Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (63)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mitchison, H. M.
Right arrow Articles by O'Rawe, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitchison, H. M.
Right arrow Articles by O'Rawe, A. M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 291-297  

Mutations in the palmitoyl-protein thioesterase gene (PPT; CLN1) causing juvenile neuronal ceroid lipofuscinosis with granular osmiophilic deposits
Introduction
Results
   Linkage analysis of vJNCL/GROD at the PPT (CLN1; INCL) locus
   Mutations disrupting PPT (CLN1; INCL) underlying vJNCL/GROD
   Defective PPT (CLN1; INCL) activity in vJNCL/GROD patients
Discussion
Materials And Methods
   Patient samples
   Linkage analysis
   PCR amplification of exons and direct sequencing
   Restriction endonuclease analysis
   RNA extraction and analysis
   Analysis of PPT activity
Acknowledgements
Abbreviations
References
Footnote

Mutations in the palmitoyl-protein thioesterase gene (PPT; CLN1) causing juvenile neuronal ceroid lipofuscinosis with granular osmiophilic deposits

Mutations in the palmitoyl-protein thioesterase gene (PPT; CLN1) causing juvenile neuronal ceroid lipofuscinosis with granular osmiophilic deposits

Hannah M. Mitchison1,*, Sandra L. Hofmann2, Carlos H. R. Becerra2, Patricia B. Munroe1, Brian D. Lake3, Yanick J. Crow4, John B. P. Stephenson5, Ruth E. Williams1, Irene L. Hofman6, Peter E. M. Taschner7, Jean-Jacques Martin8, Michel Philippart9, Eva Andermann10, Frederick Andermann10, Sara E. Mole1, R. Mark Gardiner1, Angela M. O'Rawe1

1Department of Paediatrics, University College London Medical School, The Rayne Institute, 5 University Street, London WC1E 6JJ, UK, 2Department of Internal Medicine and the Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, TX 75235, USA, 3Department of Histopathology, Great Ormond Street Hospital for Children, London WC1N 3JH, UK, 4Duncan Guthrie Institute of Medical Genetics and 5Department of Paediatric Neurology, The Royal Hospital for Sick Children, Yorkhill, Glasgow G3 8SJ, UK, 6Bartiméushage, PO Box 87, 3940 AB Doorn, The Netherlands, 7Department of Human Genetics, Leiden University, Wassenaarseweg 72, PO Box 9503, R2300 RA Leiden, The Netherlands, 8Department of Neurology, University of Antwerp, Universiteitsplein 1-B-2610, Antwerpen, Belgium, 9Departments of Paediatrics, Neurology and Psychiatry, UCLA School of Medicine, CA 90095-6967, USA and 10Montreal Neurological Institute and Hospital and the Centre for Human Genetics, McGill University, Montreal, Quebec H3A 2B4, Canada

Received October 6, 1997; Revised and Accepted November 11, 1997

A subtype of neuronal ceroid lipofuscinosis (NCL) is well recognized which has a clinical course consistent with juvenile NCL (JNCL) but the ultrastructural characteristics of infantile NCL (INCL): granular osmiophilic deposits (GROD). Evidence supporting linkage of this phenotype, designated vJNCL/GROD, to the INCL region of chromosome 1p32 was demonstrated (pairwise lod score with D1S211, Zmax = 2.63, [thetas]= 0.00). The INCL gene, palmitoyl-protein thioesterase (PPT; CLN1), was therefore screened for mutations in 11 vJNCL/GROD families. Five mutations in the PPT gene were identified: three missense mutations, Thr75Pro, Asp79Gly, Leu219Gln, and two nonsense mutations, Leu10STOP and Arg151STOP. The missense mutation Thr75Pro accounted for nine of the 22 disease chromosomes analysed and the nonsense mutation Arg151STOP for seven. Nine out of 11 patients were shown to combine a missense mutation on one disease chromosome with a nonsense mutation on the other. Mutations previously identified in INCL were not observed in vJNCL/GROD families. Thioesterase activity in peripheral blood lymphoblast cells was found to be markedly reduced in vJNCL/ GROD patients compared with controls. These results demonstrate that this subtype of JNCL is allelic to INCL and further emphasize the correlation which exists between genetic basis and ultrastructural changes in the NCLs.

INTRODUCTION

The childhood neuronal ceroid lipofuscinoses (NCLs) are a group of recessively inherited neurodegenerative disorders associated with progressive visual impairment, seizures, motor disturbances, dementia and premature death. There is characteristic accumulation of autofluorescent lipopigment in neurons and other cell types. Based on differences in clinical phenotype and the ultrastructural morphology of the stored material in cells, three main childhood NCL subtypes are recognized which have an infantile, late-infantile or juvenile age of onset. Ultrastructural examination of the stored material shows that granular osmiophilic deposits (GROD) are characteristic of the infantile subtype, while the late-infantile and juvenile subtypes are distinguished by curvilinear bodies and mixed curvilinear and fingerprint bodies, respectively (1,2). A number of `variant' subtypes have also been reported (3-8). Genetic loci for five childhood types of NCL have been mapped: CLN1 on chromosome 1p32 [INCL; MIM256730 (9)], CLN2 on chromosome 11p15 [classical LINCL; MIM204500 (8)], CLN3 on chromosome 16p12 [JNCL or Batten disease; MIM204200 (10)]; CLN5 on chromosome 13q21 [Finnish variant LINCL; MIM256731 (11)] and CLN6 on chromosome 15q21-23 [variant LINCL; MIM601780 (8)]. Three of the corresponding genes have been cloned. These are CLN1, the gene for infantile NCL (INCL) which encodes palmitoyl-protein thioesterase (PPT) (12), CLN2, the gene for classical late-infantile NCL (LINCL) which encodes a pepstatin-insensitive protease (13), and CLN3, the gene for juvenile NCL (JNCL) which encodes a novel protein of unknown function (14).

One variant subtype of NCL, first described in 1973 (6,15), is distinct in having a juvenile age of onset but an ultrastructural characterization that is unique to the infantile subtype, i.e. GROD without curvilinear or fingerprint bodies. This variant is designated vJNCL/GROD. The clinical characteristics of vJNCL/GROD patients that have been documented (6,16-23) and those reported here are quite variable but resemble juvenile onset NCL more closely than any other subtype. However, presentation can be with learning rather than visual difficulties in the latter half of the first decade. Visual failure soon follows and subsequent regression can be severe with progression to a vegetative state. Seizures commonly develop in the latter half of the second decade. The vJNCL/GROD variant, however, is like INCL rather than JNCL in other respects. Patients show no accumulation of subunit c of mitochondrial ATP synthase in their stored material which is a characteristic feature of JNCL (24). In addition, vacuolated lymphocytes in peripheral blood which are typical of JNCL are not documented in INCL or in vJNCL/GROD except in one unsubstantiated report (23). Storage of saposins in the stored material is a feature of NCL (25) and recent investigation has revealed that in vJNCL/GROD the storage is at levels more consistent with INCL than JNCL (B.D. Lake and J. Tyynela, unpublished data).

Previous work has shown that vJNCL/GROD is not linked to the CLN3 locus at 16p12 (26). The similarities between vJNCL/GROD and INCL have raised the possibility that defects in the CLN1 gene PPT could underly both diseases (22,23,26). Preliminary genetic linkage analysis in a group of four vJNCL/GROD families showed support for linkage to the CLN1 locus although statistically significant evidence of linkage was precluded by the limited family resource (26). Linkage analysis on an expanded resource of 11 vJNCL/GROD families in this study supports linkage to the CLN1 locus. Mutations were subsequently characterized in the PPT gene and the disease alleles in 10 vJNCL/GROD families have been identified.

RESULTS

Linkage analysis of vJNCL/GROD at the PPT (CLN1; INCL) locus

Eleven vJNCL/GROD families were used in genetic linkage analysis at the PPT (CLN1; INCL) locus on chromosome 1p32. This includes four families (54, 56, 105 and 173) used in the previous linkage study (26). The clinical features of the disease in each family are described in Table 1 and pedigree structures are shown in Figure 1a. All members of the vJNCL/GROD families were typed with markers which have the following order: ptel-(D1S255)-5 cM- (HY-TM1)-0.1 cM-[PPT(CLN1;INCL)]-0.1 cM-(D1S211)-10.5 cM-(D1S200)-pcen.

Pairwise lod scores between vJNCL/GROD and each marker are shown in Figure 1b. No recombination was observed between vJNCL/GROD and marker D1S211 and a maximum pairwise lod score of 2.63 ([thetas]= 0.00) was obtained. The size of the current family resource is too small to provide statistically significant linkage results at this marker, since three families (325, 345 and 346) provide no information.

Table 1. Clinical and ultrastructural features of vJNCL/GROD patients
Family Patient Sex Age at which deterioration documented in clinical features Histology Vacuolated lymphocytes Reference
      Intellect Motor function Vision EEG/epilepsy Ultrastructural change Tissue    
28 II 1 Male 7 7 6 - GROD Skin Not done -
28 II 2 Male - - 8a - GROD Skin Not done -
54 II 2 Female 7 7 7 - GROD Skin No 18
54 II 3 Female 7 7 7 - GROD Skin No 18
54 II 4 Female 7 7 7 - GROD Skin No 18
56 II 1 Female 7 13 10 17 GROD Conjunctiva No 20 (Case 1)
56 II 2 Female 8 10 10 17 GROD Conjunctiva Not done 20 (Case 2)
105 II 2 Female 12 13 10 15 GROD Rectum, blood ±b 23 (Case 5)
173 II 2 Female 10 - 10 14 GROD Skin, conjunctiva Not done -
208 II 3 Female 9 8 9 7 GROD Conjunctiva Not done 20 (Case 3)
325 II 1 Female 8 8 7 - GROD Rectum No -
336 II 1 Female 10 15 14 15 GROD Rectum No 21
336 II 2 Male 7 13 14 - GROD Rectum No 21
341 II 2 Female 13 13 7 14 GROD Blood No 23 (Case 3)
345 II 2 Male 12 12 7 16 GROD Rectum No 23 (Case 4)
346 II 1 Male 12 10 7 9 GROD Rectum No -
Ages indicated are approximate as the onset may precede recognition. -, no information available.
aOcular albinism diagnosed at 9 months.
bVacuoles documented on one occasion but not so on repeat examination.

Mutations disrupting PPT (CLN1; INCL) underlying vJNCL/GROD


Figure 1 (a) vJNCL/GROD pedigrees. (b) Two-point lod scores between vJNCL/GROD and markers on chromosome 1p32.

Following positive linkage results all nine exons of the PPT gene were amplified and sequenced in 11 vJNCL/GROD probands in order to look for mutations. Primer sets are detailed in Table 2. Five novel PPT mutations were identified: three missense mutations and two nonsense mutations predicted to give rise to truncated proteins (Table 3, Fig. 2). The predicted missense mutation Asp79Gly, present in proband 208, is located at the splice acceptor site of exon 3 and is due to transition of the second nucleotide of the exon (position 236) from an A to a G. RT-PCR amplification of fibroblast cell mRNA from the proband in family 208 was performed using primers in exon 2 and 6. Exons 2-6 were found to be correctly spliced indicating that the Asp79Gly mutation does not affect splicing of exon 3 (data not shown). Only the Asp79Gly mutation was observed, indicating that the nonsense mutation in exon 5 (Arg151STOP) did not amplify. This suggests that the Arg151STOP mutation causes message instability leading to a `null' allele.


Figure 2 Location of PPT mutations in vJNCL/GROD. The predicted signal peptide (SP) and lipase consensus sequences (L) of the PPT protein are shown below the cDNA. Point mutations in vJNCL/GROD are indicated. The location of two mutations in the PPT ORF described in INCL are shown in underlined italics. Mutations are designated according to Antonarakis's (1996) recommendations for a nomenclature system for human gene mutations (http://ariel.ucs.unimelb.edu.au:80/~cotton/antonara.htm).

Table 2. Primers for amplifying PPT exons
Exon PCR product size (bp) Annealing temperature (oC) Primer 5[prime][rarr]3[prime] sequence Primer 5[prime][rarr]3[prime] sequence
1 337 60 F TGAAAGCTCCAGGGTAGGG R AGATGCGAACCCAGGCTAG
2 289 56 F GATAATGCTCTTTGAGGCCTC R CTGCTGCTGAAAACACAAGG
3 291 57 F TCAGTGGTTGTTTTCAGTCCC R TCCCTTCCAAGATAGGTGACA
4 330 59 F GTTTGGGGAGTCACAGAGGA R CTCCAGCAATGCTGGCTAGT
5 220 59 F TCTCACAGTGCCTTGTGCAT R ACGGTGTCAGGTCCTGTAATCT
6 169 56 F GACCTGTAGCTTGATCACCTCA R GAACGCACATCTATGGGAGC
7 250 56 F TTGGGGAAGAAACACAGTGG R CTTACTCTCCTGGCATGTGG
8 187 60 F TTGGCAGTATGTGCTGTGTG R TTCAGGAACTGGGAGCTGAA
9a 336 59 F ACTCAGGACAAACTGCATTTTG R TTGCAAGCTGGATCTGAGCT
9b 473 59 F CTTCCAAACCACATGGGAGA R CAACGTACTCAGAGAGGAAGGC
9c 418 57 F GGTGATTTAACCAGTGCTTGG R CCTATTCTCTGCTAAAGCCAGC
9d 365 57 F TTCCATTCTCGACCAACCTG R CAGAGTGGGGACTATGATTTCC
9e 403 57 F TCCTTCTGGAGATCAACCCA R TGGCTGTACAGAAATGCACA

Table 3. Summary of mutations and their predicted effect in vJNCL/GROD
Family Origin Mutation Nucleotide change Amino acid change Location Inheritance Restriction site change
28 England Missense A223C Thr75Pro Exon 2 Maternal BbsI (loss)
    Nonsense C451T Arg151STOP Exon 5 Paternal TaqI (loss)
54 Newfoundland Missense A223C Thr75Pro Exon 2 ND BbsI (loss)
    Nonsense C451T Arg151STOP Exon 5 Paternal TaqI (loss)
56 USA Missense A223C Thr75Pro Exon 2 Maternal BbsI (loss)
    Missense A223C Thr75Pro Exon 2 Paternal BbsI (loss)
105 Scotland Missense A223C Thr75Pro Exon 2 Maternal BbsI (loss)
    Nonsense C451T Arg151STOP Exon 5 Paternal TaqI (loss)
173 Belgium Missense T656A Leu219Gln Exon 7 Paternal None
    Nonsense C451T Arg151STOP Exon 5 Maternal TaqI (loss)
208 USA Missense A236G Asp79Gly Exon 3 Maternal None
    Nonsense C451T Arg151STOP Exon 5 Paternal TaqI (loss)
325 Scotland Missense A223C Thr75Pro Exon 2 Maternal BbsI (loss)
    Nonsense T29A Leu10STOP Exon 1 Paternal BfaI (gain)
341 Scotland Missense A223C Thr75Pro Exon 2 Paternal BbsI (loss)
    Nonsense C451T Arg151STOP Exon 5 ND TaqI (loss)
345 Scotland Missense A223C Thr75Pro Exon 2 Paternal BbsI (loss)
    Nonsense T29A Leu10STOP Exon 1 Maternal BfaI (gain)
346 Scotland Missense A223C Thr75Pro Exon 2 Paternal BbsI (loss)
    Nonsense C451T Arg151STOP Exon 5 ND TaqI (loss)

For each of the five mutations, inheritance in family members was checked by use of a restriction-digest test where available, or sequencing, and the results are presented in Table 3. Mendelian inheritance of the mutations was observed in all family members. None of the missense mutations were observed in 90 or more chromosomes of unaffected control individuals, indicating that they are likely not to be polymorphisms. No mutations were detected in any of the nine PPT exons and surrounding sequence in the proband in family 336.

Defective PPT (CLN1; INCL) activity in vJNCL/GROD patients

PPT activity was measured in cytosolic extracts of immortalized peripheral blood lymphocytes (PBL) from members of three vJNCL/GROD families and compared with activities from normal, JNCL and INCL extracts. In this experiment (Table 4), one normal and two JNCL patients had normal PPT activity as compared with a reference range for nine normal controls established in the laboratory [0.93 ± 0.09 (SE) pmoles of palmitate released/min/mg of protein]. In contrast, the vJNCL/GROD patients had severely reduced activity that was indistinguishable from a reference group of nine typical US INCL patients [0.103 ± 0.02 pmol/min/mg (S. Hofmann and C. Becerra, unpublished data)]. No significant differences in PPT activity were observed amongst vJNCL/GROD patients with different PPT mutations. As expected, obligate heterozygotes had values of activity that were approximately half of those of normal controls. Immunoblotting of the cytosolic extracts of vJNCL/GROD patients showed severely reduced levels of PPT protein, although the high background of these immunoblots prevented accurate quantitation of the amount of residual PPT, if any (data not shown).

Table 4. PPT activity in peripheral blood lymphocytes of vJNCL/GROD patients
Sample type Sample name and status Thioesterase activitya
Control Normal 1.35 ± 0.08
JNCL Affected (L61Pa) 1.24 ± 0.05
JNCL Affected (L325Pa) 0.99 ± 0.18
vJNCL with GROD Family 28 father 0.52 ± 0.04
vJNCL with GROD Family 28 mother 0.24 ± 0.02
vJNCL with GROD Family 28 affected 0.03 ± 0.01
vJNCL with GROD Family 325 father 0.53 ± 0.01
vJNCL with GROD Family 325 mother 0.53 ± 0.06
vJNCL with GROD Family 325 affected 0.08 ± 0.02
vJNCL with GROD Family 346 affected 0.11 ± 0.02
JNCL and vJNCL/GROD patients are age-matched. Reference ranges were 0.93 ± 0.09 (SE) for controls (n = 9) and 0.103 ± 0.02 for US INCL subjects (n = 9).
aIn pmol of palmitate released/min/mg of protein. Results are expressed as mean activity ± SE for 2-4 determinations (see Materials and Methods).

DISCUSSION

Genetic linkage and subsequent mutational analysis presented here provides convincing evidence that PPT defects underly vJNCL/GROD. Mutations in the PPT gene have been identified on both chromosomes in all vJNCL/GROD patients except the proband in family 336. Restriction-digestion tests have been developed for the majority of the mutations characterized and this will be important for diagnosis of vJNCL/GROD in patients and carriers.

A total of five mutations in the open reading frame of PPT have been characterized. In the group of 11 vJNCL/GROD families there is discernible sharing of common mutations. The missense mutation Thr75Pro and nonsense mutation Arg151STOP are particularly common, occurring on nine and seven of the 22 disease chromosomes analysed, respectively. The nonsense mutation Leu10STOP is found on two disease chromosomes. This implies that there is a common ancestry amongst the vJNCL/GROD families, as has been reported in the other forms of NCL (11,27-30). Eight families (28, 54, 56, 105, 325, 341, 345 and 346) from the UK and North America share the mutations Thr75Pro, Arg151STOP and Leu10STOP. Five of these families are from Scotland, which is likely to contribute to this association (23). Only three families do not carry the common Thr75Pro mutation: family 208, which is of Hispanic origin and therefore the only non-Caucasian family, carries Arg151STOP and the single missense mutation Asp79Gly; family 173, from Belgium, carries Arg151STOP and the other single missense mutation Leu219Gln; family 336 carries none of these mutations. The sharing of mutations in vJNCL/GROD is striking; however, the small number of chromosomes under investigation together with the presence of common alleles at adjacent genetic loci preclude identification of statistically significant linkage disequilibrium.

The majority of the vJNCL/GROD patients are compound heterozygotes for a nonsense mutation in conjunction with a missense mutation. Family 56 is the only exception and the affected children each carry two copies of the missense mutation Thr75Pro. The nonsense mutations found in vJNCL/GROD are predicted to abolish PPT enzyme function. The Arg151STOP nonsense mutation results in no expression of the PPT mRNA, and since the other nonsense mutation Leu10STOP occurs earlier in the open reading frame it is predicted to have a similar consequence. Missense mutations in vJNCL/GROD which are found in conjunction with either nonsense mutation must have a less marked effect on function since vJNCL/GROD has a later onset and more protracted course compared with the severe infantile disease. Homologues of PPT have been described in cattle, rat and Caenorhabditis elegans (accession nos P45478, P45479 and U50313). The amino acid residues altered in vJNCL/GROD missense mutations affect PPT amino acid residues that are completely conserved (Asp79Gly and Leu219Gln) or conserved in residue type (Thr75Pro) across all species, suggesting that they are functionally important.

Results described in this paper confirm that vJNCL/GROD is allelic to INCL. However, none of the PPT mutations reported in INCL occurs in vJNCL/GROD and the two diseases each appear to be due to a distinct spectrum of mutations. Three mutations have been reported to date to cause INCL: a missense mutation Arg122Trp which is located immediately adjacent to the putative active-site serine, a mutation leading to a null allele and a nonsense mutation Lys55STOP [(12), Fig. 2]. The combination of Arg122Trp on both chromosomes or Arg122Trp in combination with the null allele mutation give rise to INCL. These mutations are all predicted to abolish thioesterase activity and this has been shown to be the case with the Arg122Trp mutation (12,31).

Of the three missense mutations characterized in vJNCL/GROD, none is located close to the active site of PPT and presumably sufficient enzyme function is preserved to delay disease onset in comparison with INCL (12,32). This situation is similar to that seen in JNCL where the typical JNCL phenotype arises in patients homozygous for nonsense mutations and a milder phenotype is observed in compound heterozygotes carrying a nonsense in conjunction with a missense mutation (33). It remains to be seen by what mechanism the presence of the Thr75Pro missense mutation on both chromosomes (patient 56) leads to a similar clinical course of disease as a nonsense mutation in conjunction with the same missense mutation (e.g. patient 54). The effect of mutations on biochemical activity of PPT will be clarified in subsequent work, for example by analysis of transient expression of mutant versus wild-type cDNA constructs in cells as was done by Vesa et al. (12). If the disease in family 336 is due to PPT defects they must lie outside the open reading frame, for example in the regulatory region, and further mutation screening is needed. Unfortunately, no material suitable for testing PPT activity was available for this family.

PPT enzyme activity is clearly greatly reduced in vJNCL/GROD when assayed in lymphocyte cells derived from patient peripheral blood. A statistically significant difference between the low levels of PPT activity observed in PBLs in vJNCL/GROD and INCL was not apparent. However, there are limitations to quantitative testing of thioesterase activity in this cell type and estimation in brain tissue where PPT expression is higher (12,34) may reveal subtle differences. In enzyme deficiencies small differences in residual enzyme activity can make the difference between a mild and severe phenotype as has been noted, for example, in Gaucher's disease where glucocerebrosidase levels overlap in the different disease types (35,36). In vJNCL/GROD even slightly raised levels of PPT activity could have a significant effect on the clinical course. Defects in PPT enzyme activity have also been reported in a variant of late-infantile NCL with GROD although the corresponding mutations have not yet been isolated (37).

The results presented in this study demonstrate that PPT mutations underly vJNCL/GROD and they provide further evidence to that presented by Sharp et al. (8) of the close correlation between ultrastructural changes and underlying molecular genetic basis in this group of diseases.

MATERIALS AND METHODS

Patient samples

DNA samples from 11 unrelated families which all fit the diagnostic criteria of vJNCL/GROD were used in this study (Table 1). The families originated from five different countries: the UK (England and Scotland), USA, Belgium, The Netherlands and Newfoundland. Genomic DNA was extracted from peripheral blood or peripheral blood lymphoblastoid cell lines (PBLs).

Linkage analysis

Family members were genotyped as described previously (8) using fluorescently labelled markers selected from those listed in the Genome Database (GDB); primer sets were supplied by Research Genetics and Genset. Map information for D1S255, HY-TM1, PPT and D1S211 was kindly provided by Dr E. Hellsten and the distance to D1S200 was obtained from GDB. Linkage analysis was carried out using LINKAGE version 5.2 (38). Fully penetrant autosomal recessive inheritance and a disease allele frequency of 0.001 was assumed. Pairwise lod scores were calculated using the LODSCORE and MLINK options.

PCR amplification of exons and direct sequencing

Primers that amplify each exon and its surrounding intron sequence were designed from genomic DNA sequence of PPT [accession no. L42809 (39)]. Since publication of the PPT genomic structure, a new intron within exon 4 has been determined and there are now nine exons in PPT which have been renamed 1-9 accordingly. The large final exon, exon 9, was amplified in five segments which encompass the polyadenylation site. Novel sequences generated in order to design primers can be found in GDB, accession nos AF022203-AF022211. PCR was performed in a final volume of 50 µl with 100 ng of genomic DNA, 0.2 µM of each primer, 0.25 mM of each dNTP, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 and 1.5 U of Taq DNA polymerase (Gibco/BRL). A `hot' start was usually performed, followed by 30 cycles of 1 min at 94°C, 1 min at 56-60°C (dependent on the primer set) and1 min at 72°C followed by 10 mins at 72°C, on a Hybaid Omnigene. The resulting products were electrophoresed in 2% agarose gels and visualized after ethidium bromide staining on a UV transilluminator. Amplified products were desalted and concentrated on Microcon-100 columns (Amicon) for direct sequencing. Sequencing was performed using Taq FS (Perkin-Elmer) and a 373A Applied Biosystems automatic sequencer, as previously described (33).

Restriction endonuclease analysis

Amplified exons were digested with the relevant endonuclease according to the manufacturer's recommendations. Samples were electrophoresed on 2% agarose gels and visualized after ethidium bromide staining on a UV transilluminator.

RNA extraction and analysis

Cytoplasmic mRNA was isolated from a skin fibroblast cell line generated from the proband in family 208 and RT-PCR performed as previously described (33) with exon 2 forward primer 5[prime]-TCCCTTAAGCATGGGTGCTA-3[prime] and exon 6 reverse primer 5[prime]-TCTGCCAAGAAGATGCTGTG-3[prime].

Analysis of PPT activity

Assays for palmitoyl-protein thioesterase activity were performed on extracts of PBLs as described (40) with the exception that a crude cytosolic fraction (100 000 g supernatant) of lymphoblasts was prepared. The samples were preincubated in the presence of 2.0 mM phenylmethanesulphonyl fluoride for 40 min at 37°C to reduce non-specific thioesterase activity, and the assays were carried out for 90 min at 37°C. The specific activity of the [3H]palmitate labelled H-Ras substrate was 331 cpm/pmol. PBLs from each individual were assayed four times with the exception of proband 28 and JNCL control L61Pa, which were assayed two and three times, respectively, due to lack of material. Immunoblotting was performed as described previously (41).

ACKNOWLEDGEMENTS

We are indebted to all the patients, their families and their physicians including Drs Mary O'Regan and Karen Naismith for their participation in this study. We are grateful to the Children's Brain Disease Foundation (USA) and the Batten Disease Support and Research Association (USA). We thank the European Collection of Cell Cultures (Porton Down) and the Oregon Health Sciences University for supplying PBLs and skin fibroblasts. We thank Mrs Keith Parker and Won Yi and Drs Jouni Vesa, Elina Hellsten, Sandra Strautnieks and Magali Williamson for expert technical help. This work was supported by the Medical Research Council (UK), the Wellcome Trust (UK), Action Research, the National Institutes of Health (USA) (NS36867) and a fellowship from Amgen to C.H.R.B.

ABBREVIATIONS

GROD, granular osmiophilic deposits; INCL, infantile neuronal ceroid lipofuscinosis; JNCL, juvenile neuronal ceroid lipofuscinosis; NCL, neuronal ceroid lipofuscinosis; PBL, peripheral blood immortalized lymphoblastoid cell lines; PPT, palmitoyl-protein thioesterase.

REFERENCES

1. Santavuori, P. (1988) Neuronal ceroid lipofuscinosis in childhood. Brain Dev., 10, 80-83.

2. Rapola, J. (1993) Neuronal ceroid-lipofuscinoses in childhood. Perspect. Pediatr. Pathol., 17, 7-44. MEDLINE Abstract

3. Lake, B.D. and Cavanagh, N.P.C. (1978) Early-juvenile Batten's disease-a recognisable subgroup distinct from other forms of Batten's disease. J. Neurol. Sci., 36, 265-271. MEDLINE Abstract

4. Santavuori, P., Rapola, J., Saino, K. and Raitta, C. (1982) A variant of Jansky-Bielschowsky disease. Neuropediatrics, 13, 135-141. MEDLINE Abstract

5. Santavuori, P., Rapola, J., Nuutila, A., Raininko, R., Lappi, M., Launes, J., Herva, R. and Saino, K. (1991) The spectrum of Jansky-Bielschowsky disease. Neuropediatrics, 22, 92-96. MEDLINE Abstract

6. Carpenter, S., Karpati, G., Wolfe, L.S. and Andermann, F. (1973) A type of juvenile cerebromacular degeneration characterised by granular osmiophilic deposits. J. Neurol. Sci., 18, 67-87. MEDLINE Abstract

7. Dyken, P. and Wisniewski, K. (1995) Classification of the neuronal ceroid-lipofuscinoses: expansion of the atypical forms. Am. J. Med. Genet., 57, 150-154. MEDLINE Abstract

8. Sharp, J.D., Wheeler, R.B., Lake, B.D., Savukowski, M., Järvelä, I.E., Peltonen, L., Gardiner, R.M. and Williams, R.E. (1997) Loci for classical and a variant late infantile neuronal ceroid lipfuscinoses map to chromosomes 11p15 and 15q21-23. Hum. Mol. Genet., 6, 591-596. MEDLINE Abstract

9. Järvelä, I., Schleutker, J., Haataja, L., Santavuori, P., Puhakka, L., Manninen, T., Palotie, A., Sandkuijl, L.A., Renlund, M., White, R., Aula, P. and Peltonen, L. (1991) Infantile form of neuronal ceroid lipofuscinosis (CLN1) maps to the short arm of chromosome 1. Genomics, 9, 170-173. MEDLINE Abstract

10. Gardiner, R.M., Sandford, A., Deadman, M., Poulton, J., Reeders, S., Jokiaho, I., Peltonen, L. and Julier, C. (1990) Batten disease (Spielmeyer-Vogt; juvenile-onset neuronal ceroid lipofuscinosis) gene (CLN3) maps to human chromosome 16. Genomics, 8, 387-390. MEDLINE Abstract

11. Savukoski, M., Kestila, M., Williams, R., Järvelä, I., Sharp, J., Harris, J., Santavuori, P., Gardiner, M. and Peltonen, L. (1994) Defined chromosomal assignment of CLN5 demonstrates that at least four genetic loci are involved in the pathogenesis of human ceroid lipofuscinoses. Am. J. Hum. Genet., 55, 695-701. MEDLINE Abstract

12. Vesa, J., Hellsten, E., Verkruyse, L.A., Camp, L.A., Rapola, J., Santavuori, P., Hofmann, S.L. and Peltonen, L. (1995) Mutations in the palmitoyl protein thioesterase gene causing infantile neuronal ceroid lipofuscinosis. Nature, 376, 584-587. MEDLINE Abstract

13. Sleat, D.E., Donnelly, R.J., Lackland, H., Liu, C.-G., Sohar, I., Pullarkat, R.K. and Lobel, P. (1997) Association of mutations in a lysosomal protein with classical late-infantile neuronal ceroid lipofuscinosis. Science, 277, 1802-1805. MEDLINE Abstract

14. The International Batten Disease Consortium (1995) Isolation of a novel gene underlying Batten disease (CLN3). Cell, 82, 949-957.

15. Carpenter, S., Karpati, G., Andermann, F., Jacob, J.C. and Andermann, E. (1977) The ultrastructural characteristics of the abnormal cytosomes in Batten-Kufs' disease. Brain, 100, 137-156. MEDLINE Abstract

16. Zeman, W. and Dyken, P. (1969) Neuronal ceroid-lipofuscinosis (Batten's disease): Relationship to amaurotic familial idiocy? Paediatrics, 44, 570-583.

17. Manca, V., Kanitakis, J., Zambruno, G., Thivolet, J. and Gonnaud, P.M. (1990) Ultrastructural study of the skin in a case of juvenile ceroid-lipofuscinosis. Am. J. Dermatopathol., 12, 412-416. MEDLINE Abstract

18. Hart, Y.M., Andermann, E., Mitchison, H.M., Gardiner, R.M., Michaud, J., Carpenter, S., Karpati, G., Wolfe, L.S. and Andermann, F. (1994) Genetic heterogeneity in juvenile NCL. Am. J. Hum. Genet., 55, A82. MEDLINE Abstract

19. Taratuto, A.L., Saccoliti, M., Sevlever, G., Ruggieri, V., Arroyo, H., Herrero, M., Massaro, M. and Fejerman, N. (1995) Childhood neuronal ceroid-lipofuscinoses in Argentina. Am. J. Med. Genet., 57, 144-149. MEDLINE Abstract

20. Philippart, M., Chugani, H.T. and Bateman, J.B. (1995) New Spielmeyer-Vogt variant with granular inclusions and early brain atrophy. Am. J. Med. Genet., 57, 160-164. MEDLINE Abstract

21. Hofman, I.L. and Taschner, P.E.M. (1995) Late onset juvenile neuronal ceroid-lipofuscinosis with granular osmiophilic deposits (GROD). Am. J. Med. Genet., 57, 165-167. MEDLINE Abstract

22. Lake, B.D., Brett, E.M. and Boyd, S.G. (1996) A form of juvenile Batten's disease with granular osmiophilic deposits. Neuropediatrics, 27, 265-269. MEDLINE Abstract

23. Crow, Y.J., Tolmie, J.L., Howatson, A.G., Patrick, W.J.A. and Stephenson, J.B.P. (1997) Batten disease in the West of Scotland 1974-1995 including five cases of the juvenile form with granular osmiophilic deposits. Neuropediatrics, 28, 140-144. MEDLINE Abstract

24. Hall, N.A., Lake, B.D., Dewji, N.N. and Patrick, A.D. (1991) Lysosomal storage of subunit c of mitochondrial ATP synthase in Batten's disease (ceroid lipofuscinosis). J. Biochem., 275, 269-272.

25. Tyynelä, J., Palmer, D.N., Baumann, M. and Haltia, M. (1993) Storage of saposins A and D in infantile neuronal ceroid-lipofuscinosis. FEBS Lett., 330, 8-12. MEDLINE Abstract

26. O'Rawe, A., Mitchison, H.M., Williams, R., Wheeler, R., Andermann, E., Andermann, F., Hart, Y.M., Martin, J.-J., Philippart, M., Stephenson, J.B.P., Gardiner, R.M. and Mole, S.E. (1997) Genetic linkage analysis of a variant of juvenile onset neuronal ceroid lipofuscinosis with granular osmiophilic deposits. Neuropediatrics, 28, 21-22. MEDLINE Abstract

27. Järvelä, I. (1991) Infantile neuronal ceroid lipofuscinosis (CLN1): linkage disequilibrium in the Finnish population and evidence that variant late infantile form (variant CLN5) represents a nonallelic locus. Genomics, 10, 333-337. MEDLINE Abstract

28. Hellsten, E., Vesa, J., Speer, M.C., Mäkelä, T.P., Järvelä, I., Alitalo, K., Ott, J. and Peltonen, L. (1993) Refined assignment of the infantile neuronal ceroid lipofuscinoses (INCL, CLN1) locus at 1p32: Incorporation of linkage disequilibrium in multipoint analysis. Genomics, 16, 720-725. MEDLINE Abstract

29. Mitchison, H.M., Thompson, A.D., Mulley, J.C., Kozman, H.M., Richards, R.I., Callen, D.F., Stallings, R.L., Doggett, N.A., Attwood, J., McKay, T.R., Sutherland, G.R. and Gardiner, R.M. (1993) Fine genetic mapping of the Batten disease locus (CLN3) by haplotype analysis and demonstration of allelic association with chromosome 16p microsatellite loci. Genomics, 16, 455-460. MEDLINE Abstract

30. Mitchison, H.M., O'Rawe, A.M., Taschner, P.E.M., Santavuori, P., de Vos, N., Breuning, M.H., Mole, S.E., Gardiner, R.M. and Järvelä, I.E. (1995) Batten disease (CLN3): Linkage disequilibrium mapping in the Finnish population and analysis of European haplotypes. Am. J. Hum. Genet., 56, 654-662. MEDLINE Abstract

31. Hellsten, E., Vesa, J., Olkkonen, V.M., Jalanko, A. and Peltonen, L. (1996) Human palmitoyl protein thioesterase: evidence for lysosomal targeting of the enzyme and disturbed cellular routing in infantile neuronal ceroid lipofuscinosis. EMBO J., 15, 5240-5245. MEDLINE Abstract

32. Witkowski, A., Witkowska, H.E. and Smith, S. (1994) Reengineering the specificity of a serine active-site enzyme. J. Biol. Chem., 269, 379-383. MEDLINE Abstract

33. Munroe, P.B., Mitchison, H.M., O'Rawe, A.M., Anderson, J.W., Boustany, R.-M., Lerner, T.J., Taschner, P.E.M., de Vos, N., Breuning, M.H., Gardiner, R.M. and Mole, S.E. (1997) Spectrum of mutations in the Batten disease gene, CLN3. Am. J. Hum. Genet., 61, 310-316. MEDLINE Abstract

34. Camp, L.A., Verkruyse, L.A., Afendis, S.J., Slaughter, C.A. and Hofmann, S.L. (1994) Molecular cloning and expression of palmitoyl-protein thioesterase. J. Biol. Chem., 269, 23212-23219. MEDLINE Abstract

35. Daniels, L.B. and Glew, R.H. (1982) Beta-glucosidase assays in the diagnosis of Gaucher's disease. Clin.l Chem., 28, 569-577.

36. Pentchev, P.G., Neumeyer, B., Svennerholm, L., Groth, C.G. and Brady, R.O. (1983) Immunological and catalytic quantitation of splenic glucocerebrosidase from the three clinical forms of Gaucher disease. Am. J. Hum. Genet., 35, 621-628. MEDLINE Abstract

37. Wisniewski, K.E., Becerra, C.R. and Hofmann, S.L. (1997) A novel granular variant (GROD) form of late infantile neuronal ceroid lipofuscinosis (CLN2) is an infantile form of NCL (CLN1) when biochemically studied. J. Neuropathol. Exp. Neurol., 56, 94.

38. Lathrop, G.M., Lalouel, J.M., Julier, C. and Ott, J. (1984) Strategies for multilocus linkage analysis in humans. Proc. Natl Acad. Sci. USA, 81, 3443-3446. MEDLINE Abstract

39. Schriner, J.E., Yi, W. and Hofmann, S.L. (1996) cDNA and genomic cloning of human palmitoyl-protein thioesterase (PPT), the enzyme defective in infantile neuronal ceroid lipofuscinosis. Genomics, 34, 317-322. MEDLINE Abstract

40. Camp, L.A. and Hofmann, S.L. (1995) Assay and isolation of a palmitoyl-protein thioesterase from bovine brain using palmitoylated H-Ras as a substrate. Methods Enzymol., 250, 336-347. MEDLINE Abstract

41. Verkruyse, L.A., Natowicz, M.R. and Hofmann, S.L. (1997) Palmitoyl-protein thioesterase deficiency in fibroblasts of individuals with infantile neuronal ceroid lipofuscinosis and I-cell disease. Biochim. Biophys. Acta, 1361, 1-5. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +44 171 209 6109; Fax: +44 171 209 6103; Email: hmitchis@ucl.ac.uk

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 6 Jan 1998
Copyright© Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 GeneticsHome page
H. Buff, A. C. Smith, and C. A. Korey
Genetic Modifiers of Drosophila Palmitoyl-Protein Thioesterase 1-Induced Degeneration
Genetics, May 1, 2007; 176(1): 209 - 220.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
A. J. Hickey, H. L. Chotkowski, N. Singh, J. G. Ault, C. A. Korey, M. E. MacDonald, and R. L. Glaser
Palmitoyl-Protein Thioesterase 1 Deficiency in Drosophila melanogaster Causes Accumulation of Abnormal Storage Material and Reduced Life Span
Genetics, April 1, 2006; 172(4): 2379 - 2390.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Calero, P. Gupta, M. C. Nonato, S. Tandel, E. R. Biehl, S. L. Hofmann, and J. Clardy
The Crystal Structure of Palmitoyl Protein Thioesterase-2 (PPT2) Reveals the Basis for Divergent Substrate Specificities of the Two Lysosomal Thioesterases, PPT1 and PPT2
J. Biol. Chem., September 26, 2003; 278(39): 37957 - 37964.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. K. Das, J.-Y. Lu, and S. L. Hofmann
Biochemical analysis of mutations in palmitoyl-protein thioesterase causing infantile and late-onset forms of neuronal ceroid lipofuscinosis
Hum. Mol. Genet., June 1, 2001; 10(13): 1431 - 1439.
[Abstract] [Full Text] [PDF]

Home page
 Arch. Dis. Child.Home page
R. Robinson and M. Gardiner
Current topic: Genetics of childhood epilepsy
Arch. Dis. Child., February 1, 2000; 82(2): 121 - 125.
[Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J. J. Bellizzi III, J. Widom, C. Kemp, J.-Y. Lu, A. K. Das, S. L. Hofmann, and J. Clardy
The crystal structure of palmitoyl protein thioesterase 1 and the molecular basis of infantile neuronal ceroid lipofuscinosis
PNAS, April 25, 2000; 97(9): 4573 - 4578.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (63)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mitchison, H. M.
Right arrow Articles by O'Rawe, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitchison, H. M.
Right arrow Articles by O'Rawe, A. M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?