan

Received August 18, 1997; Revised and Accepted November 12, 1997

Members of the ATP-binding cassette (ABC) transporter superfamily are mutated to cause diseases that include cystic fibrosis, hyperinsulinemia, adrenoleukodystrophy, Stargardt disease and multidrug resistance. We recently isolated a novel human member of ABC transporter superfamily as the candidate transporter for the glucuronide and glutathione-conjugated antitumor agents, and found it highly homologous to the rat cmoat gene. Consistent with recent findings of defects in the homologous cmoat gene in two rat models of hyperbilirubinemia (TR- and Eisai), we report two deletions and a missense mutation in the active transport family signature region in the gene in patients with hyperbilirubinemia II/Dubin-Johnson syndrome (DJS; MIM 237500), respectively. These results strongly implicate the cMOAT gene as responsible for the defects in DJS patients.

INTRODUCTION

Hyperbilirubinemia II/Dubin-Johnson syndrome (DJS; MIM 237500), a hereditary disease transmitted as an autosomal recessive trait, is characterized by conjugated hyperbilirubinemia, an increase in the urinary excretion of co-proporphyrin isomer I, deposition of melanin-like pigment in hepatocytes and prolonged retention of sulfobromophthalein, but otherwise normal liver function (1-4). The genetic basis of DJS is unknown, but early studies suggested defects in excretion rather than in the import or conjugation of bilirubin.

Hepatobiliary excretion of conjugated bilirubin is mediated by an ATP-dependent transport system, the canalicular multispecific organic anion transporter (cMOAT), located in the apical (canalicular) membrane of hepatocytes (5-7). The multidrug resistance-associated protein (MRP) can also transport glutathione conjugates [leucotriene C4 (LTC4) and dinitrophenyl glutathione (GS-DNP)] (8,9), which are also putative substrates for transport by cMOAT protein, but the expression of the MRP gene in liver is very low (9). Recently, Paulusma et al. demonstrated that rat cMOAT is a liver-specific homolog of the MRP; they reported that TR- rats, an animal model of DJS, are defective in anion transporter (cMOAT) and found a single nucleotide deletion mutation at nucleotide 1179 in the gene, resulting in reduced mRNA abundance and absence of the protein (10). Ito et al. (11) have reported independently that expression of cmoat is defective in Eisai hyperbilirubinemic rats (EHBR), a second animal model, and found a molecular defect in cmoat in that case as well, a transition mutation (G -> A at nucleotide 2564) that creates a premature stop codon.

We recently isolated a novel human member of the ATP-binding cassette (ABC) transporter superfamily as the candidate transporter for the glucuronide and glutathione-conjugated antitumor agents, and found it highly homologous to the rat cmoat gene (12). Recently, >20 genes for the ABC transporter were found in the expressed sequence tag (EST) databases and their genomic map positions determined (13,14). One of these, EST172291 (13), corresponds to the human cMOAT gene (12) by sequence identity and map location. Members of the ABC transporter superfamily (15) are mutated to cause diseases that include cystic fibrosis (16), hyperinsulinemia (17), adrenoleukodystrophy (18), Stargardt disease (19) and multidrug resistance (20).

These results raised the question of whether the human cMOAT gene is responsible for DJS. The mRNA and genomic DNA encoding the cMOAT gene were analyzed in four DJS patients. We detected a deletion caused by a mutation at a splice site in a patient and also a missense mutation and/or a deletion mutation in the active transport family signature region that is characteristic of nucleotide-binding folds of ABC transporters (15) in three other patients, strongly suggesting that the mutated cMOAT gene is responsible for the defects in DJS patients.

RESULTS AND DISCUSSION

Using RT-PCR and sequence analysis, we analyzed the entire cMOAT cDNA sequence from four patients that had high concentrations of T (total)- and D (direct)-bilirubin [5.0, 5.2, 1.3 and 1.3 mg/dl for T- and ND (not determined), 3.8, 0.8 and 0.8 mg/ml for D-bilirubin in patients DJ1, DJ7, DJ4 and DJ5, respectively]. Patients DJ4 and DJ5 were brothers, and the others are unrelated. We identified a missense mutation 2302 (C -> T) R768W in the active transport family signature (15) present in cDNA of three patients, DJ1, DJ4 and DJ5 (Figs 1 and 2). This mutation was homozygous in genomic DNA of the severely affected patient DJ1 and heterozygous in patients DJ4 and DJ5 and their father DJ2 (Fig. 2). The second alteration, 2272del168, a deletion of 168 nucleotides from 2272 to 2439 in PCR product G, was also detected in cDNA from peripheral blood leukocyte of DJ4 and DJ5 (Figs 1 and 3a). Sequence, RT-PCR and restriction analyses (loss of the AciI site) of DJ4, DJ5 and their family members showed perfect co-segregation of the mutations with the DJS trait (Figs 2and3a). Patients DJ4 and DJ5 are compound heterozygote for both mutations, whereas parents DJ2 and DJ3, who have both been diagnosed as carriers by urinary excretion of co-proporphyrin I (21), are heterozygotes for one of each mutation, respectively (Figs 2and3a). Their sister DJ6 does not have both mutations (Figs 2 and3a). Restriction analysis of RT-PCR product F was also consistent with these results. The product F of an allele corresponding to the deletion mutation 2272del168 is not expected to be detected in DJ3, DJ4 and DJ5, because one of the primers used for amplification of the product F locates in the deleted region described above. As a result, the product with mutation 2302 (C -> T) was detected in DJ4 and DJ5, the product with no mutation 2302 (C -> T) was detected in DJ3 and DJ6, and the product of both types was detected in DJ2 (Fig. 3b). The base substitution 2302 (C -> T) and the deletion 2272del168 were not detected in any of 50 unrelated controls. RT-PCR analysis of peripheral blood leukocytes also revealed a shorter than expected band with primer pair H in subjects DJ4 and DJ5. However, this deletion, 2748del136, was also detected in some control samples, and proved on sequencing to represent an apparent product of alternative splicing, with one exon skipped. Genomic sequencing of DJ4 and DJ5 revealed no alteration of exon-intron boundaries corresponding to 2748del136.


Figure 1. The nucleotide sequence of cMOAT cDNA amplified by primer pairs E, F and G. The nucleotide sequence of primer pairs E, F and G are indicated by thick underlining with the characters E5', E3', F5', F3', G5', G3', respectively. Waker A, B and C motif are indicated by underlining with the characters WA, WB and WC, respectively. The C -> T transition mutation detected in this study is indicated by a bold letter T below the wild-type sequence C, and the amino acid change W is also shown above the wild-type amino acid R. The deletion mutations detected are indicated by boxes. The nucleotide number from the translation start site is shown on the right.


Figure 2. Detection of a cMOAT missense mutation in DJS. (a) Sequence analysis of the exon containing the nucleotide-binding domain amplified from genomic DNA of patients DJ1, DJ4, DJ5 and their families. The sequencing result indicates that DJ1 is homozygous for the mutation 2302(C -> T). DJ4 and DJ5 are brothers and are heterozygous for the mutation, having inherited it from their father DJ2 who is also heterozygous for this mutation. The mother, DJ3, and sister, DJ6, of DJ4 and DJ5 do not have this mutation. Sequencing profiles of the sense strand of only DJ3 (wild-type), DJ4 (heterozygous mutant) and DJ1(homozygous mutant) are presented. (b) Restriction digestion analysis of the genomic region around the mutation 2302(C -> T) in DJ1, DJ4, DJ5 and their family members. The mutation 2302(C -> T) destroys a naturally occurring AciI restriction site. PCR-amplified genomic DNA (170 bp) was digested with AciI and the products were electrophoresed on a 3% agarose gel. Wild-type products are digested into 88 and 82 bp (DJ2, DJ3, DJ4, DJ5, DJ6 and control). The 2302(C -> T) mutant products are not cleaved (DJ1, DJ2 DJ4 and DJ5). This shows that DJ1 is homozygous and DJ2, DJ4 and DJ5 are heterozygous for the mutation. The 100 bp ladder marker was run in lane M.


Figure 3. Detection of a cMOAT deletion mutation in DJS. (a) Analysis of the RT-PCR product from DJ4, DJ5 and their family members. The primer pair G (see Materials and Methods for nucleotide sequences and Fig. 1 for the region amplified) was used to amplify the cDNA from peripheral blood leukocytes. A single RT-PCR product of 500 bp was amplified from DJ2, DJ6 and control. In contrast, a smaller fragment of 332 bp was amplified mainly from DJ3, DJ4 and DJ5. This mutation has been designated as 2272del168. The full-length band is faint in DJ3, DJ4 and DJ5, probably because unequal amplification was due to the size of each template and/or the formation of heteroduplexes resulting in shorter products. Analysis of the PCR product of each subject is shown below the corresponding symbols in the pedigree. Closed and shaded symbols show the 2302(C -> T) and the deletion mutation 2272del168, respectively. (b) Restriction digestion analysis of the RT-PCR products amplified from peripheral blood leukocytes by the F primer pair (see Materials and Methods and Fig. 1) in DJ4, DJ5 and their family members. RT-PCR products of 404 bp were digested with AciI and electrophoresed on 3% agarose gel. There is an AciI site in the normal control sequence, providing fragments of 82 and 322 bp (DJ3, DJ6 and control). The single base substitution of nucleotide 2302 prevents digestion. A faint 404 bp band in the DJ3 and DJ6 is a product of incomplete digestion. The 200 bp band detected in DJ6 was also detected in some control samples and no alteration in these exon-intron boundaries was detected. It could be a product of alternative splicing which occurs rarely in peripheral blood leukocytes.

A third alteration in cDNA, 1669del147, a deletion of 147 nucleotides from 1669 to 1815 in PCR product E, was identified in patient DJ7 (Figs 1 and 4a). The genomic sequence was determined, including exon-intron boundaries (Fig. 4b), and revealed that the deletion junction was at an exon-intron boundary. A T -> A transition two bases after the 3' boundary of the corresponding exon (the splice donor site) was identified in genomic DNA isolated from patient DJ7 (Fig. 4b). No deletion was detected in 50 unrelated controls, and no other change was observed in the cMOAT of patient DJ7 (data not shown).


Figure 4. Detection of a cMOAT splicing mutation in DJ7. (a) Gel electrophoresis of the RT-PCR product from liver tissue of DJ7, using primer pair E (see Materials and Methods and Fig. 1). The full-length product is 476 bp as in the control lane; the band in lane DJ7 is 329 bp. The sequencing of this 329 bp cDNA revealed a 147 bp deletion from nucleotides 1669 to 1815. This mutation was designated as 1669del147. The 100 bp marker was run in lane M. (b) Genomic DNA sequence analysis at the splice site junction corresponding to 1669del147 mutation. The well-conserved nucleotide T at the splicing donor is substituted for A in patient DJ7.

In contrast to the two animal models for DJS, we observed similar levels of cMOAT mRNA in the liver of patient DJ7 (the only one for whom liver tissue was available) compared with normal liver. The deletion mutation in patient DJ7, and presumably the missense mutation as well, thus most likely affects protein formation or function rather than an absence of transcription. This interpretation of the mutation analysis is supported further by the demonstration of the absence of the canalicular isoform of the MRP in DJS (22) and by the segregation profile of the mutation (Figs 2 and3a), which is consistent with the autosomal recessive inheritance of the syndrome (2,4) and the chromosomal location, 10q21, of the human cMOAT gene (12). During the preparation of this report, Paulusma et al. have reported a nonsense mutation at codon 1066 in another DJS patient (23). Although this report was not accompanied by genomic analysis data, it further supports the conclusion reached here.

The Walker A, B motif and the active transport family signature, also called the C motif at the nucleotide-binding site, are highly conserved among members of the ABC transporter superfamily, and are important for both ATP binding and hydrolysis. Missense mutation of the active transport family signature, as we found in patients DJ1, DJ4 and DJ5, is also reported in other ABC transporter disorders, including cystic fibrosis and Stargardt disease (19,24). As in DJS, the loss of the transporter function is severe but not lethal to the affected cells. In DJS, this combination of features permits the survival of liver cells that have developed the other phenotype associated with cMOAT loss, failure to transport certain conjugated drugs.

MATERIALS AND METHODS

Subjects

Four patients were analyzed in this study. Patients DJ4 and DJ5 are brothers and were diagnosed as having DJS by their serum bilirubin concentration (1.3 and 1.3 mg/dl for T-bilirubin and 0.8 and 0.8 mg/ml for D-bilirubin, respectively) and co-proporphyrin retention (94.5 and 93.6% for urinary co-proporphyrin I, respectively) (21). Other laboratory findings in DJ4 and DJ5 were as follows (21): hemoglobin concentration, 88 and 95 g/l; red cell count, 303×104 and 278×104/mm3, respectively. Urinalysis showed an increased excretion of urobilinogen. Serum levels of aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, [gamma]-glutamyltranspeptidase, lactate dehydrogenase and [alpha]-fetoprotein were normal. Serum antibody titers showed no evidence of infection with rubella virus, cytomegalovirus, hepatitis B virus or herpes simplex. Hepatobiliary scintigraphy of DJ4 showed gastrointestinal excretion, without visualization of the extrahepatic biliary ducts. Abdominal sonography showed a homogeneously enlarged liver with a normal-sized biliary tree and portal veins. The gall bladder was visible. Hepatobiliary scintigraphy of DJ5 showed gastrointestinal excretion, and the extrahepatic biliary ducts were visualized. Abdominal sonography showed a liver of normal size with a normal biliary tree and portal veins. The gall bladder was visible. Menghini needle liver biopsy of DJ4 showed a specimen that was not dark greenish. On light microscopic examination of DJ4, the liver showed a normal lobular pattern without inflammatory change or fibrosis. Abnormal pigment granules were seen in the hepatocytes, showing a positive reaction for Fontana-Masson and melanin stains. Macrovesicular fatty changes were also observed in the hepatocytes. Light microscopic examination of the liver from DJ5 showed that most of the hepatocytes contained pigment granules. Macrovesicular fatty droplets were also observed in the hepatocytes. Characteristic lysosomal pigment granules were observed in the cytoplasm of the hepatocytes of DJ5 by electron microscopy.

DJ2, DJ3 and DJ6 are a father, mother and sister, with DJ2 and DJ3 diagnosed as carriers of DJS by co-proporphyrin retention (42.1 and 43.5% for urinary co-proporphyrin I, respectively) (21). The ages and sex of DJ2, DJ3, DJ4, DJ5 and DJ6 are 31, male; 28, female; 7, male; 4, male and 0.5, female, respectively. DJ2, DJ3, DJ4, DJ5 and DJ6 are members of a single family and DJ1 and DJ7 are member of other families; DJ1 and DJ7 were diagnosed as having DJS by their serum bilirubin concentration (see Results and Discussion) and pigmentation in liver. DJ1 is a 51 year old male and his T-bilirubin level is 5.0 mg/dl. DJ7 is a 46 year old male and his T- and D-bilirubin level are 5.2 and 3.8 mg/dl, respectively.

RT-PCR

The sequences of the 12 pairs of primer used for RT-PCR-sequencing analysis were as follows, with the nucleotide numbers from the translation start site for each amplified region indicated in parentheses: A(-28 to 513), 5'GTCTTTGTTCCAGACGCAGTC3' and 5'GGAGATGAAGAACAGGCAGG3'; B(449- 876), 5'TGATCCGGACACTCTTACAGG3' and 5'AACATCTTCCAGGACAAGGG3'; C(819-1303), 5'GCCTGGCTTGAACAAGAATC3' and 5'TCACATCCATGAGCTTCTGG3'; D(1228-1715), 5'TTGGCCAGGAAGGAGTACAC3' and 5'TTGTTGCTATCCACCAGGAC3'; E(1601-2067), 5'AGAACCTGCTGGCCTTTAGTC3' and 5'TTCCATTTCTCCCAGCATG3'; F(1980-2383), 5'CATTATGGCAGGCCAACTTG3' and 5'CATGAGCATCCACTGCAGAC3'; G(2251-2750), 5'TTGGCTGAGATTGGAGAGAAG3' and 5'GAACTGCGGCTAAGTGTTCG3'; H(2665-3140), 5'TCCAGTGTGGAAGAGATCCC3' and 5'AAGGCACTCCAGAAATGTGC3'; I(3054-3553), 5'TCAGAGGGACATGAGAGTTGG3' and 5'GTTTCAGAAATCGCTGCTGG3'; J(3420-3904), 5'TTATGTGTCTACCTCCCGCC3' and 5'ACTGGATCTTGCCTTTGCTG3'; K(3801-4226), 5'GGCTGTTGAGCGAATAACTG3' and 5'GCCTTCCAAATCTCCTCATC3'; L(4164-4784), 5'TGGAAGCCTGAGGATGAATC3' and 5'TGGGTAGTAGGTTCATGGGTG3'. The nucleotide sequence corresponding to the region amplified by primer pairs E, F and G where we found mutations is also presented as Figure 1. Total RNA from peripheral blood leukocytes and liver tissue of DJS patients was isolated using the ISOGEN (Nippongene Co., Tokyo, Japan). First-strand synthesis from total RNA was performed using random hexanucleotide primers and MMLV reverse transcriptase (Gibco BRL, Gaithersburg, MD). The single-stranded cDNA was PCR amplified with 2 pmol of the forward and reverse primers described above using AmpliTaqGoldtm DNA polymerase (Perkin Elmer, Tokyo, Japan). For PCR, 40 cycles of denaturation (94°C for 30 s), annealing (60°C for 30 s) and extension (72°C for 45 s) were performed. The PCR products were sequenced directly or after subcloning into pMOSBlue vector (Amersham, Buckinghamshire, UK).

Sequencing and identification of mutations

In order to avoid PCR artifacts, we sequenced at least 10 subclones for each sample or sequenced PCR products directly, using a DyeDeoxy Terminator Cycle Sequencing kit (Applied Biosystems, Tokyo, Japan) and a DNA sequencing system (model 373S, Applied Biosystems). Both sense and antisense strands were sequenced for confirmation.

Amplification of genomic DNA

Genomic DNAs were prepared from either peripheral blood leukocyte cells or liver tissue (DJ7) following standard methods. The nucleotide sequences of the primers used to amplify the genomic fragments containing each mutation were as follows (the region to which these primers correspond are described parentheses: gFG5', 5'TTAGGAGATGGAGCCAAGATTC3' (intron at the beginning of the cDNA G fragment, see above); gFG3', 5'CATGAGCATCCACTGCAGAC3' (F and G fragments of cDNA); gE5', 5' AAGGATTGGCTTAGGAGGC3' (intron at the beginning of the cDNA E fragment); gE3', 5'AGTCATTCTGGACTCCAAGG3' (intron at the end of the cDNA E fragment).

ACKNOWLEDGEMENTS

We thank Dr David Schlessinger for fruitful discussion and editorial help and T. Matsuguma for help in preparing the manuscript. This study was supported by grants-in-aid for Scientific Research from the Ministry of Education, Science, Sports and Culture, Japan and a grant in aid for Cancer Research from the Fukuoka Cancer Society, Japan.

REFERENCES

1. Dubin, I.N. and Johnson, F.B. (1954) Chronic idiopathic jaundice with unidentified pigment in liver cells: new clinico-pathologic entity with report of 12 cases. Medicine, 33, 155-197.

2. Shani, M., Seligsohn, U., Gilon, E., Sheba, C. and Adam, A. (1970) Dubin-Johnson syndrome in Israel. I. Clinical, laboratory, and genetic aspects of 101 cases. Q. J. Med.,39, 549-567. MEDLINE Abstract

3. Sprinz, H. and Nelson, R.S. (1954) Persistent nonhemolytic hyperbilirubinemia associated with lipochrome-like pigment in liver cells: report of four cases. Ann. Int. Med., 41, 952-962.

4. Kondo, T., Kazuo, K., Ohtsuka, Y., Yanagisawa, W. and Shiomura, T. (1974) Clinical and genetic studies on Dubin-Johnson syndrome in a cluster area in Japan. Jap. J. Hum. Genet., 18, 378-392.

5. Oude Elferink, R.P., Meijer, D.K., Kuipers, F., Jansen, P.L., Groen, A.K.and Groothuis, G.M. (1995) Hepatobiliary secretion of organic compounds; molecular mechanisms of membrane transport. Biochim. Biophys. Acta, 1241, 215-268. MEDLINE Abstract

6. Oude Elferink, R.P., Ottenhoff, R., Liefting, W.G., Schoemaker, B., Groen, A.K.and Jansen, P.L. (1990) ATP-dependent efflux of GSSG and GS-conjugate from isolated rat hepatocytes. Am. J. Physiol., 258, G699-G706. MEDLINE Abstract

7. Kitamura, T., Jansen, P., Hardenbrook, C., Kamimoto, Y.,Gatmaitan, Z. and Arias, I.M. (1990) Defective ATP-dependent bile canalicular transport of organic anions in mutant (TR-) rats with conjugated hyperbilirubinemia. Proc. Natl Acad. Sci. USA, 87, 3557-3561. MEDLINE Abstract

8. Loe, D.W., Almquist, K.C., Deeley, R.G. and Cole, S.P. (1996) Multidrug resistance protein (MRP)-mediated transport of leukotriene C4 and chemotherapeutic agents in membrane vesicles. Demonstration of glutathione-dependent vincristine transport. J. Biol. Chem., 271, 1675-1682.

9. Cole, S.P., Bhardwaj, G., Gerlach, J.H., Mackie, J.E., Grant, C.E., Almquist, K.C., Stewart, A.J., Kurz, E.U., Duncan A.M. and Deeley R.G. (1992) Overexpression of a transporter gene in a multidrug-resistant human lung cancer cell line. Science, 258, 1650-1654. MEDLINE Abstract

10. Paulusma, C.C., Bosma, P.J., Zaman, G.J., Bakker, C.T., Otter, M., Scheffer, G.L., Scheper, R.J., Borst, P. and Oude Elferink, R.P. (1996) Congenital jaundice in rats with a mutation in a multidrug resistance-associated protein gene. Science, 271, 1126-1128. MEDLINE Abstract

11. Ito, K., Suzuki, H., Hirohashi, T., Kume, K., Shimizu, T. and Sugiyama, Y. (1997) Molecular cloning of canalicular multispecific organic anion transporter defective in EHBR. Am. J. Physiol.,35, G16-G22.

12. Taniguchi, K., Wada, M., Kohno, K., Nakamura, T., Kawabe, T., Kawakami, M, Kagotani, K., Okumura, K., Akiyama, S. and Kuwano, M. (1996) A human canalicular multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplatin-resistant human cancer cell lines with decreased drug accumulation. Cancer Res., 56, 4124-4129 MEDLINE Abstract

13. Allikmets, R., Gerrard, B., Hutchinson, A. and Dean, M. (1996) Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database. Hum. Mol. Genet., 5, 1649-1655. MEDLINE Abstract

14. Dean, M. and Allikmets, R. (1995) Evolution of ATP-binding cassette transporter genes. Curr. Opin. Genet. Dev., 5, 779-785. MEDLINE Abstract

15. Higgins, C.F. (1992) ABC transporters: from microorganisms to man. Annu. Rev. Cell Biol., 8, 67-113. MEDLINE Abstract

16. Riordan, J.R., Rommens, J.M., Kerem, B., Alon, N., Rozmahel, R., Grzelczak, Z., Zielenski, J., Lok, S., Plavsic, N. and Chou, J.L. (1989) Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science, 245, 1066-1073. MEDLINE Abstract

17. Thomas, P.M., Cote, G.J., Wohllk, N., Haddad, B., Mathew, P.M., Rabl, W. Aguilar-Bryan, L., Gagel, R.F. and Bryan, J. (1995) Mutations in the sulfonylurea receptor gene in familial persistent hyperinsulinemic hypoglycemia of infancy. Science, 268, 426-429. MEDLINE Abstract

18. Mosser, J., Douar, A.M., Sarde, C.O., Kioschis, P., Feil R, Moser, H., Poustka, A.M., Mandel, J.L. and Aubourg, P. (1993) Putative X-linked adrenoleukodystrophy gene shares unexpected homology with ABC transporters. Nature, 361, 726-730. MEDLINE Abstract

19. Allikmets, R., Singh, N., Sun, H., Shroyer, N.F., Hutchinson, A., Chidambaram, A., Gerrard, B., Baird, L., Stauffer, D., Peiffer, A., Rattner, A., Smallwood, P., Li, Y., Anderson, K.L., Lewis, R.A., Nathans, J., Leppert, M., Dean, M. and Lupski, J.R. (1997) A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is mutated in recessive Stargardt macular dystrophy. Nature Genet., 15, 236-246.

20. Roninson, I.B., Chin, J.E., Choi, K.G., Gros, P, Housman, D.E., Fojo, A., Shen, D.W, Gottesman, M.M. and Pastan, I. (1986) Isolation of human mdr DNA sequences amplified in multidrug-resistant KB carcinoma cells. Proc. Natl Acad. Sci. USA,83, 4538-4542. MEDLINE Abstract

21. Kimura, A., Yuge, K., Kosai, K.I., Kage, M., Fujisawa, T., Inoue, T., Yamashita, Y., Nakashima, E. and Kato, H. (1995) Neonatal cholestasis in two siblings: a variant of Dubin-Johnson syndrome? J. Paediatr. Child Health, 31, 557-560. MEDLINE Abstract

22. Kartenbeck, J., Leuschner, U., Mayer, R. and Keppler, D. (1996) Absence of the canalicular isoform of the MRP gene-encoded conjugate export pump from the hepatocytes in Dubin-Johnson syndrome. Hepatology, 23, 1061-1066. MEDLINE Abstract

23. Paulsma, C.C, Kool, M., Bosma, P.J., Scheffer, G.I., Bork, F., Scheper, R.J., Tygat, G.N.J., Borst, P., Baas,.F. and Oude Elgerink, J. (1997) A mutaion in the human canalicular multispecific organic anion transporter gene causes the Dubin-Johnson syndrome. Hepatology, 25, 1539-1542.

24. Welsh, M.J. and Smith, A.E. (1993) Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis. Cell, 73, 1251-1254. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +81 92 642 6100; Fax: +81 92 642 6203; Email: wada@biochem1.med.kyushu-u.ac.jp

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 6 Jan 1998
Copyright© Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Drug Metab. Dispos.Home page
K. Heredi-Szabo, H. Glavinas, E. Kis, D. Mehn, G. Bathori, Z. Veres, L. Kobori, O. von Richter, K. Jemnitz, and P. Krajcsi
Multidrug Resistance Protein 2-Mediated Estradiol-17{beta}-D-glucuronide Transport Potentiation: In Vitro-in Vivo Correlation and Species Specificity
Drug Metab. Dispos., April 1, 2009; 37(4): 794 - 801.
[Abstract] [Full Text] [PDF]

Home page
 Adv. Physiol. Educ.Home page
Y. Tarmalinggam and E. S. Prakash
How Does Conjugated Bilirubin Appear in the Bloodstream?
Advan Physiol Educ, December 1, 2007; 31(4): 370 - 371.
[Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
P. Surowiak, V. Materna, I. Kaplenko, M. Spaczynski, B. Dolinska-Krajewska, E. Gebarowska, M. Dietel, M. Zabel, and H. Lage
ABCC2 (MRP2, cMOAT) Can Be Localized in the Nuclear Membrane of Ovarian Carcinomas and Correlates with Resistance to Cisplatin and Clinical Outcome
Clin. Cancer Res., December 1, 2006; 12(23): 7149 - 7158.
[Abstract] [Full Text] [PDF]

Home page
 International Journal of ToxicologyHome page
S. Choudhuri and C. D. Klaassen
Structure, Function, Expression, Genomic Organization, and Single Nucleotide Polymorphisms of Human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) Efflux Transporters
International Journal of Toxicology, July 1, 2006; 25(4): 231 - 259.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
K. Mutoh, J. Mitsuhashi, Y. Kimura, S. Tsukahara, E. Ishikawa, K. Sai, S. Ozawa, J.-i. Sawada, K. Ueda, K. Katayama, et al.
A T3587G germ-line mutation of the MDR1 gene encodes a nonfunctional P-glycoprotein.
Mol. Cancer Ther., April 1, 2006; 5(4): 877 - 884.
[Abstract] [Full Text] [PDF]

Home page
 Drug Metab. Dispos.Home page
H. E. Meyer zu Schwabedissen, G. Jedlitschky, M. Gratz, S. Haenisch, K. Linnemann, C. Fusch, I. Cascorbi, and H. K. Kroemer
VARIABLE EXPRESSION OF MRP2 (ABCC2) IN HUMAN PLACENTA: INFLUENCE OF GESTATIONAL AGE AND CELLULAR DIFFERENTIATION
Drug Metab. Dispos., July 1, 2005; 33(7): 896 - 904.
[Abstract] [Full Text] [PDF]

Home page
 J. Histochem. Cytochem.Home page
K. Beck, K. Hayashi, B. Nishiguchi, O. Le Saux, M. Hayashi, and C. D. Boyd
The Distribution of Abcc6 in Normal Mouse Tissues Suggests Multiple Functions for this ABC Transporter
J. Histochem. Cytochem., July 1, 2003; 51(7): 887 - 902.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
A. C. Lockhart, R. G. Tirona, and R. B. Kim
Pharmacogenetics of ATP-binding Cassette Transporters in Cancer and Chemotherapy
Mol. Cancer Ther., July 1, 2003; 2(7): 685 - 698.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. Konno, T. Ebihara, K. Hisaeda, T. Uchiumi, T. Nakamura, T. Shirakusa, M. Kuwano, and M. Wada
Identification of Domains Participating in the Substrate Specificity and Subcellular Localization of the Multidrug Resistance Proteins MRP1 and MRP2
J. Biol. Chem., June 13, 2003; 278(25): 22908 - 22917.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
M. Trauner and J. L. Boyer
Bile Salt Transporters: Molecular Characterization, Function, and Regulation
Physiol Rev, April 1, 2003; 83(2): 633 - 671.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
C. J. Oleschuk, R. G. Deeley, and S. P. C. Cole
Substitution of Trp1242 of TM17 alters substrate specificity of human multidrug resistance protein 3
Am J Physiol Gastrointest Liver Physiol, February 1, 2003; 284(2): G280 - G289.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
V. Keitel, A. T. Nies, M. Brom, J. Hummel-Eisenbeiss, H. Spring, and D. Keppler
A common Dubin-Johnson syndrome mutation impairs protein maturation and transport activity of MRP2 (ABCC2)
Am J Physiol Gastrointest Liver Physiol, January 1, 2003; 284(1): G165 - G174.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S.-Y. Cai, C. J. Soroka, N. Ballatori, and J. L. Boyer
Molecular characterization of a multidrug resistance-associated protein, Mrp2, from the little skate
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2003; 284(1): R125 - R130.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. Koike, C. J. Oleschuk, A. Haimeur, S. L. Olsen, R. G. Deeley, and S. P. C. Cole
Multiple Membrane-associated Tryptophan Residues Contribute to the Transport Activity and Substrate Specificity of the Human Multidrug Resistance Protein, MRP1
J. Biol. Chem., December 13, 2002; 277(51): 49495 - 49503.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
P. M. Gerk and M. Vore
Regulation of Expression of the Multidrug Resistance-Associated Protein 2 (MRP2) and Its Role in Drug Disposition
J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 407 - 415.
[Abstract] [Full Text] [PDF]

Home page
 Eukaryot CellHome page
C. Anjard, the Dictyostelium Sequencing Consortium, and W. F. Loomis
Evolutionary Analyses of ABC Transporters of Dictyostelium discoideum
Eukaryot. Cell, August 1, 2002; 1(4): 643 - 652.
[Abstract] [Full Text] [PDF]

Home page
 Eukaryot CellHome page
K. G. Sharma, D. L. Mason, G. Liu, P. A. Rea, A. K. Bachhawat, and S. Michaelis
Localization, Regulation, and Substrate Transport Properties of Bpt1p, a Saccharomyces cerevisiae MRP-Type ABC Transporter
Eukaryot. Cell, June 1, 2002; 1(3): 391 - 400.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Inokuchi, E. Hinoshita, Y. Iwamoto, K. Kohno, M. Kuwano, and T. Uchiumi
Enhanced Expression of the Human Multidrug Resistance Protein 3 by Bile Salt in Human Enterocytes. A TRANSCRIPTIONAL CONTROL OF A PLAUSIBLE BILE ACID TRANSPORTER
J. Biol. Chem., December 7, 2001; 276(50): 46822 - 46829.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
G. Lee, S. Dallas, M. Hong, and R. Bendayan
Drug Transporters in the Central Nervous System: Brain Barriers and Brain Parenchyma Considerations
Pharmacol. Rev., December 1, 2001; 53(4): 569 - 596.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
M. Dean, Y. Hamon, and G. Chimini
The human ATP-binding cassette (ABC) transporter superfamily
J. Lipid Res., July 1, 2001; 42(7): 1007 - 1017.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
G. L. Scheffer, M. Kool, M. Heijn, Marcel de Haas, A. C. L. M. Pijnenborg, J. Wijnholds, A. van Helvoort, M. C. de Jong, J. H. Hooijberg, C. A. A. M. Mol, et al.
Specific Detection of Multidrug Resistance Proteins MRP1, MRP2, MRP3, MRP5, and MDR3 P-Glycoprotein with a Panel of Monoclonal Antibodies
Cancer Res., September 1, 2000; 60(18): 5269 - 5277.
[Abstract] [Full Text]

Home page
 Am. J. Physiol. Renal Physiol.Home page
R. A. M. H. Van Aubel, R. Masereeuw, and F. G. M. Russel
Molecular pharmacology of renal organic anion transporters
Am J Physiol Renal Physiol, August 1, 2000; 279(2): F216 - F232.
[Abstract] [Full Text] [PDF]

Home page
 GutHome page
P L M JANSEN and M MULLER
The molecular genetics of familial intrahepatic cholestasis
Gut, July 1, 2000; 47(1): 1 - 5.
[Full Text] [PDF]

Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
D. F. Ortiz, S. Li, R. Iyer, X. Zhang, P. Novikoff, and I. M. Arias
MRP3, a new ATP-binding cassette protein localized to the canalicular domain of the hepatocyte
Am J Physiol Gastrointest Liver Physiol, June 1, 1999; 276(6): G1493 - G1500.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. Hirohashi, H. Suzuki, and Y. Sugiyama
Characterization of the Transport Properties of Cloned Rat Multidrug Resistance-associated Protein 3 (MRP3)
J. Biol. Chem., May 21, 1999; 274(21): 15181 - 15185.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
Y. Cui, J. König, U. Buchholz, H. Spring, I. Leier, and D. Keppler
Drug Resistance and ATP-Dependent Conjugate Transport Mediated by the Apical Multidrug Resistance Protein, MRP2, Permanently Expressed in Human and Canine Cells
Mol. Pharmacol., May 1, 1999; 55(5): 929 - 937.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
S. Ryu, T. Kawabe, S. Nada, and A. Yamaguchi
Identification of Basic Residues Involved in Drug Export Function of Human Multidrug Resistance-associated Protein 2
J. Biol. Chem., December 8, 2000; 275(50): 39617 - 39624.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. Mor-Cohen, A. Zivelin, N. Rosenberg, M. Shani, S. Muallem, and U. Seligsohn
Identification and Functional Analysis of Two Novel Mutations in the Multidrug Resistance Protein 2 Gene in Israeli Patients with Dubin-Johnson Syndrome
J. Biol. Chem., September 28, 2001; 276(40): 36923 - 36930.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K.-i. Ito, C. J. Oleschuk, C. Westlake, M. Z. Vasa, R. G. Deeley, and S. P. C. Cole
Mutation of Trp1254 in the Multispecific Organic Anion Transporter, Multidrug Resistance Protein 2 (MRP2) (ABCC2), Alters Substrate Specificity and Results in Loss of Methotrexate Transport Activity
J. Biol. Chem., October 5, 2001; 276(41): 38108 - 38114.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
F. Ringpfeil, M. G. Lebwohl, A. M. Christiano, and J. Uitto
Pseudoxanthoma elasticum: Mutations in the MRP6 gene encoding a transmembrane ATP-binding cassette (ABC) transporter
PNAS, May 23, 2000; 97(11): 6001 - 6006.
[Abstract] [Full Text] [PDF]

Home page
 Genome ResHome page
M. Dean, A. Rzhetsky, and R. Allikmets
The Human ATP-Binding Cassette (ABC) Transporter Superfamily
Genome Res., July 1, 2001; 11(7): 1156 - 1166.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (164)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wada, M.
Right arrow Articles by Kuwano, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wada, M.
Right arrow Articles by Kuwano, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?