| Human Molecular Genetics | Pages |
Mutations of the [alpha]2(V) chain of type V collagen impair matrix assembly and produce Ehlers-Danlos syndrome type I
Introduction
Results
Mutational analysis
Clinical phenotype
Dermal collagens
Bone collagens
Discussion
Materials And Methods
Mutational analyses
DNA sequencing
Primer extension analysis
Collagen analyses
Light and electron microscopy
Acknowledgements
References
Mutations of the [alpha]2(V) chain of type V collagen impair matrix assembly and produce Ehlers-Danlos syndrome type I
Ehlers-Danlos syndrome (EDS) is a heterogeneous connective tissue disorder that severely impairs the structure and function of the skin, joints, eyes and blood vessels. We have identified mutations of the COL5A2 gene, which encodes the [alpha]2(V) chain of type V collagen, in two unrelated patients with the severe type I form of EDS. The first proband was heterozygous for a 7 bp deletion that resulted in skipping of exon 27 while the second proband was heterozygous for a single nucleotide substitution that resulted in skipping of exon 28. Cultured dermal fibroblasts from both probands produced about equal amounts of the normal and mutant [alpha]2(V) mRNAs and protein chains. The dermis from the first proband contained a sparse collagen fibrillar network with great variability in collagen fibril sizes and shapes. The dermal collagens were also abnormally soluble. Bone cells from the first proband also produced about equal amounts of the normal and mutant [alpha]2(V) mRNAs. However, the collagen fibrillar architecture and collagen solubility of the bone matrix were normal. Our findings show that heterozygous mutations of the COL5A2 gene can produce the EDS type I phenotype. They also suggest that type V collagen plays a more important role in collagen fibrillogenesis of dermis than that of bone.
INTRODUCTION
Type V collagen is a quantitatively minor component of connective tissues that are rich in type I collagen, such as dermis, bone, tendon, ligament and cornea (1-3). It appears, however, to play a critical role in determining the diameter of the heterotypic collagen fibrils in these tissues. To explain this role, a model has been proposed in which the helical regions of the type V collagen chains are buried within the type I collagen fibrils while their aminopropeptides protrude from the surface and limit growth of the fibrils (4). Type V collagen molecules may contain [alpha]1(V), [alpha]2(V) and [alpha]3(V) chains (5,6). Trimeric type V collagen molecules of the dermis, tendon, ligament and cornea most commonly have the [alpha]1(V)2[alpha]2(V) chain composition (4,5). Type V collagen molecules with the [alpha]1(V)[alpha]2(V)[alpha]3(V) chain composition are also found in placenta while hybrid type V and XI collagen molecules with the [alpha]1(XI)2[alpha]2(V) chain composition are also found in bone (5,6).
Mutations of the COL5A1 gene (7-10), which encodes the [alpha]1(V) chain of type V collagen, have been identified in some patients with the type I and II forms of Ehlers-Danlos syndrome (EDS) (MIM 130000). Abnormal collagen fibrillogenesis is responsible for the severe dermal fragility and joint laxity that characterize these forms of EDS (9,10). It is likely that the reported mutations reduced the amount of normal type V collagen available for collagen fibrillogenesis.
Mutations of the human COL5A2 gene, which encodes the [alpha]2(V) chain of type V collagen, have not been reported previously. However, Andrikopoulos et al. (11) deleted exon 6 of the col5a2 gene, creating mice with a conformational anomaly of the aminopropeptide of the [alpha]2(V) chain of type V collagen. Homozygous pN/pN mice resembled EDS type I, with severe skin and eye abnormalities caused by the disorganization and enlargement of fibrils containing types I, III and V collagens. Heterozygous pN/wt mice lacked an apparent phenotype, although histological evidence of abnormal collagen fibrillogenesis was observed in the cornea.
In this study we report that heterozygous exon skipping mutations of human COL5A2, which alter the structure of the triple helical domain of [alpha]2(V) chains, severely impair matrix assembly in dermis but not in bone. The mutations produced the EDS type I phenotype.
RESULTS
Mutational analysis
Twenty eight unrelated individuals and families with typical EDS types I or II were screened for mutations of type V collagen (9). In a previous report linkage was found in two of the families between their mild EDS type I phenotypes and intragenic COL5A1 markers (8). In one of them a heterozygous skipping mutation of exon 65 of COL5A1 was found (8). We did not find any evidence of COL5A1 mutations in the other 26 unrelated patients using double-stranded (DSCA) and single-stranded (SSCA) conformational analyses of [alpha]1(V) cDNA prepared from cultured fibroblasts. However, in two of the 26 patients, probands EDS 3 and EDS 38, we identified abnormalities of [alpha]2(V) cDNA. Overall, 24 of the 28 individuals and families with EDS types I or II did not show evidence of [alpha]1(V) or [alpha]2(V) cDNA anomalies. They also did not show any of the anomalies of N-terminal processing of type I procollagen to collagen reported in EDS type VII or any of the type III collagen protein anomalies reported in EDS type IV (12,13).
In proband EDS 3 DSCA of a 360 bp ApaI-HinfI RT-PCR fragment, corresponding to nt 1820-2180 of the protein coding region of [alpha]2(V) cDNA (14), showed a normal sized fragment as well as a fragment lacking 54 bp (results not shown). The normal and abnormal double-stranded and single-stranded fragments from DSCA and SSCA were present in approximately equal amounts. Direct sequencing showed a heterozygous deletion of 54 bp from nt 1924 to 1977 of [alpha]2(V) cDNA. The deletion removed 18 amino acids, Gly430-Pro447 (14), from the triple helical domain of the [alpha]2(V) chain (Fig. 1). The deletion retained the translational reading frame and the Gly-Xaa-Yaa repeating structure of the triple helical domain of the mutant [alpha]2(V) chains.
Figure
The region deleted from cDNA corresponded to a 54 bp exon, which was tentatively assigned as exon 27 based on features shared with other fibrillar collagen genes (15). Proband EDS 3 was heterozygous for a 7 bp deletion of 5[prime]-agGGAGC-3[prime], which included the consensus ag dinucleotide of the 3[prime]-splice site of intron 26 and the five 5[prime] nucleotides of exon 27 (Fig. 2). The splice donor sites of intron 26 (5[prime]-AGGgtaaatatacatttt-3[prime]), intron 27 (5[prime]-CCGgtatgtgatttttgt-3[prime]) and intron 28 (5[prime]-CAGgtatgcactaattcgg-3[prime]) as well as the splice acceptor sites of intron 27 (5[prime]-ccttcacaacttagGGT-3[prime]) and intron 28 (5[prime]-cacaattttattttcttacttttgttttagGGG-3[prime]) were normal. The nature of the deletion mutation suggested that the missing splice acceptor site caused exon 27 to be skipped during splicing of the mutant [alpha]2(V) pre-mRNA. There were two other AG dinucleotides in exon 27, but they were not used as cryptic splice acceptor sites as we did not find any additional spliced products in the proband's fibroblast cDNA. Sequencing of genomic DNA from the proband's clinically normal parents showed only the normal sequence.
Figure
In proband EDS 38 DSCA of the same 360 bp ApaI-HinfI RT-PCR fragment also showed equal amounts of the normal sized fragment and a fragment lacking 54 bp (results not shown). Direct sequencing showed a heterozygous deletion of 54 bp from nt 1978 to 2031 of [alpha]2(V) cDNA which removed 18 amino acids, Gly448[rarr]Gln465 (14), from the triple helical domain of the [alpha]2(V) chain (Fig. 1). The deletion retained the translational reading frame and the Gly-Xaa-Yaa repeating structure of the triple helical domain of the mutant [alpha]2(V) chains. We also expected the 54 bp deletion in proband EDS 38 to correspond to an exon, which we tentatively assigned as exon 28 (15). Proband EDS 38 was heterozygous for a single nucleotide substitution that changed the consensus gt dinucleotide of the 5[prime]-splice donor of intron 28 to tt (Fig. 2). We concluded from the nature of the mutation that the missing splice donor site caused exon 28 to be skipped during splicing of the mutant allele of COL5A2. Primer extension analysis of genomic DNA from the clinically normal parents of proband EDS 38 showed only the normal allelic product. Analyses of genomic DNA from 50 unrelated control individuals and from 26 unrelated patients with EDS types I and II did not show either of the genomic DNA sequence anomalies identified in the probands.
Clinical phenotype
The clinical features of probands EDS 3 and EDS 38 were very similar and were typical of severe EDS type I (9). Proband EDS 3 was aged 18 years and proband EDS 38 was aged 13 years. They had severe hyperextensibility, softness, fragility and `cigarette paper' scarring of the skin, easy bruising and generalized joint laxity. The skin scarring was greatest over bony prominences such as the olecranon and tibia. Proband EDS 38 was born with club feet. Proband EDS 3 had recurrent dislocations of the shoulders and patellae. Neither child showed clinical evidence of ocular, visceral or skeletal abnormalities. In particular, there were no clinical signs of corneal or vitreous humor anomalies, although quantitative measurements were not undertaken. Radiographs of the limbs, spine, pelvis and skull of proband EDS 3 did not show any skeletal anomalies. Their parents and siblings were clinically normal.
Dermal collagens
Radiolabelled fibroblast cultures from control individuals and the probands produced type I and III collagens and a small amount of type V collagen (Fig. 3). In all cultures type V collagen was only found in the cell layer fraction. In both probands the [alpha]2(V) chain band was more diffuse than in controls. The latter finding was probably due to a mixture of normal and shortened mutant [alpha]2(V) chains. The amount of type V collagen was slightly reduced in proband EDS 3 but not in proband EDS 38.
Figure
The effects of the [alpha]2(V) collagen chain mutation on collagen assembly in dermis was studied further in proband EDS 3. Highly soluble pepsin-resistant collagens were extracted from the proband EDS 3 dermis (Fig. 3). Densitometry scanning showed that 55 ± 10, 25 ± 6 and 20 ± 5% of the total solubilized collagens were obtained from age-matched control dermal samples (mean ± SD, n = 20) by the first and second pepsin digestions and the final guanidine HCl extraction respectively (Fig. 3). The corresponding yields of 93, 5 and 2% from the proband EDS 3 dermis were >2 SD outside the control means. The extraction procedures solubilized all of the collagen from the control and EDS samples, as electrophoresis of cyanogen bromide cleavage products from the final residue did not show any type I, III or V collagen peptides. Half or more of the collagen chains in the EDS and control dermal extracts were covalently crosslinked to form dimeric, trimeric or polymeric complexes (Fig. 3). In proband EDS 3 50 and 59% of the collagen chains were covalently crosslinked in the first and second pepsin digests respectively. These values did not differ significantly from the corresponding values of 51 ± 9 and 52 ± 8% in control individuals (n = 20). Sixty four per cent of the collagen chains in the guanidine HCl extract of proband EDS 3 dermis were crosslinked, mostly as polymeric complexes. The latter percentage was >2 SD above the control mean of 45 ± 8% (n = 20). Although individual lysine-derived crosslinks were not directly measured, our observations suggested that the increased solubility of theDS dermal collagen was not due to impaired formation of intramolecular and intermolecular lysine-derived covalent crosslinks. The dermis from control individuals and proband EDS 3 did not differ significantly in their type I and III collagen compositions. Age-matched control dermis (n = 20) contained 65 ± 9% type I, 30 ± 8% type III and <5% type V collagens while the proband EDS 3 dermis contained 61% type I, 39% type III and <5% type V. We were unable to accurately compare the amounts of type V collagen in the control and EDS dermis because it was only present in very small amounts in both. We were also unable to quantify the amount of mutant type V collagen in the EDS dermis. Light microscopy showed that the EDS dermis was of normal thickness when compared with age- and site-matched dermis. In contrast to the uniform dense packing of collagen fibrils in site- and age-matched normal reticular dermis, however, the collagen fibrils in the EDS reticular dermis were widely spaced (Fig. 4). Granular reticular material was present between the EDS fibrils. The EDS fibrils were extremely variable in size and shape (Fig. 4). Some fibrils were small and round, others were of more normal size and some were abnormally large and irregular. The EDS collagen fibrils had normal periodicities in longitudinal sections and the fibroblasts were normal in appearance.
Figure
The loose packing of the collagen fibrils in the EDS dermis indicated that the concentration of the fibrillar collagens was reduced. As the proportions of type I to III collagens in the total collagen extracts were not significantly different from control values, it was likely the concentrations of type I and III collagens were both reduced in EDS dermis.
Bone collagens
Cultured bone cells from proband EDS 3 produced approximately equal amounts of mutant [alpha]2(V) mRNA lacking exon 27 sequences and normal [alpha]2(V) mRNA. There were no other spliced products.
Serial extractions of decalcified bone from proband EDS 3 showed normal collagen solubility. Densitometry scanning of electrophoretic gels showed that 63 ± 9, 31 ± 7 and 6 ± 4% of the total solubilized collagens were obtained from age-matched control bone samples (n = 15) by the first and second pepsin digestions and the final guanidine HCl extraction respectively (Fig. 3). The corresponding yields of 65, 32 and 3% from proband EDS 3 bone were not significantly different from the control values. All of the collagen was extracted from the control and EDS bone samples, as electrophoresis of cyanogen bromide cleavage products from the final residue did not show any type I, III or V collagen peptides. The percentage of collagen chains that were crosslinked to form dimeric, trimeric or polymeric complexes also did not differ significantly in the EDS sample when compared with control values (Fig. 3). The percentages of crosslinked chains in the first and second pepsin digestions were 53 ± 9 and 52 ± 7% in control samples (n = 15) and 53% in both digests from the proband EDS 3 sample.
The control and proband EDS 3 bone contained type I and V collagens (Fig. 3). There was no detectable type III collagen after delayed reduction of disulphide bonds. The amount of type V collagen in control and proband EDS 3 bone was higher than in dermis but was still <5% of the total collagen. The [alpha]1(V) and [alpha]2(V) chains migrated as sharp bands in the control and EDS bone samples. The broad [alpha]2(V) collagen band found in dermal fibroblast cultures was not observed in the bone digests from proband EDS 3. We were unable to accurately compare the amounts of type V collagen in the control and EDS bone because it was only present in very small amounts in both.
Table| Forward primer- reverse primera | Forward primer sequence (5[prime][rarr]3[prime]) | Reverse primer sequence (5[prime][rarr]3[prime]) | Annealing temperature (°C) | Restriction endonucleases |
| 29-926 | CAGGAGAACCCACAGTCTAA | CCTTCAAGACCTTTGTGTCC | 60 | MboI and StyI/BglI |
| 815-1728 | ATGGAAATCCTGGTGAAGTG | TCCTGTCAAACCCCGAGCAC | 58 | ApaI and NcoI/HpaII |
| 1567-2616 | GCTCCTGGCAATCGTGGTTT | AGCATCTCCCTTCTGTCC | 58 | ApaI and HinfI |
| 2597-3627 | CAGGACAGAAGGGAGATGCT | TCCTGCTTCTCCTACACTGC | 55 | AvaI and PvuII |
| 3467-4525 | CTCCTGGTCCAAATGGTGAA | CATTGTCGATGTGTCTTGGC | 60 | EcoRV/HindIII and HinfI/HhaI/PvuII |
Light microscopy of cancellous and compact bone of EDS tibia did not reveal any anomalies (results not shown). The osteoblasts and periosteal fibroblasts were normal in appearance. Normal collagen birefringence indicated that the collagen fibres were normally packed and organized in the trabecular bone from proband EDS 3 (results not shown).
DISCUSSION
We identified two novel mutations of the COL5A2 gene in unrelated patients with EDS type I. Proband EDS 3 was heterozygous for a 7 bp deletion that we tentatively assigned as involving the splice acceptor of intron 26 and the 5[prime]-part of exon 27 (15). Exon 27 was skipped during pre-mRNA processing by dermal fibroblasts and bone cells. Proband EDS 38 was heterozygous for a single nucleotide substitution that altered the consensus gt dinucleotide of the splice donor of intron 28. Exon 28 was skipped during pre-mRNA processing by dermal fibroblasts. We concluded that these heterozygous mutations were de novo events in probands EDS 3 and EDS 38.
Several pieces of evidence showed that the observed DNA changes were the cause of the EDS phenotypes in probands EDS 3 and EDS 38. The identified mutations were not observed in the clinically normal parents, in 50 unrelated control individuals nor in 26 unrelated patients with EDS types I and II. The type of mutation is also consistent with data from other fibrillar collagen gene mutations. For example, heterozygous skipping mutations of exons 42 and 49 of COL5A1, which encode parts of the triple helical domain of the [alpha]1(V) chain of type V collagen, produce EDS type I and EDS of a mixed type respectively (9,10). Heterozygous skipping mutations of exon 27 of COL1A1 or exon 28 of COL1A2 produce perinatal lethal forms of osteogenesis imperfecta, while skipping of exon 27 of COL3A1 produces a severe form of EDS type IV (12,16).
Dermal fibroblasts from probands EDS 3 and EDS 38 produced equal amounts of the normal and mutant [alpha]2(V) mRNAs and protein chains. Consequently, it was likely that half of the type V collagen molecules of [alpha]1(V)2[alpha]2(V) chain composition contained a normal [alpha]2(V) chain while half contained a mutant [alpha]2(V) chain. The mutant molecules were probably more susceptible to degradation than the normal molecules because of the differing lengths of the helical domains of the normal [alpha]1(V) chains and the mutant [alpha]2(V) chain. We did not determine, however, the relative contributions of reduced amounts of type V collagen and of mutant type V collagen molecules to the abnormal collagen fibrillogenesis observed in the dermis. Our observation of small round fibrils and large irregular fibrils may reflect differences in the distribution of type V collagen along and around the type I and III collagen-containing fibrils (17). This proposal is consistent with a previous study that used a dominant negative mutation of the chick [alpha]1(V) collagen gene in transfected chick corneal fibroblasts (18). In the pericellular matrix the small diameter collagen fibrils had a relatively high content of type V collagen while the abnormally large diameter fibrils had a reduced content of type V collagen.
Although the collagen fibril morphology was grossly abnormal in proband EDS 3, the proportion of type I and III collagens incorporated into the fibrils and their ability to form intramolecular and intermolecular covalent crosslinks were apparently normal. Consequently, it was likely that the extreme solubility of the dermis as well as its abnormal clinical characteristics were due to loose packing of the fibrils and to their abnormal morphology.
Marked joint laxity in the probands was probably due to similar collagen fibrillar changes in the ligaments, joint capsules and tendons, although these tissues were not available for study. In contrast, there were no clinical abnormalities of the cornea, despite the relatively high content of type V collagen that is essential in this tissue for formation of small diameter collagen fibrils (4,18). The corneas of the pN/wt mouse, which was heterozygous for an exon 6 deletion of col5a2, were also clinically normal, but contained abnormally large collagen fibrils when examined by electron microscopy (11).
The probands also did not show any clinical or plain radiological evidence of bone abnormalities, despite the known presence of type V collagen and type V and XI hybrid collagen molecules in bone matrix (5). The bone cells from proband EDS 3 produced, in a similar manner to his dermal fibroblasts, about equal amounts of normal and mutant [alpha]2(V) mRNAs. However, we did not detect any pathological or biochemical changes in his bone. The lack of an apparent bone phenotype is consistent with similar observations reported in the pN/pN and pN/wt mice (11). From these observations we concluded that type V collagen plays a less significant role in collagen fibrillogenesis of bone than of dermis. Additional quantitative bone studies are needed to determine whether there is a bone phenotype, as reduced trabecular bone mass has been reported in patients with EDS type I (19).
Further studies are also needed to compare the processes of fibrillogenesis in tissues containing various forms of type V collagen. However, it is likely that normal collagen fibrillogenesis involves tissue-specific interactions between the large amounts of type I collagen, the variable amounts of type III collagen, the minor amounts of various type V collagens and type V/XI hybrid collagens as well as other matrix macromolecules (3).
MATERIALS AND METHODS
Mutational analyses
Fibroblasts were grown to confluency in the presence of ascorbate (20). Total RNA was extracted using the Trizol reagent (Gibco BRL) and cDNA was prepared from total RNA using an oligo(dT) primer (Gibco BRL). The [alpha]2(V) collagen cDNA was screened for mutations using SSCA and DSCA (21,22). The [alpha]2(V) cDNA was amplified by PCR in five overlapping regions, each of [sim]1000 bp. Primers were designed using the published [alpha]2(V) cDNA sequence (GenBank accession no. X04758) (14). In PCR reactions 25 ng cDNA were amplified in a volume of 20 µl using 50 ng each primer (Table 1 lists all primer positions and sequences) and 1 U Taq polymerase (Gibco BRL) in 1× PCR buffer (67 mM Tris-HCl, pH 8.8, 6.7 mM MgCl2, 98 mM [beta]-mercaptoethanol, 16.6 mM (NH4)2SO4, 6.7 µM EDTA, 328 µg/ml BSA, 1.5 mM dATP, 1.5 mM dGTP, 1.5 mM dTTP, 0.75 mM dCTP and 10% DMSO). All reactions were supplied with 3 µCi [32P]dCTP. The PCR conditions were denaturation at 94°C for 20 s, annealing at an appropriate temperature (Table 1) for 30 s, extension at 72°C for 40 s for 35 cycles and an additional 10 min at 72°C. The reaction products were resolved on a 0.8% low melting point agarose gel (NuSieve). Bands were excised from the gel, weighed and counted. To ensure that mutations would be detected over the entire length of the particular amplicon the PCR products were digested with restriction endonucleases to yield three or four fragments of sizes ranging between 80 and 400 bp (Table 1). Two endonucleases or sets of endonucleases which produced overlapping fragments were used on each [alpha]2(V) cDNA PCR product. Restriction digestions were undertaken in a volume of 20 µl with 10 U enzyme, 1× appropriate restriction buffer and 3000 c.p.m. PCR product. After 4 h reactions were stopped with 13 µl stop solution (Amersham) and loaded onto a 6% non-denaturing polyacrylamide gel containing 10% glycerol. For DSCA 9 µl digestion mixture were resolved and for SSCA the samples were heated to 85°C for 3 min and only 3 µl were electrophoresed. The conditions for electrophoresis were 60 W for 40 min and 250 V overnight or 60 W for 60 min, 10 W for 45 min and 40 W for 3 h. The gels were dried at 80°C for 2 h and exposed to X-ray film (Kodak) overnight.
DNA sequencing
The [alpha]2(V) cDNA clone OK 25 from the human rhabdomyosarcoma cell line A204 as well as normal [alpha]2(V) cDNA from human dermal fibroblasts were sequenced (14). The same sequences were obtained from these different cDNA sources. The organization of the COL5A2 gene, encompassing the regions corresponding to the cDNA deletions, was determined by amplification and direct sequencing of PAC genomic DNA clones containing the gene (23). The PCR primers were designed using the predetermined [alpha]2(V) cDNA sequences. The cDNA and genomic DNA PCR products were directly sequenced from low melting point agarose gel slices with the Sequenase Version 2.0 DNA sequencing kit (Amersham).
Primer extension analysis
The presence of G or T at the splice donor site of intron 28 of COL5A2 alleles was determined using primer extension analysis (24). The primer 5[prime]-ATGGAAAACCGAATTAGTGC-3[prime] derived from the intron 28 sequence was end-labelled with 15 µCi [[gamma]-32P]ATP using T4 kinase (Promega). Primer extension was undertaken using previously described methods (24). The products were resolved on a 10% denaturing polyacrylamide gel and visualized by autoradiography. Mutational analysis was also undertaken using cDNA prepared from tibial bone cell cultures of proband EDS 3.
Collagen analyses
Dermal fibroblast cultures were established from probands EDS 3 and EDS 38 and from age-matched control individuals. The cultured cells were grown to confluency and collagens were biosynthetically labelled by incorporation of L-[2,3-3H]proline in the presence of ascorbate and [beta]-aminoproprionitrile (20). The procollagens in the cell layer and medium were harvested and converted to collagen by limited pepsin digestion. The pepsin-digested collagens were resolved by 5% SDS-PAGE, examined by fluorography and quantified by densitometry.
The collagens in freeze-milled and defatted dermis and decalcified bone from proband EDS 3 and control individuals were serially solubilized by two limited pepsin digestions and extraction in 6 M guanidine HCl (20,25). The collagens solubilized by each step were resolved by 5% SDS-PAGE and Coomassie blue or silver staining and quantified by densitometry. For quantification of crosslinked collagen chains the densities of the dimeric, trimeric and polymeric complexes were combined and compared with the combined densities of the free [alpha] chains. The percentages of types I, III and V collagens in the total collagen solubilized from dermis and bone were determined by densitometry of the free [alpha]1(I), [alpha]1(III) and [alpha]1(V) chains, as previously described (25). Western blotting was undertaken using a specific polyclonal antibody to human type V collagen. Peptides released by cyanogen bromide cleavage of the dermal and bone residues following the final guanidine HCl extract were analysed by electrophoresis on 12.5% SDS-polyacrylamide gels and silver staining (26).
Light and electron microscopy
Light microscopy, birefringence microscopy and transmission electron microscopy of dermis and decalcified bone were undertaken using previously described methods (27).
ACKNOWLEDGEMENTS
We thank L.-C.Tsui for screening of a PAC library for COL5A2-containing clones, F.Ramirez for [alpha]2(V) cDNA clones as well as C.Smith and V.Edwards for the pathology studies. This work was supported by grants from the Medical Research Council of Canada, the Samuel Lunenfeld Charitable Foundation (to W.G.C.), the Lucille Markey Trust, the Trustees of the Cincinnati Children's Hospital Research Foundation (to R.J.W.) and by a Carver Clinician Scientist Award (to M.C.W.).
REFERENCES
This article has been cited by other articles:
This page is run by TARGET="_top">Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP JournalsComments and feedback: www-admin{at}oup.co.uk
Last modification: 6 Jan 1998
Copyright© Oxford University Press, 1998.
![]()
CiteULike
Connotea
Del.icio.us What's this?
![]()
![]()

![]()
![]()
![]()
C. Wittwer, H. Hamann, and O. Distl
The Candidate Gene XIRP2 at a Quantitative Gene Locus on Equine Chromosome 18 Associated with Osteochondrosis in Fetlock and Hock Joints of South German Coldblood Horses
J. Hered.,
July 1, 2009;
100(4):
481 - 486.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
R. J. Wenstrup, J. B. Florer, J. M. Davidson, C. L. Phillips, B. J. Pfeiffer, D. W. Menezes, I. Chervoneva, and D. E. Birk
Murine Model of the Ehlers-Danlos Syndrome: col5a1 HAPLOINSUFFICIENCY DISRUPTS COLLAGEN FIBRIL ASSEMBLY AT MULTIPLE STAGES
J. Biol. Chem.,
May 5, 2006;
281(18):
12888 - 12895.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
F. Segev, E. Heon, W. G. Cole, R. J. Wenstrup, F. Young, A. R. Slomovic, D. S. Rootman, D. Whitaker-Menezes, I. Chervoneva, and D. E. Birk
Structural Abnormalities of the Cornea and Lid Resulting from Collagen V Mutations
Invest. Ophthalmol. Vis. Sci.,
February 1, 2006;
47(2):
565 - 573.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
H. Chanut-Delalande, C. Bonod-Bidaud, S. Cogne, M. Malbouyres, F. Ramirez, A. Fichard, and F. Ruggiero
Development of a Functional Skin Matrix Requires Deposition of Collagen V Heterotrimers
Mol. Cell. Biol.,
July 1, 2004;
24(13):
6049 - 6057.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
N. Zoppi, R. Gardella, A. De Paepe, S. Barlati, and M. Colombi
Human Fibroblasts with Mutations in COL5A1 and COL3A1 Genes Do Not Organize Collagens and Fibronectin in the Extracellular Matrix, Down-regulate {alpha}2{beta}1 Integrin, and Recruit {alpha}v{beta}3 Instead of {alpha}5{beta}1 Integrin
J. Biol. Chem.,
April 30, 2004;
279(18):
18157 - 18168.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. Koch, F. Laub, P. Zhou, R. A. Hahn, S. Tanaka, R. E. Burgeson, D. R. Gerecke, F. Ramirez, and M. K. Gordon
Collagen XXIV, a Vertebrate Fibrillar Collagen with Structural Features of Invertebrate Collagens: SELECTIVE EXPRESSION IN DEVELOPING CORNEA AND BONE
J. Biol. Chem.,
October 31, 2003;
278(44):
43236 - 43244.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
C. Grond-Ginsbach, F. Wigger, M. Morcher, F. von Pein, A. Grau, I. Hausser, and T. Brandt
Sequence analysis of the COL5A2 gene in patients with spontaneous cervical artery dissections
Neurology,
April 9, 2002;
58(7):
1103 - 1105.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
C. Dame, I. Hausser, J. Geukens, and R. E. Brenner
Pathological Case of the Month
Arch Pediatr Adolesc Med,
November 1, 2001;
155(11):
1275 - 1276.
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
R. Bick
State-of-the-Art Review: Vascular Thrombohemorrhagic Disorders: Hereditary and Acquired
Clinical and Applied Thrombosis/Hemostasis,
July 1, 2001;
7(3):
178 - 194.
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
C. Grond-Ginsbach, R. Weber, J. Haas, E. Orberk, S. Kunz, O. Busse, I. Hausser, T. Brandt, and B. Wildemann
Mutations in the COL5A1 Coding Sequence Are Not Common in Patients With Spontaneous Cervical Artery Dissections
Stroke,
September 1, 1999;
30
(9):
e1887 - 1890.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
F. Delacoux, A. Fichard, S. Cogne, R. Garrone, and F. Ruggiero
Unraveling the Amino Acid Sequence Crucial for Heparin Binding to Collagen V
J. Biol. Chem.,
September 15, 2000;
275(38):
29377 - 29382.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
P. Bouma, W. A. Cabral, W. G. Cole, and J. C. Marini
COL5A1 Exon 14 Splice Acceptor Mutation Causes a Functional Null Allele, Haploinsufficiency of alpha 1(V) and Abnormal Heterotypic Interstitial Fibrils in Ehlers-Danlos Syndrome II
J. Biol. Chem.,
April 13, 2001;
276(16):
13356 - 13364.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
H. Chanut-Delalande, A. Fichard, S. Bernocco, R. Garrone, D. J. S. Hulmes, and F. Ruggiero
Control of Heterotypic Fibril Formation by Collagen V Is Determined by Chain Stoichiometry
J. Biol. Chem.,
June 22, 2001;
276(26):
24352 - 24359.
[Abstract]
[Full Text]
[PDF]
![]()
This Article ![]()
![]()
Abstract
![]()
FREE Full Text (PDF)
![]()
Alert me when this article is cited
![]()
Alert me if a correction is posted
![]()
Services ![]()
![]()
Email this article to a friend
![]()
Similar articles in this journal
![]()
Similar articles in ISI Web of Science
![]()
Similar articles in PubMed
![]()
Alert me to new issues of the journal
![]()
Add to My Personal Archive
![]()
Download to citation manager
![]()
Search for citing articles in:
ISI Web of Science (55)
![]()
Request Permissions ![]()
Google Scholar ![]()
![]()
Articles by Michalickova, K.
![]()
Articles by Cole, W. G.
![]()
Search for Related Content
![]()
PubMed ![]()
![]()
PubMed Citation
![]()
Articles by Michalickova, K.
![]()
Articles by Cole, W. G.
![]()
Social Bookmarking ![]()
![]()
What's this?