| Human Molecular Genetics | Pages |
Mice with an aspartylglucosaminuria mutation similar to humans replicate the pathophysiology in patients
Introduction
Results
Generation of AGA-deficient mice
Functional inactivation of the AGA gene in mutant mice
Secretion of glycoasparagines in the urine of mutant mice
Pathology
Morris water maze
Discussion
Materials And Methods
Targeting vector construction
Generation of AGA-deficient mice
Analysis of DNA and RNA
AGA activity assay
Western blot analysis
Thin-layer chromatography of urine
MRI analysis
Histology and electron microscopy
Morris water maze
Acknowledgements
References
 |
Mice with an aspartylglucosaminuria mutation similar to humans replicate the pathophysiology in patients
Aspartyglucosaminuria (AGU) is a lysosomal storage disease with autosomal recessive inheritance that is caused by deficient activity of aspartylglucosaminidase (AGA), a lysosomal enzyme belonging to the newly described enzyme family of N-terminal hydrolases. An AGU mouse model was generated by targeted disruption of the AGA gene designed to mimic closely one human disease mutation. These homozygous mutant mice have no detectable AGA activity and excrete aspartylglucosamine in their urine. Analogously to the human disease, the affected homozygous animals showed storage in lysosomes in all analyzed tissues, including the brain, liver, kidney and skin, and lysosomal storage was already detected in fetuses at 19 days gestation. Electron microscopic studies of brain tissue samples demonstrated lysosomal storage vacuoles in the neurons and glia of the neocortical and cortical regions. Magnetic resonance images (MRI) facilitating monitoring of the brains of living animals indicated cerebral atrophy and hypointensity of the deep gray matter structures of brain-findings similar to those observed in human patients. AGU mice are fertile, and up to 11 months of age their movement and behavior do not differ from their age-matched littermates. However, in the Morris water maze test, a slow worsening of performance could be seen with age. The phenotype mimics well AGU in humans, the patients characteristically showing only slowly progressive mental retardation and relatively mild skeletal abnormalities.
INTRODUCTION
Aspartylglucosaminuria (AGU) is a recessively inherited neurodegenerative lysosomal storage disease. AGU is characterized by the deficiency of aspartylglucosaminidase (AGA) (EC 3.5.1.26), a lysosomal hydrolase that catalyzes the breakdown of the N-glycosidic linkage between asparagine and N-acetylglucosamine in the ordered breakdown of glycoproteins [for reviews, see (1,2)]. We recently crystallized human AGA, and by X-ray crystallographic analyses showed that the molecular structure of the enzyme is a packed tetramer with two [alpha]- and two [beta]-subunits (3). The three-dimensional structure analyses of AGA revealed that this lysosomal enzyme belongs to a newly identified enzyme family, the N-terminal hydrolases, of which AGA is the only eukaryotic representative known so far. Human AGA cDNA and genomic DNA have been cloned and, altogether, 15 different disease-causing mutations have been described in the AGA gene (4-10). The functional consequence of the majority of mutations is misfolding of the AGA precursor polypeptide. Consequently, the proteolytic cleavage between [alpha]- and [beta]-subunits does not occur and the enzyme is not activated due to the fact that the catalytic N-terminal amino acid of the [beta]-subunit, Thr206, does not become exposed (3,11,12)
Human patients with AGU are characterized by slowly progressive mental retardation leading to severe mental impairment, mild motor clumsiness and coarse facial features (2). The basic cellular disturbance in AGU, as in many other lysosomal storage diseases, is the accumulation of hypertrophic storage lysosomes. The correlation between the lysosomal accumulation and the functional disturbance of brain cells has not been clarified in detail. Notably, the functions of other organs including the liver and kidney remain normal despite extensive storage.
Currently there is no effective therapy for AGU or other lysosomal storage diseases with central nervous system (CNS) abnormalities. Potential approaches include bone marrow transplantation, enzyme replacement therapy and gene therapy, and the evaluation of these different therapies is facilitated by animal models. With the AGA enzyme, different therapy approaches are extremely tempting, since we have shown that this very stable, soluble lysosomal enzyme migrates from cell to cell by receptor-mediated endocytosis and is also taken up by neuronal cells (13).
Recently, a mouse model for AGU, in which the targeted disruption of exon 3 resulted in a null allele, was reported (14). Here we describe the generation of AGU mice containing a mutation in exon 8, which closely mimics two human disease mutations (6,8). Affected mice exhibit enzyme deficiency, secrete aspartylglucosamine (AADG) in their urine and display characteristic histopathological changes. The abnormalities in the CNS, when monitored with magnetic resonance imaging (MRI), are indistinguishable from those observed in AGU patients. These mice should provide a valuable opportunity for detailed analysis of CNS pathogenesis and novel therapy trials.
RESULTS
Generation of AGA-deficient mice
The construct for homologous recombination in embryonic stem (ES) cells contained 8 kb of the mouse AGA gene, starting from intron 4 and ending 3 kb downstream of the stop codon. A neomycin resistance cassette (neor) was introduced into an EcoRI site of exon 8, thus interrupting the reading frame. Sixty one nucleotides of exon 8 and 450 nucleotides of intron 8 of mouse AGA are absent from the targeting construct (Fig. 1). Following the electroporation of murine J1 ES cells (15) with the targeting vector, clones that were both G418 and GANC resistant (G418R/GANCR) were screened for homologous recombination events. The predicted structure of the mutated AGA gene was confirmed by Southern blot analysis with an AGA cDNA probe outside the region of recombination containing exons 2-4 (not shown), and with a probe containing exons 4-8. The expected sizes of the genomic SacI fragments hybridizing with the exon 4-8 probe were 14 kb for the wild-type allele and 7 kb for the targeted allele (Fig. 1). Electroporation of murine J1 ES cells yielded 433 G418R/GANCR clones, 262 (52%) of which were positive for the correct recombination event. Thus the mouse AGA locus exhibited an exceptionally high targeting frequency. The enzymatic activity of the targeted ES cell clones was 56-75% of the wild-type AGA activity in ES cells. Three karyotyped J1 ES cell clones having the mutation at the AGA locus were injected into C57BL/6 donor blastocysts and re-implanted into pseudopregnant females. All of the J1-targeted lines gave rise to germline transmission. Breeding of the male chimeric mice with C57BL/6 females yielded agouti progeny, of which [sim]50% were heterozygous for the mutant AGA allele. The heterozygous mice derived from each clone appeared normal and were bred to give homozygous mice. Genotyping of the mice was performed by Southern blot analysis using DNA extracted from tails (Fig. 1C).
Figure
The homozygous AGA-deficient mice developed normally and were fully fertile. Individual mice were weighed at the age of 4-7 months, and mutant mice of both sexes had body weights 20% higher than their their age-matched wild-type and heterozygous littermates. The distribution of the genotypes of the pups born in the F2 generation was 28% of the wild-type animals, 52% of the heterozygotes and 20% of the homozygotes (n = 354), which is not significantly different from the expected 1:2:1 ratio. This indicated that there was no prenatal lethality associated with the homozygous mutant genotype. 
Functional inactivation of the AGA gene in mutant mice
Northern blot analysis of poly(A) RNA from the liver of AGA -/- mice hybridized with AGA cDNA revealed no 1.2 kb wild-type mRNA but showed a larger transcript of 3.4 kb (Fig. 2). This larger mRNA, seen also in the heterozygous samples (Fig. 2), was also detected with a neo-specific probe (not shown). Sequencing of an RT-PCR product amplified with AGA exon 7 and a neo-specific primer confirmed the existence of a readthrough transcript from exon 8 to the neo cassette (Fig. 2). Surprisingly, RT-PCR analysis of AGA -/- mRNA with AGA exon 7- and 9-specific primers yielded a mutant mRNA product that was smaller than the wild-type mRNA. Sequencing of the mutant PCR product revealed that exon 8 was totally lacking from the second mutant mRNA. Thus, homozygous mice actually produced two transcripts, the readthrough transcript and a transcript with an aberrant splice product (Fig. 2).
Figure
The enzymatic activity of the liver and brain of the homozygous, heterozygous and wild-type mice was determined from tissue homogenates of autopsy samples. No AGA activity could be detected in the homozygous mice, whereas the heterozygotes exhibited 50-70% activity of the controls. Western blot analysis of tissue homogenates of AGA -/- mice demonstrated absence of both the [alpha]- and [beta]-subunits of AGA (Fig. 3). The 24 kDa [alpha]- and 17 kDa [beta]-subunits of the wild-type AGA were detected in the samples from wild-type and heterozygous animals, whereas in the tissues of AGA -/- mice, an AGA-specific band with a mol. wt of 21 kDa was detected only occasionally (Fig. 3).
Figure
Secretion of glycoasparagines in the urine of mutant mice
In human AGU patients, stored AADG excretion is constant and thus spot urine samples can be used for specific diagnosis. We analyzed urine oligosaccharides of homozygous AGA -/-, heterozygous (+/-) and wild-type (+/+) mice by thin-layer chromatography. Homozygous AGA-deficient mice demonstrated a characteristic AADG chromatographic pattern, which compared well with a sample from a human AGU patient (Fig. 4). Consistent with the findings from human samples, no AADG was detected in the heterozygous or wild-type mice.
Figure
Pathology
Macroscopic examination and MRI of visceral organs of homozygous AGA -/- mice at the age of 6 months revealed no difference in the sizes of the liver, kidney or spleen as compared with age-matched heterozygous and wild-type mice. MRI of the brain of homozygous mice showed clear pathological changes. On T2-weighted images, the cerebrospinal fluid (CSF) spaces were prominent (Fig. 5) and the deep gray matter structures were hypointense as compared with the cortical gray matter. In contrast, the heterozygous mice had narrow CSF spaces and all gray matter structures were of equal signal intensity.
Figure
Microscopic examination was carried out on fetuses of 14 and 19 days and 6-week-old mice. Six-week-old homozygous mice showed vacuoles in 1 µm thick resin-embedded tissue sections of all the organs studied: brain, liver, kidney and skin. The vacuoles were most abundant in the astroglial cells of the cerebral cortex, but neurons also contained inclusions (Fig. 6). In the basal ganglia and thalami, both the neurons and glial cells showed abundant vacuoles. In the liver sections, the sinusoidal Kupfer cells were distended by small vacuoles. The hepatocytes also displayed vacuoles of various sizes, many of them larger than those in the Kupfer cells. In the kidney, the accumulation of small vacuoles was most evident in the cytoplasm of the visceral epithelial cells (podocytes). Skin fibroblasts also contained numerous vacuoles.
Figure
Transmission electron microscopy of tissues of 6-week-old mice demonstrated that the enlarged vacuoles were storage lysosomes, having a typical lysosomal membrane and containing small amounts of amorphous granular material and membrane fragments on an electron-clear background (Fig. 7). The diameter of the storage lysosomes varied from 0.2 to 4 µm and, in liver, vacuoles up to 8 µm could be detected. The heterozygotes did not show cellular changes differing from the control samples. The storage lysosomes were identical to those in human AGU patients (Fig. 7).
Figure
Homozygous AGA -/- fetuses of 19 days showed large numbers of vacuoles both in the hepatocytes and the sinusoidal Kupfer cells of the liver (Fig. 7E). A dramatic difference was seen in liver tissue sections of fetuses of 14 days: only a few small vacuoles could be detected per cell. Developing neural cells of the CNS of the homozygous fetuses of 19 days showed occasional cytoplasmic vacuoles (not shown). 
Morris water maze
A water maze hidden platform test was used to measure spatial navigation in the young and old wild-type and AGU mice (Fig. 8). We observed that the AGU mice found the escape platform as frequently as the wild-type mice [age, strain and age×strain: F(1,33) < 0.6, P > 0.45 for all]. However, aged AGU mice employed a slightly less accurate search strategy than the wild-type mice, since the swim distance to the platform was higher [age: F(1,33) = 0.94; strain: F(1,33) = 6.32, P = 0.017; age×strain: F(1,33) = 10.72, P = 0.002] and the spatial bias values of aged AGU mice were decreased [age: F(1,33) = 0.22 P = 0.64; strain: F(1,33) = 2.73, P = 0.11; age×strain: F(1,33) = 5.10, P = 0.03]. The swim speed was not affected by aging or genetic manipulation [age, strain and age×strain: F(1,33) < 1.0, P > 0.3 for all], suggesting that motor activity of young and aged AGU mice was normal.
Figure
DISCUSSION
Here we describe the basic characterization of a mouse model for human AGU, a defect in the glycoprotein metabolism that causes progressive brain dysfunction. Mice carrying a targeted disruption in both alleles of the AGA gene closely mimicking two reported human AGU mutations have neither wild-type mRNA nor the AGA polypeptide pattern characteristic of the active enzyme in their tissues. As a consequence of the complete enzyme deficiency, AADG is secreted into urine. Enlarged storage lysosomes can be detected in all analyzed tissues, and extensive accumulation of storage lysosomes is already present prenatally. The characteristic CNS pathology could also be observed in MRI images of living AGA -/- mice, including atrophy of cerebral hemispheres resulting in enlarged ventricles-a finding highly similar to AGU patients. Thus, this mouse model exhibits the majority of the phenotypic characteristics typically associated with human AGU.
Careful analysis of the intracellular synthesis, assembly and activation of the wild-type human and mouse enzyme in different cell systems has enhanced our understanding of the molecular pathogenesis of AGU disease (11,12,16,17). Furthermore, the crystallization and analysis of the three-dimensional structure of human AGA, resulting in the characterization of the active site and catalytic mechanism of human AGA, has provided a basis for the molecular dissection of the AGU disease (3,18). Thus, it has been possible to model the consequences of different AGU mutations on the three-dimensional structure of the AGA molecule and to confirm the predicted effects of the folding and assembly by in vitro expression of mutant cDNAs (3,11,12,18).
We mutated the mouse AGA gene in exon 8, where two human mutations result in the misfolding of the precursor and inhibition of the activation cleavage (6,8). To make certain that no wild-type mRNA could be formed through aberrant splicing, the targeting construct was designed to delete 20 amino acids from the C-terminal end of exon 8. The analysis of mutant tissue mRNA revealed both the readthrough transcript with the neo cassette and a spliced mRNA in which exon 8 was totally deleted. No AGA activity was detected in the tissues of the AGA -/- mice. The enzymatic activity in the tissues of the heterozygous animals ranged between 50 and 70% of that of the wild-type, which is in good agreement with the activity observed in lymphoblasts from human AGU carriers (19). Western blot analysis of the tissues of the homozygous AGA -/- mice did not reveal detectable amounts of the two-subunit complex characteristic of enzymatically active AGA (24 kDa [alpha], 17 kDa [beta]). However, an abnormal AGA-specific polypeptide band of 21 kDa was detected occasionally. The mechanism for synthesis of this small mutant polypeptide currently is not known, since in AGU patients with similar mutations in exon 8, only a misfolded 42 kDa precursor can be detected by overexpression of mutant AGA in COS-1 cells (6,8). Furthermore, the open reading frame of the readthrough transcript would also indicate a polypeptide close to 40 kDa, leaving the possibility that the 21 kDa aberrant polypeptide represents a product of proteolytic cleavage of the mutant precursor molecule.
In human AGU, the first signs of CNS involvement become evident between 1 and 4 years of age, and are characterized by delayed or arrested speech development. Patients usually do not learn to read or write; adult patients are moderately or profoundly mentally retarded and the life expectancy of AGU patients is 35-45 years. No disturbances in motoneuron function has been reported and the patients are able to move independently throughout their lives. No apparent mental retardation is evident in AGU mice; up to 11 months of age their movement and behavior do not differ from those of their age-matched littermates. However, in the Morris water maze, which is a test for spatial learning and memory, the aged AGU mice did not perform quite as well as the other groups tested. The slow worsening of performance with age is in agreement with the gradual progression of the mental retardation seen in human patients. No differences in the motor performance during swimming were observed in AGU mice, suggesting a normal motor coordination, which is also in agreement with the human disease. The endocrine functions and fertility of human patients are probably normal. The AGA -/- mice are fertile, and no prenatal or early postnatal lethality in homozygous mice was observed.
Before the DNA era, the diagnosis of AGU was based on the detection of glycosaminoglycans in urine and enlarged lysosomes in peripheral blood leukocytes. The enlarged lysosomes can already be found at the 8th week of fetal life (19). In our AGA -/- mice, the secretion of glycosaminoglycans in the urine was evident and, just like in human AGU patients, light and electron microscopic analysis of the tissues of these mice show extensive storage lysosomes in the brain, liver, spleen, kidney and skin. Vacuolized lysosomes were clearly present in the livers of homozygous fetuses at 19 days, whereas only few, small vacuoles could be detected in fetuses of 14 days. This implicates the rapid development of the pathophysiological changes coincident with the rapid development of the mouse fetus during the last critical stage of organogenesis. Unlike the liver, cells in brain sections of 19 day fetuses showed only scanty small vacuoles, whereas in the six-week-old mice the vacuolization in brain cells was extensive. Thus, the histopathology of brain seems to develop more slowly than that of visceral organs.
Despite CNS symptoms of AGU patients, only two detailed reports describe neuropathological changes in AGU patients (20,21). Neuronal destruction was found in the basal ganglia and thalamus, being most severe in the globi pallidi and lateral parts of the thalami. Peripheral white matter showed only slight changes, while in the periventricular white matter lack of myelin and gliosis was observed. Electron microscopic analyses of neurons revealed enlarged storage lysosomes and numerous electron-dense granular bodies. The studies were based on autopsy tissues of old patients and, therefore, some of the changes in the brains may have been secondary and age-related. The MRI analysis, facilitating the monitoring of CNS changes in living patients, demonstrated a lower signal intensity of the thalami on T2-weighted images in AGU patients as compared with healthy subjects. Furthermore, MRI has demonstrated that although AGU is primarily a gray matter disease, it also affects the white matter by delaying myelination; i.e. the signal intensity of the white matter is abnormally high on T2-weighted images (21). The MRI of AGA -/- mice of 6 months showed enlarged ventricles and hypointensity of the deep gray matter structures, thus enforcing the similarity between the pathological findings between human and mouse AGU diseases.
AGU knock-out mice provide a model of a lysosomal storage disease classified as glucoproteinoses. Recently, another mouse model for AGU was reported (14) with targeted disruption of exon 3 and resulting in a null allele. The tissue pathology of this knock-out mouse was described only from 5 months of age on, but is relatively similar to that shown this report; the mice exhibited lysosomal hypertrophy in all the visceral organs. Reporting of neurological findings focused on the motoneuron dysfunction, a feature actually atypical for AGU patients. Axonal swelling in the gracial nucleus and impaired neuromotor coordination was observed. The AGA -/- mice described in this report demonstrated microscopic pathological changes already prenatally, and distinct MRI changes of the brain were detected at 6 months of age revealing cerebral atrophy and signal intensity alterations highly similar to MRI findings in AGU patients. Since MRI analysis can be performed in living mice, the monitoring of the CNS changes by MRI should be valuable during various treatment trials in future.
Based on earlier experiences of knock-out mouse models for lysosomal storage diseases (22-25), there has been some doubt whether lysosomal storage diseases with only moderate CNS symptoms can be reproduced in mice with only a limited life span. Here we show that AGU mice clearly present with a cellular pathology similar to human AGU, thus providing an excellent model for studying the link between the enzyme deficiency and the brain pathology. It is not known whether the neuronal destruction in AGU is caused by overloading of the cells with storage lysosomes and AADG with toxic effects, or by some other secondary metabolic effect linked to AGA deficiency. A mouse model for a CNS disease is clearly needed for different therapeutical approaches, since to date no report has been published on definite curative therapy for a metabolic brain disease using animal models. Concerning potential human therapy, AGU provides an excellent model for a brain disease, since the clinical findings are very uniform in patients and, as shown here, both tissue pathogenesis and disturbed learning and memory are well replicated in the animal model produced.
MATERIALS AND METHODS
Targeting vector construction
The isolation and characterization of the mouse AGA gene has been described (16). A 3.5 kb genomic fragment carrying part of intron 4 and exons 5-8 up to an EcoRI site within exon 8 was inserted into the XhoI site of pPNT (15), thus placing the Neor cassette adjacent to the interrupted exon 8. A 5 kb genomic fragment starting at intron 8, 450 bp from the 3[prime] end of exon 8 and ending to the 3[prime]-flanking region of the AGA gene, was inserted into an EcoRI site of pPNT so that the thymidine kinase cassette was located 3[prime] of the AGA 5 kb fragment. Orientation was determined by dideoxy sequencing.
Generation of AGA-deficient mice
The targeting vector (50 µg) was linearized with HindIII and introduced into the J1 ES cells (26) (0.8 ml cuvette volume; 2×107 cells/ml) by electroporation (400 V and 25 µF) in a Bio-Rad gene pulser. The ES cells were plated on tissue culture dishes containing an irradiated mouse embryonic fibroblast feeder cell layer. After 36 h, the cells were placed in a selective medium containing 350 µg/ml of G418 (Gibco) and 2 days later switched to medium with 350 µg/ml of G418 and 2 µM of Ganciclovir (Syntex). After 8 days, colonies were picked and expanded. Some of the cells were frozen and some were used to isolate DNA for Southern blot analysis.
Analysis of DNA and RNA
Genomic DNA was isolated from ES cells and mouse tails as described previously (27). DNA was digested with SacI, subjected to agarose gel electrophoresis and blotted as described (28). The filters were hybridized with a 32P-random prime-labeled mouse AGA cDNA probe containing exons 4-8. mRNA from mouse liver was isolated from 1 g of frozen tissue using an Invitrogen mRNA isolation kit. mRNA was size-fractionated by agarose gel electrophoresis, blotted and hybridized (28) with a mouse AGA cDNA probe. The filter was stripped and rehybridized with a [beta]-actin cDNA probe (Clontech). RT-PCR analysis of RNA of the wild-type or homozygous mutant mice was carried out with a reverse transcription reaction from liver RNA using a T(17) primer followed by PCR reactions either with mouse AGA exon 7 primer (CCGTGTAGGGGATTCACCAA) and exon 9 reverse primer (CGGTTGGCTCATTGTGTAAAGA) or with the exon 7 primer and a reverse neo primer (CTCGTCAAGAAGGCGATAGAAGGC).
AGA activity assay
Liver and brain samples of the wild-type, heterozygous and homozygous AGA-deficient mice were homogenized in 3 vols (v/w) of phosphate-buffered saline and sonicated. The 20:l tissue homogenate was analyzed for AGA activity as described previously (12).
Western blot analysis
For AGA polypeptide analysis, 5 µg of liver homogenates were electrophoresed on SDS-polyacrylamide gels (29), electroblotted onto nylon membranes and immunostained according to standard protocols. The AGA-specific antibody used was an immunoglobulin fraction of guinea pig antibody to human AGA-GST fusion protein. This antibody also detects denatured mouse AGA (K. Tenhunen et al., manuscript in preparation).
Thin-layer chromatography of urine
Spot urine filters of homozygous AGA -/-, heterozygous AGA +/- and wild-type AGA +/+ mice were extracted and analyzed by thin-layer chormatography as described earlier (30).
MRI analysis
Two heterozygous (AGA+/-) and two homozygous (AGA-/-) mice were anesthesized and the MRI was performed on a Siemens Magneton Vision 1.5T imager (Siemens, Erlangen, Germany). An inductively coupled solenoid volume coil, 21 mm in inner diameter, was used for signal excitation and emission. Axial images were acquired by using a CISS sequence, with a repetition time (TR) of 12.25 ms, echo time (TE) of 5.9 ms and a flip angle of 70°. The slice thickness was 1 mm, the field of view (FOV) 80 mm and the matrix 256×256, single excitation. Coronal images were acquired by using a turbo spin echo sequence, with a TR/TE = 2000/119 ms, and a flip angle of 180°. The slice thickness was 2 mm, FOV 79 mm and the matrix 250×256, single excitation. Both of the sequences used in this study are T2-weighted. In a T2-weighted image, the relative brightness of an MRI image is controlled by the T2 time constant: tissues with high T2 values will be seen as bright areas on the image, and tissues with low T2 values as dark areas.
Histology and electron microscopy
The excised organs were fixed in phosphate (0.05 M)-buffered 2.5% glutaraldehyde solution at pH 7.2 for several hours and stored in the 0.05 M phosphate buffer until processed further. Small pieces were osmicated, dehydrated and embedded in the epoxy resin using standard methods. Semithin sections (1 µm) were stained with toluidine blue and used for the light microscopy. Ultrathin sections were contrasted with uranyl acetate and lead citrate. The sections were studied and photographed in a transmission electron microscope.
Morris water maze
Four groups of mice were tested in the Morris water maze: 4- to 5-month-old C57/BL wild-types (n = 10) and AGU homozygotes (n = 10) and 10- to 11-month-old AGU heterozygotes (n = 10) and homozygotes (n = 7). A black plastic circular pool, diameter 59 cm, and a black stainless steel square platform, 3.5×3.5 cm, 1 cm below the water surface, were used. Starting locations were labeled North, South, East and West, and mice were placed in the water facing the wall. The pool was divided into four quadrants and three annuli of equal surface area, and the escape platform was always located in the middle annulus. A computer connected to an image analyzer (HVS Image, Hampton, UK) monitored the swim pattern. The following parameters were measured: escape length, swimming speed and counter crossing during the bias test [counter crossing was defined as crossing a circular area, in which the platform had previously been located, and which was three times larger than the platform (diameter = 6.0 cm)]. The temperature of the water was kept constant throughout the experiment (21°C). Statistical analysis for the hidden platform test was made with repeated measures ANOVA, and for counter crossing with simple factorial ANOVA. Five days of hidden platform tests were performed. Five 50 s trials with 30 s recovery time were carried out each day. If the mice did not find the platform in the maximum time, they were placed on it for 5 s. The starting location was changed in every trial in a semi-random way and the position of the platform was in the Northwest quadrant of the pool. After the hidden platform test, a spatial bias test was performed with the platform removed. The mice were placed in the water for a single 50 s trial and their movement was monitored.
ACKNOWLEDGEMENTS
We thank Professor Pirkko Santavuori for helpful discussions, Dr Martin Renlund for help in the analysis of urinary oligosaccharides and Dr Hannu Sariola for reproducing the microscopic illustrations. The research was funded by The Sigrid Juselius Foundation, The Foundation of Pediatric Research, Ulla Hjelt Fond, The Academy of Finland and The Paulo Foundation.
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 6 Jan 1998
Copyright© Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
D.-A. N. W. Persaud-Sawin, A. VanDongen, and R.-M. N. Boustany
Motifs within the CLN3 protein: modulation of cell growth rates and apoptosis
Hum. Mol. Genet.,
September 1, 2002;
11(18):
2129 - 2142.
[Abstract]
[Full Text]
[PDF]
H. Putaala, R. Soininen, P. Kilpelainen, J. Wartiovaara, and K. Tryggvason
The murine nephrin gene is specifically expressed in kidney, brain and pancreas: inactivation of the gene leads to massive proteinuria and neonatal death
Hum. Mol. Genet.,
January 1, 2001;
10(1):
1 - 8.
[Abstract]
[Full Text]
[PDF]
L. Peltonen, A. Jalanko, and T. Varilo
Molecular genetics of the Finnishdisease heritage
Hum. Mol. Genet.,
September 1, 1999;
8(10):
1913 - 1923.
[Abstract]
[Full Text]
[PDF]
A. Kyttala, O. Heinonen, L. Peltonen, and A. Jalanko
Expression and Endocytosis of Lysosomal Aspartylglucosaminidase in Mouse Primary Neurons
J. Neurosci.,
October 1, 1998;
18(19):
7750 - 7756.
[Abstract]
[Full Text]
[PDF]
G. A. Johnson, G. P. Cofer, S. L. Gewalt, and L. W. Hedlund
Morphologic Phenotyping with MR Microscopy: The Visible Mouse
Radiology,
March 1, 2002;
222(3):
789 - 793.
[Abstract]
[Full Text]
[PDF]
This Article 
Abstract
FREE Full Text (PDF)
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My Personal Archive
Download to citation manager
Search for citing articles in:
ISI Web of Science (20)
Request Permissions Google Scholar
Articles by Jalanko, A.
Articles by Peltonen, L.
Search for Related Content
PubMed
PubMed Citation
Articles by Jalanko, A.
Articles by Peltonen, L.
Social Bookmarking
What's this?