Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (86)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Payne, A. M.
Right arrow Articles by Bhattacharya, S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Payne, A. M.
Right arrow Articles by Bhattacharya, S. S.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 273-277  

A mutation in guanylate cyclase activator 1A (GUCA1A) in an autosomal dominant cone dystrophy pedigree mapping to a new locus on chromosome 6p21.1
Introduction
Results
   Linkage analysis
   Candidate gene screening
Discussion
Materials And Methods
   Microsatellite and linkage analysis
   Heteroduplex analysis
   Direct sequencing
   Electrophysiology
Acknowledgements
References
Footnote

A mutation in guanylate cyclase activator 1A (GUCA1A) in an autosomal dominant cone dystrophy pedigree mapping to a new locus on chromosome 6p21.1

A mutation in guanylate cyclase activator 1A (GUCA1A) in an autosomal dominant cone dystrophy pedigree mapping to a new locus on chromosome 6p21.1

Annette M. Payne1,+, Susan M. Downes1,2,+, David A.R. Bessant1,2, Rachel Taylor2, Graham E. Holder2, Martin J. Warren1, Alan C. Bird1,2, Shomi S. Bhattacharya1,*

1Institute of Ophthalmology, Department of Molecular Genetics, 11-43 Bath Street, London EC1V 9EL, UK and 2Moorfields Eye Hospital, City Road, London EC1V 2PD, UK

Received September 24, 1997; Revised and Accepted November 20, 1997

We report a mutation (Y99C) in guanylate cyclase activator 1A (GUCA1A), the gene for guanylate cyclase activating protein (GCAP1), in a family with autosomal dominant cone dystrophy. Linkage analysis excluded all the known cone and cone-rod dystrophy loci, except the chromosome 6p21.1 region. This is known to contain the RDS gene, which is associated with dominant cone-rod dystrophy. Screening of the RDS gene by heteroduplex analysis and direct sequencing failed to demonstrate sequence changes in the coding region of this gene. The gene for GCAP1, a calcium binding protein which is highly expressed in photoreceptor outer segments, is also located in 6p21.1. It was screened for mutations, and all affected individuals showed a single base pair missense mutation (A[rarr]G) at codon 99 in exon 2 of this gene generating a tyrosine-to-cysteine change in the GCAP1 protein. This change was absent from 206 unrelated normal controls. We propose that this change would at least disrupt the EF3 handof GCAP1 thereby preventing calcium binding and consequently interfere with activation. The resulting effect on cGMP production would predictably modify the number of open cGMP gated cation channels, and could explain the ultimate demise of cone photoreceptor cells.

INTRODUCTION

The cone dystrophies are a subgroup of the inherited chorioretinal dystrophies characterized by progressive degeneration of the cone photoreceptors with preservation of rod function. Affected individuals suffer from photophobia, loss of visual acuity, colour vision and central visual field (1). In the early stage of disease electrodiagnostic testing is required to distinguish cone dystrophy from cone-rod dystrophies and macular dystrophies.

Cone dystrophies are genetically heterogeneous with loci for autosomal dominant cone dystrophy on 17p12-p13 (2,3) and X-linked cone dystrophy on Xp21.1-p11.3 (4). Deletion mapping suggests a further dominant locus on 6q25-q26 (5). Autosomal recessive pedigrees have also been observed (6). Cone-rod dystrophy has been shown to be caused by mutations in the RDS gene (on 6p21.1) (7), and as yet unidentified genes on chromosomes 19q13.3-q13.4 (8) and 17p12-p13 (9).

A four-generation British family (Fig. 1a) with typical clinical features of dominant cone dystrophy and distinctive electrophysiological findings was investigated. In total, 27 members of this family were ascertained, of whom seven were shown to be affected by clinical examination. There was some variability of expression in this pedigree. The initial symptom of reduced visual acuity associated with loss of colour vision became apparent between the ages of 20 and 40 years. Changes at the level of the retinal pigment epithelium at the macula were identified prior to visual loss. Central atrophy developed with time. Visual field testing showed central loss but preservation of peripheral visual fields, even in late disease. Electrophysiological testing revealed significant generalized loss of cone function as shown by reduction in photopic electroretinograms (ERG), and central retinal involvement as shown by reduction in pattern ERGs. Flicker responses were reduced but had a normal implicit time in all cases. Both rod and the maximal dark adapted single white flash responses, although of low amplitude, were not markedly sub-normal. In most members of the family the electro-oculogram (EOG) light induced rise was normal, but in some the rise was high (>375%). The clinical features of this family are described in detail elsewhere (S.M. Downes et al., in preparation).


Figure 1 (a) Pedigree of cone dystrophy family showing haplotypes for markers S = D6S291, D6S271 D6S282 D6S294 on chromosome 6p. (b) Lod score for markers on chromosome 6p.

RESULTS

Linkage analysis

As part of the strategy to identify the disease-causing gene in this family, initial studies focused on all known loci implicated in cone, cone rod, and macular dystrophies. Linkage analysis allowed exclusion of the loci for cone and cone-rod dystrophies on 6q, 17p and 19q (data not shown). Subsequently significant genetic linkage to the markers in the 6p21.1 region (containing the RDS gene) was obtained with a maximum two-point lod score of 3.31 (Fig. 1b).

Candidate gene screening

Since the RDS gene is in this region and is associated with cone-rod dystrophy, it was screened for mutations both by heteroduplex and direct sequencing. No changes from the published sequence in any of the three exons of the gene were found. Mutation analysis of the non-coding regions of RDS was not undertaken, as to date no mutations have been reported in these regions.

Two guanylate cyclase activating protein genes (GUCA1A and GUCA1B)were considered good candidates since they have been mapped to 6p21.1 by somatic human-hamster hybrid panel analysis and FISH (10). Furthermore, they are highly and specifically expressed in human retina where they are associated with the photoreceptor membrane (10). GUCA1A and GUCA1B have been reported to lie [sim]1 centiray distal to D6S271, the closest microsatellite marker to RDS (unpublished data).

Heteroduplex analysis of the PCR amplified exons 1, 3 and 4 of GUCA1A and all the exons of GUCA1B showed no obvious heteroduplex pattern. However, a typical heteroduplex pattern was observed when DNA from the affected individuals was amplified with the primers to exon 2 of GUCA1A (Fig. 2a). To confirm this finding direct genomic sequencing of exon 2 was undertaken. A missense change was observed at nucleotide 319 (A[rarr]G) in exon 2 of GUCA1A in all the affected individuals (Fig. 2b). This sequence change was not observed in any of the unaffected individuals from the family or any of the 206 unrelated controls by heteroduplex analysis and direct sequencing. This change leads to the expression of a cysteine in place of tyrosine in the protein sequence (Y99C). Furthermore, on sequence analysis no change from the published sequence was observed in the other exons of either gene.


Figure 2 (a) Mutation screening of exon 2 of the GUCA1A gene in this family. Heteroduplex patterns are seen in the left three lanes in affected members but not in the right three lanes from unaffected members. (b) Top: sequence of the mutated allele using forward primer demonstrates the A[rarr]G change at codon 99 indicated by N above the electropherogram. Below is the normal sequence. (c) Alignment of murine, bovine and human CGAP1 and GCAP2 sequences together with calmodulin, recoverin and calcineurin B. The equivalent residue to tyrosine (Y) at position 99, marked with an asterix, in other members of the EF hand superfamily of calcium-binding proteins is also an aromatic amino acid, either tyrosine or phenylalanine. The amino acids which code for the helices (E and F) are shown.

Discussion

This is the first report of a locus with an identified gene defect causing cone dystrophy. As important regulatory components of the phototransduction cascade, it is not surprising that a mutation in GCAP proteins would influence photoreceptor function. GCAPs are calcium binding proteins that activate the membrane bound photoreceptor guanylate cyclase(s) RetGC1 and RetGC2 (11). GCAP1 can be detected using GCAP1 antibodies in both rods and cones, although immunostaining was more intense in cone than in rod cells, parallelling the immunolocalization of RetGC1 (12). GCAP1 has been shown to directly activate guanylate cyclase (13). Consistent with this function, purified GCAP1 promotes recovery when dialysed into functionally intact rod photoreceptors during whole-cell recording (12).

It is believed that GCAPs mediate a calcium sensitive feedback mechanism that allows reversal of photoactivation of photoreceptor cells. Photons cause reduction of cytoplasmic levels of cGMP, which in turn results in a reduction of the proportion of open cGMP gated channels and cellular hyperpolarization. A reduction of calcium results in disinhibition of GCAP, activation of RetGC and consequent conversion of GTP to cGMP, thus restoring the dark state (14).

The mutation discovered in the cone dystrophy family reported here is likely to have a significant effect on the structure of GCAP1. As a member of the EF-hand-containing superfamily of Ca2+ binding proteins (15), GCAP1 displays structural similarity to calmodulin, recoverin and calcineurin B at the amino acid level. The degree of similarity between these proteins is particularly striking in the EF3 hand, most likely reflecting a highly conserved topography (Fig. 2). The mutation in GUCA1A changes the coding of tyrosine 99 to cysteine, a position which in the other members of the protein superfamily is also occupied by an aromatic amino acid, either tyrosine or phenylalanine. The reason why this position is occupied by a large aromatic side chain is revealed from a study of the structures of calmodulin (16), recoverin (17) and calcineurin B (18): the side chain fits into a hydrophobic pocket which forms part of the hydrophobic core of the C-terminal domain of the proteins (Fig. 3). Thus changing the side chain to a smaller functionality, as with cysteine, would cause a disruption of the hydrophobic packing below the EF3 hand (Fig. 3) and perhaps the whole of the C-terminal domain and consequently would prevent GCAP1 from binding calcium at least in the EF3 hand. The inability to bind calcium could allow the mutant GCAP1 to remain permanently activated, or alternatively the mutation could totally destroy GCAP1 functionality.


Figure 3 Structural representation of recoverin and the EF3 hand. (a) Recoverin consists of a bidomain structure (17), similar to though not as extended as calmodulin (16), where the EF3 and EF4 hands are located in the C-terminal domain. (b) The EF3 hand consists of the amino acids shown in Figure 2. In GCAP1, the sequence identity over this region with recoverin is 61% with 87% similarity and thus the topology of the GCAP1 EF3 hand is likely to be very similar to that of recoverin. The EF3 hand binds calcium mainly through the interaction of a number of oxygen ligands which are found in the loop that connects the E and F helices. The relative position of the tyrosine in the EF3 hand which is mutated in GCAP1 in the cone dystrophy family is highlighted.

Deleterious mutations in GCAP1 would therefore be predicted to lead to an aberrant change in the concentration of cGMP (high or low). Low levels of cGMP caused by mutations in Ret-GC1 have been shown to cause Leber congenital amaurosis, a recessive condition which results in blindness or near blindness at birth (19). In addition the rd-chicken (with a cone-rich retina) has an autosomal recessive retinal degeneration and defects in the guanylate cyclase/GCAP1 modulatory unit. In this mutant, both rods and cones degenerate simultaneously. Biochemical analysis has shown that cGMP levels in the rd photoreceptors are abnormally low before the onset of degeneration, thus supporting evidence for a defect in GCAP1/Ret-GC1 function (12,20). There is evidence that high levels of cGMP due to mutations in PDE[beta] can cause photoreceptor death in a variety of species (21,22). It remains to be shown what disease mechanism underlies a proportion of GCAP1 protein molecules carrying this change. In vitro mutagenesis and biochemical analysis of the mutant protein are under investigation.

The observation that the Y99C mutation produces degeneration exclusively or predominantly of cones suggests either that this particular mutation is more deleterious in cone cells than in rod cells [as can be observed when different mutations of the RDS gene producing macular dystrophy and retinitis pigmentosa (23)], or that GCAP1 is more important to cones than rods. The second possibility is supported by the observation of higher expression of GCAP1 in cones rather than in rods (12).

MATERIALS AND METHODS

Peripheral blood was taken from a pedigree previously identified as suffering from an autosomal dominant cone dystrophy. The pedigree is shown in Figure 1a. Peripheral blood was also collected from 206 unrelated normal individuals to act as controls.

Genomic DNA was extracted using the Nucleon II extraction kit (Scotlab Bioscience). This DNA was used to perform both mutation analysis and microsatellite polymerase chain reactions (PCR).

Microsatellite and linkage analysis

Genomic DNA was amplified using primers that specifically amplify the polymorphic microsatellite poly(CA) regions identified by markers as detailed in Figure 1. PCR products were separated by non-denaturing polyacrylamide gel electrophoresis (Protogel, National Diagnostics), and visualized under UV illumination after staining with ethidium bromide. Alleles were assigned to individuals which allowed calculation of LOD scores using the LINKSYS 3.1 software programme. Allele frequencies were calculated from the spouses in this family. The phenotype was analysed as an autosomal dominant trait, with complete penetrance, and a frequency of 0.0001 for the affected allele.

Heteroduplex analysis

Genomic DNA was amplified using primers that allowed amplification of the complete coding region of RDS, GCAP1 and GCAP2. The primers for RDS are previously published (24); the GCAP1 and GCAP2 primers are as follows (forward/reverse, 5[prime]-3[prime]): GUCA1A, exon 1, ggcctgtccatctcagacgtccccagctggtgaggcttccag (310 bp); exon 2, gcctgaggctggagtgagcgctaaccctgggctctcagttcc (278 bp); exon 3, cctgagataggataaggatggaccccacatccat- ggtgacc (203 bp); exon 4, ctggactgcagaaatgaacaccctcggcgagctaagcctctgagttc (330 bp); GUCA1B exon 1, tcaggcctcctggaaaggcaggtggactggccactggtc (305 bp); exon 2, agaagccctgtgtttgcaggttgtggc- caaccttcagagc (303 bp); exon 3, ggaagtggtgctgggggatggacgtgcggccagaaagtgg (272 bp); exon 4, catcctgggagcgaggtctctagccaggaccctcctactac (281 bp). Annealing temperatures for all primers was 58°C. PCR reaction mix contained buffer containing 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 0.01% (w/v) gelatin, 160 µM of each primer and 0.5 U Taq DNA polymerase (Promega). The amplified exons were analysed by electrophoresis using MDE gel run at 180 V overnight using Hoeffer 600S apparatus (25).

Direct sequencing

Products of PCR amplification of the three genes were sequenced using the PRISM[trade] Ready Reaction Sequencing Kit (Perkin Elmer Cetus) and the products were analysed on an ABI 373 automated sequencer.

Electrophysiology

Subjects underwent electrophysiological investigation using a protocol in accord with the International Standard for Clinical Ophthalmology (26,27).

ACKNOWLEDGEMENTS

We would like to thank the family members for their participation in this study. This work was supported by the Medical Research Council Grant no. G9301094. We would also like to thank the Wellcome Trust for an Equipment Grant for the sequencing facility (no. 039283/2/93/Z/MW/JF).

REFERENCES

1. Weleber, R.G. and Eisner, A. (1988) Cone degeneration (`Bull's-eye dystrophies') and colour vision defects. In Newsome, D.A (ed.), Retinal Dystrophies and Degenerations. Raven Press, New York, pp. 233-256.

2. Small, K.W., Syrquin, M., Mullen, L. and Gehrs, K. (1996) Mapping of autosomal dominant cone degeneration to chromosome 17p. Am. J. Ophthalmol., 121, 13-18. MEDLINE Abstract

3. Balciuniene, J., Johanssen, K., Sandgren, O., Wachmeister, L., Holmgren, G. and Forsman G. (1995) A gene for autosomal dominant progressive cone dystrophy (CORD5) maps to chromosome 17p12-p13. Genomics, 30, 281-286. MEDLINE Abstract

4. Jacobsen, D.M., Thompson, H.S. and Bartley, J.A. (1989) X-linked progressive cone dystrophy. Clinical characteristics of affected males and female carriers. Ophthalmology, 96, 885-895.

5. McKusick, V.A. (1992) Mendelian inheritance in man, 10th edn (OMIM:online version). The John Hopkins University Press, Baltimore.

6. Krill, A.E., Deutman, A.F. and Fishman, M. (1973) The cone degenerations. Doc. Ophthalmol., 35, 1-80. MEDLINE Abstract

7. Nakazawa, M., Kikawa, E., Chida, Y., Wada, Y., Shiono, T. and Tamai M. (1996) Asn244His mutation of the peripherin/RDS gene causing autosomal dominant cone rod degeneration. Hum. Mol. Genet., 3, 1195-1196.

8. Evans, K., Fryer, A., Inglehearn, C., Duvall-Young., J., Whittaker, J.L., Gregory, C.Y., Butler, R., Ebenezer, N., Hunt, D.M. and Bhattacharya, S.S. (1994) Genetic linkage of cone-rod retinal dystrophy to chromosome 19q and evidence for segregation distortion. Nature Genet., 6, 210-213. MEDLINE Abstract

9. Kelsell, R.E., Evans, K., Gregory, C.Y., Moore, A.T., Bird, A.C. and Hunt, D.M. (1997) Localisation of a gene for dominant cone-rod dystrophy (CORD6) to chromosome 17p. Hum. Mol. Genet., 64, 597-600.

10. Surguchov, A., Bronson, J.D., Banerjee, P., Knowles, J.A., Ruiz, C., Subbaraya, I., Palczewski, K. and Baehr, W. (1997) The human GCAP1 and GCAP2 genes are arranged in a tail-to-tail array on the short arm of chromosome 6 (p21.1). Genomics, 39, 312-322. MEDLINE Abstract

11. Gorczyca, W.A., Polans, A.S., Surgeucheva, I.G., Subbaraya, I., Baehr, W. and Palczewski, K. (1995) Guanylyl cyclase activating protein. A calcium sensitive regulator of phototransduction. J. Biol. Chem., 270, 22029-22036. MEDLINE Abstract

12. Polans, A., Baehr, W. and Palczewski, K. (1996) Turned on by Ca2+. The physiology and pathology of Ca2+ binding proteins in the retina. Trends Neurosci., 19, 547-554. MEDLINE Abstract

13. Laura, R.P., Dizhoor, A.M. and Hurley, J.B. (1996) The membrane guanylyl cyclase, retinal guanylyl cyclase-1, is activated through its intracellular domain. J. Biol. Chem., 271, 11646-11651. MEDLINE Abstract

14. Dizhoor, A.M. and Hurley, J.B. (1996) Inactivation of EF-hands makes GCAP-2 (p24) a constitutive activator of photoreceptor guanylyl cyclase by preventing a Ca2+-induced `activator-to-inhibitor' transition. J. Biol. Chem., 271, 19346-19350. MEDLINE Abstract

15. Moncrief, N.D., Kretsinger, R.H. and Goodman, M. (1990) Evolution of the EF-hand calcium-modulated proteins I. Relationships based on amino acid sequences. J. Mol. Evol., 30, 522-562. MEDLINE Abstract

16. Babu, Y.S., Bugg, C.E. and Cook, W.J. (1988) Structure of calmodulin refined at 2.2A resolution. J. Mol. Biol., 204, 191-204. MEDLINE Abstract

17. Flaherty, K.M., Zozulya, S., Stryler, L. and Mackay, D.B. (1993) Three dimensional structure of recoverin, a calcium sensor in vision. Cell, 75, 709-716. MEDLINE Abstract

18. Griffiths, J.P., Kim, J.L., Kim, E.E., Sintcahk, M.D., Thomson, J.A., Fitzgibbon, M.J., Fleming, M.A., Caron, P.R., Hsiao, K. and Navia, M. (1995) X-Ray structure of calcineurin inhibited by the immunophilin-immunosuppressant FKBP12-FK506 complex. Cell, 82, 507-522.

19. Perrault, I., Rozet, J.M., Calvas, P., Gerber, S., Camuzat, A., Dollfus, H., Chatelin, S., Souied, E., Ghazi I., Leowski, C., et al). (1996) Retinal specific guanylate cyclase gene mutations in Leber's congenital amaurosis. Nature Genet., 14, 461-464. MEDLINE Abstract

20. Semple-Rowland, S.L., Gorczyca, W.A., Buczylko, J., Helekar, B.S., Ruiz, C.C., Subbaraya, I., Palczewski, K. and Baehr, W. (1996) Expression of GCAP1 and GCAP2 in the retinal degeneration (rd) mutant chicken retina. FEBS Lett., 385, 47-52. MEDLINE Abstract

21. Pittler, S.J. and Baehr, W. (1991) Identification of a nonsense mutation in the rod photoreceptor cGMP phosphodiesterase beta-subunit gene of the rd mouse. Proc. Natl Acad. Sci. USA, 88, 322-326.

22. Farber, D.B., Danciger, J.S. and Aguirre, G. (1992) The beta subunit of cyclic GMP phosphodiesterase mRNA is deficient in canine rod-cone dysplasia 1. Neuron, 9, 349-356. MEDLINE Abstract

23. Weleber, R.G., Carr, R.E., Murphey, W.H., Sheffield, V.C. and Stone, E.M. (1993) Phenotypic variation including retinitis pigmentosa, pattern dystrophy, and fundus flavimaculatus in a single family with a deletion of codon 153 or 154 of the perpherin /RDS gene. Arch. Ophthalmol., 111, 153-154.

24. Travis, G.H., Christerson, L., Danielson, P.E., Klisack, K., Sparkes, R.S., Hahn, L.B. et al). (1991) The human retinal degeneration slow (RDS) gene: Chromosome assignment and structure of the mRNA. Genomics, 10, 733-739. MEDLINE Abstract

25. Keen, J., Lester, D., Inglehearn, C., Curtis, A. and Bhattacharya, S.S. (1993) Rapid detection of single base mismatches as heteroduplexes on HydroLink gels. Trends Genet., 7, 5.

26. Marmor, M.F. and Zrenner, E. (1994) Standard for clinical electroretinography (1994 update) Doc. Ophthalmol., 89, 199-210.

27. Marmor, M.F., Holder, G.E., Porciatti, V., Trick, G. and Zrenner, E. (1996) Guidelines for pattern electroretinography. Recommendations by the International Society for Clinical Electrophysiology of Vision. Doc. Ophthalmol., 91, 291-298.

*To whom correspondence should be addressed. Tel: +44 171 608 6806; Fax: +44 171 608 6863; Email: sbhatach@hgmp.mrc.ac.uk
+These two authors contributed equally to this work

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 6 Jan 1998
Copyright© Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Arch OphthalmolHome page
K. W. Small, R. Silva-Garcia, N. Udar, E. V. Nguyen, and J. R. Heckenlively
New Mutation, P575L, in the GUCY2D Gene in a Family With Autosomal Dominant Progressive Cone Degeneration
Arch Ophthalmol, March 1, 2008; 126(3): 397 - 403.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
M. L. Woodruff, E. V. Olshevskaya, A. B. Savchenko, I. V. Peshenko, R. Barrett, R. A. Bush, P. A. Sieving, G. L. Fain, and A. M. Dizhoor
Constitutive Excitation by Gly90Asp Rhodopsin Rescues Rods from Degeneration Caused by Elevated Production of cGMP in the Dark
J. Neurosci., August 15, 2007; 27(33): 8805 - 8815.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
S. E. Haire, J. Pang, S. L. Boye, I. Sokal, C. M. Craft, K. Palczewski, W. W. Hauswirth, and S. L. Semple-Rowland
Light-Driven Cone Arrestin Translocation in Cones of Postnatal Guanylate Cyclase-1 Knockout Mouse Retina Treated with AAV-GC1.
Invest. Ophthalmol. Vis. Sci., September 1, 2006; 47(9): 3745 - 3753.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
C. L. Makino, X.-H. Wen, N. Michaud, I. V. Peshenko, B. Pawlyk, R. S. Brush, M. Soloviev, X. Liu, M. L. Woodruff, P. D. Calvert, et al.
Effects of Low AIPL1 Expression on Phototransduction in Rods
Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 2185 - 2194.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
M. Castori, E. M. Valente, M. Clementi, A. P. Tormene, F. Brancati, V. Caputo, and B. Dallapiccola
A Novel Locus for Autosomal Dominant Cone and Cone-Rod Dystrophies Maps to the 6p Gene Cluster of Retinal Dystrophies
Invest. Ophthalmol. Vis. Sci., October 1, 2005; 46(10): 3539 - 3544.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
C. Liu and M. D. Varnum
Functional consequences of progressive cone dystrophy-associated mutations in the human cone photoreceptor cyclic nucleotide-gated channel CNGA3 subunit
Am J Physiol Cell Physiol, July 1, 2005; 289(1): C187 - C198.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
I. Sokal, W. J. Dupps, M. A. Grassi, J. Brown Jr, L. M. Affatigato, N. Roychowdhury, L. Yang, S. Filipek, K. Palczewski, E. M. Stone, et al.
A Novel GCAP1 Missense Mutation (L151F) in a Large Family with Autosomal Dominant Cone-Rod Dystrophy (adCORD)
Invest. Ophthalmol. Vis. Sci., April 1, 2005; 46(4): 1124 - 1132.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. S. Kim, A. Maeda, T. Maeda, C. Heinlein, N. Kedishvili, K. Palczewski, and P. S. Nelson
Delayed Dark Adaptation in 11-cis-Retinol Dehydrogenase-deficient Mice: A ROLE OF RDH11 IN VISUAL PROCESSES IN VIVO
J. Biol. Chem., March 11, 2005; 280(10): 8694 - 8704.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
K. M. Nishiguchi, I. Sokal, L. Yang, N. Roychowdhury, K. Palczewski, E. L. Berson, T. P. Dryja, and W. Baehr
A Novel Mutation (I143NT) in Guanylate Cyclase-Activating Protein 1 (GCAP1) Associated with Autosomal Dominant Cone Degeneration
Invest. Ophthalmol. Vis. Sci., November 1, 2004; 45(11): 3863 - 3870.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. E. Coleman, Y. Zhang, G. A. J. Brown, and S. L. Semple-Rowland
Cone Cell Survival and Downregulation of GCAP1 Protein in the Retinas of GC1 Knockout Mice
Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3397 - 3403.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
S. Yoshida, A. J. Mears, J. S. Friedman, T. Carter, S. He, E. Oh, Y. Jing, R. Farjo, G. Fleury, C. Barlow, et al.
Expression profiling of the developing and mature Nrl-/- mouse retina: identification of retinal disease candidates and transcriptional regulatory targets of Nrl
Hum. Mol. Genet., July 15, 2004; 13(14): 1487 - 1503.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
E. V. Olshevskaya, P. D. Calvert, M. L. Woodruff, I. V. Peshenko, A. B. Savchenko, C. L. Makino, Y.-S. Ho, G. L. Fain, and A. M. Dizhoor
The Y99C Mutation in Guanylyl Cyclase-Activating Protein 1 Increases Intracellular Ca2+ and Causes Photoreceptor Degeneration in Transgenic Mice
J. Neurosci., July 7, 2004; 24(27): 6078 - 6085.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
M. Michaelides, I. A. Aligianis, J. R. Ainsworth, P. Good, J. D. Mollon, E. R. Maher, A. T. Moore, and D. M. Hunt
Progressive Cone Dystrophy Associated with Mutation in CNGB3
Invest. Ophthalmol. Vis. Sci., June 1, 2004; 45(6): 1975 - 1982.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
S. Ito, M. Nakamura, Y. Nuno, Y. Ohnishi, T. Nishida, and Y. Miyake
Novel Complex GUCY2D Mutation in Japanese Family with Cone-Rod Dystrophy
Invest. Ophthalmol. Vis. Sci., May 1, 2004; 45(5): 1480 - 1485.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
K. Holopigian, V. C. Greenstein, W. Seiple, D. C. Hood, and R. E. Carr
Rod and Cone Photoreceptor Function in Patients with Cone Dystrophy
Invest. Ophthalmol. Vis. Sci., January 1, 2004; 45(1): 275 - 281.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Yamazaki, H. Yu, M. Yamazaki, H. Honkawa, I. Matsuura, J. Usukura, and R. K. Yamazaki
A Critical Role for ATP in the Stimulation of Retinal Guanylyl Cyclase by Guanylyl Cyclase-activating Proteins
J. Biol. Chem., August 29, 2003; 278(35): 33150 - 33160.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
S. C. Khani, A. J. Karoukis, J. E. Young, R. Ambasudhan, T. Burch, R. Stockton, R. A. Lewis, L. S. Sullivan, S. P. Daiger, E. Reichel, et al.
Late-Onset Autosomal Dominant Macular Dystrophy with Choroidal Neovascularization and Nonexudative Maculopathy Associated with Mutation in the RDS Gene
Invest. Ophthalmol. Vis. Sci., August 1, 2003; 44(8): 3570 - 3577.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. E. Pennesi, K. A. Howes, W. Baehr, and S. M. Wu
Guanylate cyclase-activating protein (GCAP) 1 rescues cone recovery kinetics in GCAP1/GCAP2 knockout mice
PNAS, May 27, 2003; 100(11): 6783 - 6788.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
M. Michaelides, S. Johnson, A. K. Tekriwal, G. E. Holder, C. Bellmann, E. Kinning, G. Woodruff, R. C. Trembath, D. M. Hunt, and A. T. Moore
An Early-Onset Autosomal Dominant Macular Dystrophy (MCDR3) Resembling North Carolina Macular Dystrophy Maps to Chromosome 5
Invest. Ophthalmol. Vis. Sci., May 1, 2003; 44(5): 2178 - 2183.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
M. Michaelides, S. Johnson, A. Poulson, K. Bradshaw, C. Bellmann, D. M. Hunt, and A. T. Moore
An Autosomal Dominant Bull's-Eye Macular Dystrophy (MCDR2) that Maps to the Short Arm of Chromosome 4
Invest. Ophthalmol. Vis. Sci., April 1, 2003; 44(4): 1657 - 1662.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. E. Coleman, G. E. Fuchs, and S. L. Semple-Rowland
Analyses of the Guanylate Cyclase Activating Protein-1 Gene Promoter in the Developing Retina
Invest. Ophthalmol. Vis. Sci., May 1, 2002; 43(5): 1335 - 1343.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
Z. Yang, N. S. Peachey, D. M. Moshfeghi, S. Thirumalaichary, L. Chorich, Y. Y. Shugart, K. Fan, and K. Zhang
Mutations in the RPGR gene cause X-linked cone dystrophy
Hum. Mol. Genet., March 1, 2002; 11(5): 605 - 611.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
I. Sokal, N. Li, C. S. Klug, S. Filipek, W. L. Hubbell, W. Baehr, and K. Palczewski
Calcium-sensitive Regions of GCAP1 as Observed by Chemical Modifications, Fluorescence, and EPR Spectroscopies
J. Biol. Chem., November 9, 2001; 276(46): 43361 - 43373.
[Abstract] [Full Text] [PDF]

Home page
 Arch OphthalmolHome page
S. M. Downes, A. M. Payne, R. E. Kelsell, F. W. Fitzke, G. E. Holder, D. M. Hunt, A. T. Moore, and A. C. Bird
Autosomal Dominant Cone-Rod Dystrophy With Mutations in the Guanylate Cyclase 2D Gene Encoding Retinal Guanylate Cyclase-1
Arch Ophthalmol, November 1, 2001; 119(11): 1667 - 1673.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
R. J. Newbold, E. C. Deery, C. E. Walker, S. E. Wilkie, N. Srinivasan, D. M. Hunt, S. S. Bhattacharya, and M. J. Warren
The destabilization of human GCAP1 by a proline to leucine mutation might cause cone-rod dystrophy
Hum. Mol. Genet., January 1, 2001; 10(1): 47 - 54.
[Abstract] [Full Text] [PDF]

Home page
 Arch OphthalmolHome page
S. M. Downes, G. E. Holder, F. W. Fitzke, A. M. Payne, M. J. Warren, S. S. Bhattacharya, and A. C. Bird
Autosomal Dominant Cone and Cone-Rod Dystrophy With Mutations in the Guanylate Cyclase Activator 1A Gene-Encoding Guanylate Cyclase Activating Protein-1
Arch Ophthalmol, January 1, 2001; 119(1): 96 - 105.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
M. Nakamura, Y. Hotta, A. Tanikawa, H. Terasaki, and Y. Miyake
A High Association with Cone Dystrophy in Fundus Albipunctatus Caused by Mutations of the RDH5 Gene
Invest. Ophthalmol. Vis. Sci., November 1, 2000; 41(12): 3925 - 3932.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
S. Tachibanaki, K. Nanda, K. Sasaki, K. Ozaki, and S. Kawamura
Amino Acid Residues of S-modulin Responsible for Interaction with Rhodopsin Kinase
J. Biol. Chem., February 4, 2000; 275(5): 3313 - 3319.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
I. B. Griesinger, P. A. Sieving, and R. Ayyagari
Autosomal Dominant Macular Atrophy at 6q14 Excludes CORD7 and MCDR1/PBCRA Loci
Invest. Ophthalmol. Vis. Sci., January 1, 2000; 41(1): 248 - 255.
[Abstract] [Full Text]

Home page
 IOVSHome page
G. L. Fain and J. E. Lisman
Light, Ca2+, and Photoreceptor Death: New Evidence for the Equivalent-Light Hypothesis from Arrestin Knockout Mice
Invest. Ophthalmol. Vis. Sci., November 1, 1999; 40(12): 2770 - 2772.
[Full Text] [PDF]

Home page
 J. Med. Genet.Home page
A. M Payne, S. M Downes, D. A R Bessant, C. Plant, T. Moore, A. C Bird, and S. S Bhattacharya
Genetic analysis of the guanylate cyclase activator 1B (GUCA1B) gene in patients with autosomal dominant retinal dystrophies
J. Med. Genet., September 1, 1999; 36(9): 691 - 693.
[Abstract] [Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. L. Tucker, S. C. Woodcock, R. E. Kelsell, V. Ramamurthy, D. M. Hunt, and J. B. Hurley
Biochemical analysis of a dimerization domain mutation in RetGC-1 associated with dominant cone-rod dystrophy
PNAS, August 3, 1999; 96(16): 9039 - 9044.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
R.-B. Yang, S. W. Robinson, W.-H. Xiong, K.-W. Yau, D. G. Birch, and D. L. Garbers
Disruption of a Retinal Guanylyl Cyclase Gene Leads to Cone-Specific Dystrophy and Paradoxical Rod Behavior
J. Neurosci., July 15, 1999; 19(14): 5889 - 5897.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
I. Sokal, A. E. Otto-Bruc, I. Surgucheva, C. L. M. J. Verlinde, C.-K. Wang, W. Baehr, and K. Palczewski
Conformational Changes in Guanylyl Cyclase-activating Protein 1 (GCAP1) and Its Tryptophan Mutants as a Function of Calcium Concentration
J. Biol. Chem., July 9, 1999; 274(28): 19829 - 19837.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. B. Ames, A. M. Dizhoor, M. Ikura, K. Palczewski, and L. Stryer
Three-dimensional Structure of Guanylyl Cyclase Activating Protein-2, a Calcium-sensitive Modulator of Photoreceptor Guanylyl Cyclases
J. Biol. Chem., July 2, 1999; 274(27): 19329 - 19337.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. V. Olshevskaya, S. Boikov, A. Ermilov, D. Krylov, J. B. Hurley, and A. M. Dizhoor
Mapping Functional Domains of the Guanylate Cyclase Regulator Protein, GCAP-2
J. Biol. Chem., April 16, 1999; 274(16): 10823 - 10832.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. M. Krylov, G. A. Niemi, A. M. Dizhoor, and J. B. Hurley
Mapping Sites in Guanylyl Cyclase Activating Protein-1 Required for Regulation of Photoreceptor Membrane Guanylyl Cyclases
J. Biol. Chem., April 16, 1999; 274(16): 10833 - 10839.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
F. Haeseleer, I. Sokal, N. Li, M. Pettenati, N. Rao, D. Bronson, R. Wechter, W. Baehr, and K. Palczewski
Molecular Characterization of a Third Member of the Guanylyl Cyclase-activating Protein Subfamily
J. Biol. Chem., March 5, 1999; 274(10): 6526 - 6535.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. M. Dizhoor, S. G. Boikov, and E. V. Olshevskaya
Constitutive Activation of Photoreceptor Guanylate Cyclase by Y99C Mutant of GCAP-1. POSSIBLE ROLE IN CAUSING HUMAN AUTOSOMAL DOMINANT CONE DEGENERATION
J. Biol. Chem., July 10, 1998; 273(28): 17311 - 17314.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (86)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Payne, A. M.
Right arrow Articles by Bhattacharya, S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Payne, A. M.
Right arrow Articles by Bhattacharya, S. S.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?