Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Perry, J.
Right arrow Articles by Ashworth, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perry, J.
Right arrow Articles by Ashworth, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 299-305  


The human FXY gene is located within Xp22.3: implications for evolution of the mammalian X chromosome
Introduction
Results
   Cloning of human FXY cDNA
   FXY is a member of the RING finger gene family
   Genomic structure of the FXY gene
   Expression of the FXY gene
   FXY maps to Xp22.3
   Discussion
Materilas And Methods
Cloning of human FXY cDNA and genomic DNA
   Expression analysis
   Southern blotting and pulsed field gel analysis
   Physical mapping
References

Footnote

The human FXY gene is located within Xp22.3: implications for evolution of the mammalian X chromosome

The human FXY gene is located within Xp22.3: implications for evolution of the mammalian X chromosome

Jo Perry1, Sally Feather3, Alice Smith1, Steve Palmer1,+, Alan Ashworth1,2,*

1CRC Centre for Cell and Molecular Biology and 2Section of Gene Function and Regulation, Chester Beatty Laboratories, The Institute of Cancer Research, Fulham Road, London SW3 6JB, UK and 3Molecular Genetics Unit, Institute of Child Health, London WC1 1EH, UK

Received October 8, 1997; Revised and Accepted November 4, 1997

DDBJ/EMBL/GenBank accession no. AF035360

It has been proposed that the pseudoautosomal region of mammals has evolved by sequential addition of autosomal material onto the X and Y chromosomes followed by movement of the pseudoautosomal boundary to create X-unique regions. We have previously described a gene, Fxy, that spans the pseudoautosomal boundary in mice such that the first three exons of the gene are located on the X chromosome, but the remainder of the gene is located on both X and Y chromosomes. Therefore, this gene might be in a state of transition between pseudoautosomal and X-unique locations. In support of this theory we show here that the human FXY gene is located in Xp22.3 in humans, proximal to the pseudoautosomal boundary.

INTRODUCTION

The sex chromosomes of eutherian mammals, although heteromorphic in both size and gene content, are thought to have evolved from a pair of homologous chromosomes (1). A small region of identity, known as the pseudoautosomal region (PAR), exists between the X and Y chromosomes (2,3) and is thought to be a remnant of these ancestral sex chromosomes. During male meiosis the X and Y chromosomes pair and recombine along their PARs, thus ensuring correct chromosomal segregation (2). One significant consequence of the sequence identity of the PAR between the X and Y chromosomes is that genes located within this part of the genome escape X inactivation in females so as to maintain the dosage of genes relative to that of XY males (2,3).

The mouse and human PARs appear to be of distinct evolutionary origin. Of a number of genes that have been mapped to the PAR in humans, those that have been mapped in the mouse are all located on autosomes (4-7). However, some of the genes located on the human X chromosome proximal to the pseudoautosomal boundary are located near or within the PAR in mice. The Steroid Sulphatase gene (Sts) is located within the PAR in mice and has been shown to escape X chromosome inactivation in females (8). However, the human STS gene is located just proximal of the human pseudoautosomal boundary in Xp22.3 (9). The escape from X inactivation of the human STS gene and the presence of STS-related sequences on the Y chromosome are thought to be remnants of its previous PAR location (9). The human enamel protein gene Amelogenin (AMELX), located in Xp22.3 proximal to STS (10), also has related sequences present on the Y chromosome. In mice linkage between Amelogenin, which is X-unique in mice, and Sts has been preserved, although some other rearrangements have occurred (11-13).

The gene content of mammalian X chromosomes is highly conserved, as predicted by Ohno (1). However, the order of these genes with respect to each other has changed dramatically between species. This conservation of the X chromosome is also found, to a certain extent, in metatherian and prototherian mammals. The marsupial and much of the monotreme X chromosomes are thought to be equivalent to the long arm of the human X chromosome, Xq, and thus the marsupial X chromosome may represent an ancestral X chromosome (14,15). However, genes located on the short arm, Xp, of the human X chromosome are located in two autosomal clusters in both monotremes and marsupials, suggesting that human Xp, including the PAR, was originally autosomal and is a relatively recent addition to the eutherian X chromosome (14).

The `addition-attrition' theory (16) proposes that divergence of the mammalian X and Y chromosomes has occurred through cyclical addition of autosomal segments onto the PAR of either the X or Y chromosome. The autosomal addition is then recombined onto its partner, resulting in an enlarged PAR. Meanwhile the male-determining Y chromosome undergoes a series of rearrangements and deletions, reducing its homology with the X chromosome and gradually decreasing the size of the PAR as genes within this region lose their homologous Y chromosome partner and become X-unique (16). The change in location of the STS gene from its presumed original pseudoautosomal location to Xp22, proximal to the PAR, in humans has been presented as evidence for the addition-attrition theory. Recently we have identified a novel gene, Fxy (finger on X and Y), which spans the mouse pseudoautosomal boundary on the X chromosome (17). The first three exons of the gene are located on the X chromosome, whereas the 3[prime] exons of the gene are located on both the X and Y chromosomes. We proposed that the gene is at an intermediate stage in evolving from a pseudoautosomal location to one that is X-unique. Here we demonstrate that the human FXY gene is located within Xp22.3, proximal to the human pseudoautosomal boundary. This finding provides further evidence for the addition-attrition theory and we discuss the implications for evolution of the eutherian X chromosome and PAR.

RESULTS

Cloning of human FXY cDNA

PCR primers derived from mouse Fxy exon 3 were used to amplify a 90 bp fragment from human genomic DNA. Sequence analysis confirmed high sequence similarity to the mouse Fxy gene. This 90 bp fragment was used to screen a human full-term placenta cDNA library in pCDM8 by colony hybridization. One positive clone was isolated, sequenced and found to contain nt 747-1100 of the human FXY cDNA sequence. Simultaneously, database searching using the mouse Fxy sequence revealed a number of overlapping ESTs in the GenBank expressed sequence database (dbEST) covering the 3[prime] coding region and 3[prime]-untranslated region (UTR) of the human FXY gene (Unigene accession no. WI-12892). The 5[prime] coding portion of human FXY was obtained by PCR using a combination of mouse and human FXY primers on cDNA synthesized from human placental RNA. Finally, the 5[prime]-UTR was obtained using a modified 5[prime]-RACE procedure.

FXY is a member of the RING finger gene family

The compiled FXY cDNA contig consisted of 3334 bp and included an open reading frame of 2001 bp. An in-frame termination codon present 51 bp upsteam of the potential initiating methionine suggested that we had cloned the entire coding potential of the FXY gene (GenBank accession no. AF035360). The human FXY cDNA encodes a 667 amino acid protein which shows very high (95%) identity to the protein encoded by the mouse Fxy gene (Fig. 1a).


Figure 1 Amino acid sequence of the human FXY protein. (a) Comparison of human and mouse FXY proteins. The human FXY sequence (top) is aligned with the mouse Fxy protein (bottom). Sequences were aligned using the BESTFIT program of the GCG suite of programs (Daresbury Computing Group). Similarities between amino acids as determined by the scoring matrix in the program are illustrated as follows. |, identical amino acids; :, non-identical amino acid pairs having matrix scores >0.5; ., non-identical amino acids having a positive score <0.5. (b) Alignment of FXY with other members of the RBCC family. Residues important for zinc binding in the RING, B1 and B box domains are boxed in black. Other identical residues are boxed in grey. Sequences were aligned using the PILEUP and PRETTYBOX programs of the GCG suite of programs (Daresbury Computing Group). The following proteins are shown: Fxy (17); xnf7 (20); EFP (21); Rfp (35); Staf50 (36); TIF1 (37); Bt (29).

FXY is a member of the rapidly growing family of RING finger genes which are characterized by the presence of an N-terminal C3HC4 zinc binding domain (18; Fig. 1b). FXY also contains four additional domains; two potential zinc binding B box domains and a leucine coiled coil domain characteristic of a subgroup of this family, the `RING-B box-coiled coil' (RBCC) subgroup (19), as well as a C-terminal domain conserved in several proteins (Fig. 1b). FXY contains two types of B box motif; the first (a B1 box) is thought to be related to the B box motif through a common ancestor (19) and the second is a typical B box binding domain seen in the majority of the members of the RBCC subgroup. Overall, FXY is most similar to nuclear phosphoprotein xnf7 from Xenopus laevis (20) and a human estrogen-responsive finger protein, EFP (21).

Genomic structure of the FXY gene

To investigate the genomic organization of FXY we screened a human X chromosome Charon 35 phage library with PCR primers derived from the FXY cDNA sequence. The FXY gene consists of 10 exons, with the first intron located in the 5[prime]-UTR and the potential translation initiating methionine codon located within exon 2 (Fig. 2). The largest exon of the gene, exon 2, encodes one third of the FXY protein and also contains the RING, B1 and B box domains. The coiled coil domain is located in exons 3 and 4 and the C-terminal domain is encoded by exons 9 and 10. Not all of the splice junctions in the mouse gene have been isolated but all of those that have are conserved between the human and the mouse gene. Long range PCR with human genomic DNA as template was used to estimate the size of the introns of the FXY gene. These results indicated that the FXY gene spans at least 80 kb.


Figure 2 Gene structure of FXY. (a) Diagrammatic representation of the exon structure of FXY. FXY consists of 10 exons designated by Roman numerals. The RING, B1 box, B box, coiled coil and C-terminal domains are represented by shaded boxes and described in the key. The putative initiation and termination codon of the gene are indicated by ATG and TGA respectively. (b) Intron/exon structure of FXY. The position and sequence of the exon/intron splice junctions was determined by analysing genomic clones spanning the gene. Exons are indicated by Roman numerals. The percentage identity between the human and mouse FXY genes for each exon is indicated. For exon X this is calculated for the coding part only.

Comparison of the DNA sequences of human and mouse FXY cDNA shows that the genes are highly conserved. However, if the sequence identity in the coding region is plotted exon by exon it is clear that the 5[prime] exons are, in general, more conserved than the 3[prime] exons (Fig. 2b). This might reflect a more stringent requirement for conservation of particular amino acids in the N-terminus of the encoded protein. Alternatively, this might be due to the pseudoautosomal location of the 3[prime]-region of the Fxy gene. Exons IV-X of the mouse gene are located in the PAR and other genes in this region are known to evolve rapidly (22).

Expression of the FXY gene

We used hybridization analysis and RT-PCR to investigate the expression pattern of the human FXY gene. A fragment of the 5[prime]-end of FXY cDNA encompassing exons 2-4 was hybridized to a northern blot containing poly(A)+ RNAs isolated from human adult tissues. A major RNA species of 7.4 kb and two minor RNAs of 4.3 and 2.6 kb were detected in all the tissues analysed (Fig. 3). The FXY cDNA contig that we characterized was 3334 bp in length. The multiple transcripts that we observed might be the result of alternative splicing or might arise through the use of alternative polyadenylation sites. However, the presence of an in-frame termination codon upstream of the potential initiating methionine and the similarity to the mouse Fxy gene strongly suggests that we have isolated the entire coding region of the gene. RT-PCR analysis was used to examine expression of the FXY gene during human foetal development. FXY was found to be expressed in several tissues of 8 and 9 week human foetuses (data not shown). Although this analysis is non-quantitative, it demonstrates that FXY is widely expressed.


Figure 3 Expression of FXY in adult and fetal tissues. Northern analysis of FXY expression. A multiple tissue northern blot hybridized with (i) a 5[prime] fragment of the FXY cDNA and (ii) a GAPDH control as described in Materials and Methods. The transcript sizes are estimated from markers.

FXY maps to Xp22.3

Southern blot hybridization analysis of male and female human genomic DNA demonstrated that FXY was probably X linked; this was suggested by a comparison of the signal obtained from DNA derived from the two sexes (Fig. 4). We have found no evidence of male-specific fragments, suggesting that FXY-related sequences are not present on the human Y chromosome.


Figure 4 FXY is X-linked in humans. Southern hybridization of male and female human genomic DNA digested with restriction enzymes and hybridized with an 800 bp fragment of the FXY cDNA. The hybridization intensity ratio of 2:1 between female and male DNA suggests X linkage of FXY in humans. Reprobing of the blot with a probe derived from an autosomal gene confirmed that equal amounts of DNA were loaded.

To locate the human FXY gene more precisely in the genome, PCR primers derived from exon 2 were used to screen the Genebridge 4 radiation hybrid mapping panel. This consists of 93 cell lines segregating fragments of human chromosomes on a rodent cell background (23). Analysis of these data indicated that FXY mapped within 6.4 cR (1 cR = 250 kb; 24) of the marker DXS1223 on the short arm of the X chromosome within Xp22.3. These data were confirmed by mapping of an EST present in the Unigene database encompassing the 3[prime]-end of FXY. This EST also mapped to Xp22.3, in agreement with our radiation hybrid data. We have also placed FXY on two YAC contigs which span the region, the CEPH-Genethon integrated YAC contig (25) and a 35 Mb YAC contig that spans Xp22.3-Xp21.3 (26). PCR with primers specific for FXY on YAC DNAs from these contigs mapped the gene to a number of YACs from both contigs (Fig. 5). Comparison of markers known to be present on these YACs allowed us to delimit the position of FXY to a location between the STS markers DXS7108 and DXS6848. The gene is flanked by two previously characterized genes, AMELX and CLCN4 (10,27).


Figure 5 FXY maps to Xp22.3. Schematic representation of the position of FXY and other markers on the human X chromosome and the location of various YACs used in the mapping of FXY. Grey boxes represent YACs from the CEPH YAC and mega-YAC libraries. Genes from the surrounding region (within grey ovals) and other markers are indicated.

DISCUSSION

The PAR has unique properties in mammalian genomes due to its function in ensuring proper pairing and segregation of the sex chromosomes at meiosis (2,3). This function is complicated by the location of genes within the PAR. These genes are present in two identical expressed copies in males and in females are found to escape X chromosome inactivation. Whether this is a property of the genes themselves or a property of the PAR globally is not known. The PAR appears to be organized very differently in the two species, humans and mice, in which it has been characterized; no gene has been identified which is pseudoautosomal in both species. Despite this, a region proximal to the pseudoautosomal boundary in humans, Xp22.3, shows evidence of a pseudoautosomal location at some time in the past. Here we have characterized a human gene, FXY, that is located in Xp22.3, while in the mouse this gene spans the pseudoautosomal boundary (17).

The human FXY gene encodes a 667 amino acid protein which contains several regions of sequence similarity to previously characterized RING finger proteins (Fig. 1b). This is seen not only over the RING domains of these proteins but also within other domains that are common to this family. RBCC domains have recently been shown to be involved in protein-protein interactions through the coiled coil domain, with the B box domain also being necessary for this interaction (28). There is also evidence that the RING finger and B box domains may be involved in subcellular compartmentalization (28). The RBCC domains of mouse and human FXY are completely conserved, suggesting a crucial role for these domains in the function of FXY. An additional C-terminal domain common to some of the RING finger family is also present in FXY, but little is known about its function. This domain is also present in the Butyrophilin protein, a milk fat globule membrane protein, although this protein does not contain any of the other RING finger domains (29). The C-terminal domain also appears to be almost completely conserved between the mouse and the human proteins. Despite the presence in FXY of these multiple domains it is difficult to assign a function to the protein, as members of the RING finger family of proteins have such diverse cellular roles.

FXY shows very high sequence similarity to the mouse Fxy gene at both the DNA and protein levels, suggesting that both have similar roles in vivo. Although overall highly conserved, the 3[prime]-part of the gene appears to be less highly conserved that the 5[prime]-part (Fig. 2b). This may correspond to a greater level of divergence of the part of the mouse gene (exons IV-X) present in the PAR. Several lines of evidence suggest a much higher rate of divergence of genes that are present in the PAR than genes that are present in the unique part of the X chromsome or on autosomes. For example, both the GM-CSFR[alpha] and Il3R[alpha] genes, which are present in the human PAR but which are autosomal in mice, are very divergent between the two species (22). Similarly, the Sts gene present in the PAR of mouse but located within Xp22.3 of humans, is also very divergent (8). Thus it seems possible that the greater divergence of the 3[prime]-part of the mouse Fxy gene is due to the presence of this region of the gene within the PAR. This could be tested by sequencing FXY from other mammalian species.

The human FXY gene maps to Xp22.3, distal to AMELX, providing further evidence for a conservation between this region in humans and the mouse distal X chromosome (13; Fig. 6). The human STS gene is also located within Xp22.3 just proximal to the human PAR (9). Thus the gene order AMELX-FXY-STS is conserved between humans and mice. A gene encoding a chloride channel, CLCN4, is located distal to FXY in humans (27) and this gene is absent from the X chromosome in laboratory mice, being located on chromosome 7 (11,12; Fig. 6). However, the CLCN4 gene is located on the X chromosome in Mus spretus, suggesting that the ancestral gene order was probably AMELX-FXY-CLCN4-STS and that this cluster of genes might have been pseudoautosomal at some time.

It has been suggested that the PAR in mammals is evolving by the addition of autosomal segments to the PAR together with progressive loss of material from the Y chromosome PAR (16). In this `addition-attrition' hypothesis the site of attrition is the point at which the homologous PAR diverges into X- and Y-specific sequences, i.e. the pseudoautosomal boundary. The action of attrition is part of the ongoing process that, it is suggested, has degraded the Y PAR since the origin of the sex chromosomes from a pair of homologous autosomes (16). We suggested previously that the presence of the truncated Fxy gene at the pseudoautosomal boundary on the Y chromosome of mice revealed the process of attrition at work (17). Mapping of the FXY gene within Xp22.3 in humans strongly supports this idea.


Figure 6 Model for the evolution of the human and mouse PARs. A possible ancestral PAR and the present day PARs for humans and mice are shown. The XG and Fxy genes span the pseudoautosomal boundaries of humans and mice respectively (17,38). In Mus musculus the CLCN4 gene is located on chromosome 7 (11,12). X-unique and Y-unique regions are represented by shaded and hatched boxes respectively. The PAR is represented by an open white box. A wavy line marks the pseudoautosomal boundary.

MATERIALS AND METHODS

Cloning of human FXY cDNA and genomic DNA

Primers derived from mouse Fxy exon 3 (CAACATGTTGACA AGTTTGG and ACTTGGAGAGTAATCTCACC) were used to amplify a 90 bp fragment from human genomic DNA using PCR conditions of 30 cycles of: 94°C, 30 s; 52°C, 30 s; 72°C, 1 min. This fragment was used to screen a human full-term placenta cDNA library in pCDM8 (HGMP Resource Centre, Hinxton, UK) by colony hybridization. Positive clones were isolated and the inserts amplified by PCR with vector-specific primers and then sequenced.

ESTs derived from the 3[prime]-end of the FXY coding region and the 3[prime]-UTR were located in the GenBank dbEST database by BLAST searches with the mouse Fxy sequence. A total of 23 ESTs cover this region of the gene and one of these (GenBank accession no. Z40343) has been mapped on the Unigene-Genethon integrated map of the human X chromosome (Unigene web site: http://www.ncbi.nlm.nih.gov/UniGene/index.html, accession no. WI-12892). Most of the remaining coding cDNA was obtained by PCR on human placenta cDNA with the following primers: the mouse Fxy primer GAAACACTGGAGTCGGAGCT and the human FXY primer TTGGTTCCAATAATCTGTCG amplify the 5[prime]-portion of the gene from the initiation codon to exon 4; AAGCCAAATTGACAGAGGAG and CCTGAACCTTACTGTTCCCC amplify nt 862-2138 of the human cDNA. The 5[prime]-UTR of the cDNA was isolated using a modified 5[prime]-RACE procedure based on the template switching capacity of reverse transcriptase (A.Ashworth, unpublished results).

A human X chromosome [lambda] Charon 35 phage library (ATCC) was screened by hybridization with probes derived from each of the 10 exons. Intron/exon boundaries were amplified either by long range PCR (Boehringer Expand Long Template PCR kit) using vector- and exon-specific primers or by subcloning [lambda] DNA digested with various restriction enzymes into pBluescript.

Automated DNA sequencing was performed by cycle sequencing with Applied Biosystems Taq FS containing Dye Terminators and analysed on an Applied Biosystems 377 sequencer.

Expression analysis

A human multiple tissue northern blot (Clontech) was hybridized according to the manufacturer's instructions with an 800 bp cDNA fragment spanning exons 2-4, produced by PCR with the primers ACAGCCTCTGCTTCAACTGC and ttggttccaataatctgtcg corresponding to nt 166-935 of the human cDNA sequence. After removal of this probe the northern blot was rehybridized with a 1 kb fragment of Gapdh cDNA (30) as a loading control.

Human tissues were provided by the Institute of Child Health from embryonic and foetal collections made under local research ethical committee permission. Three normal foetuses were collected from chemically induced and surgically induced terminations performed at 8-9 weeks after fertilization as described (31). The stage of gestation was determined by standard criteria based on examination of external morphology (32). Total RNA was extracted from freshly dissected human foetal tissues using TRI Reagent (Molecular Research Centre Inc.) and used to synthesize cDNA with M-MLV reverse transcription enzyme (Gibco) according to the manufacturer's instructions. To investigate expression of FXY RT-PCR, with the same primers used to produce the 800 bp fragment described above, was used to amplify FXY from human foetal cDNA with 30 cycles of the following PCR conditions: 94°C, 1 min; 52°C, 1 min; 72°C, 1 min.

Southern blotting and pulsed field gel analysis

For Southern blot hybridization analysis 5 µg aliquots of male and female human genomic DNA (Promega) were digested with restriction enzymes, electrophoresed on a 0.8% agarose gel and blotted onto Hybond N+ (Amersham) overnight in 0.4 M NaOH.

Yeast genomic DNA for pulsed field gel electrophoresis was prepared in Seaplaque agarose (FMC, Rockland, ME) using the lithium dodecylsulphate method (33). DNA embedded in agarose plugs was digested with restriction enzymes and electrophoresis was carried out in a BioRad CHEF DRII PFG apparatus on a 1% agarose gel in TBE at 6 V for 15 h with a pulse time of 60-120 s. Gels were stained with ethidium bromide, treated with 25 mM HCl for 15 min and then blotted as above for Southern hybridization.

DNA fragments for hybridization were labelled with [32P]dCTP using a Prime-It II kit (Stratagene) and purified on NucTrap columns (Stratagene). Hybridization was carried out in Church and Gilbert hybridization buffer (34).

Physical mapping

A panel of 93 radiation hybrids (23), obtained from the HGMP Resource Centre, was screened by PCR with the FXY cDNA-derived primers AAGCCAAATTGACAGAGGAG and TTGGTT- CCAATAATCTGTCG to produce a product of 73 bp. Results were analysed on the Whitehead Institute web site (http://www.genome.wi.mit.edu/cgi-bin/contig/rhmapper.pl).

YAC clones obtained from CEPH and the HGMP Resource Centre were screened by PCR using the conditions described above with the following sets of primers: ACAGCCTCTGCTTCAACTGC and TCACTCAAAGCTGCCACCTG derived from exon 2; AAGCCAAATTGACAGAGGAG and ttggttccaataatctgtcg derived from exon 4; ATTTGGACTGCACAGAGCAG and CCTGAACCTTACTGTTCCCC derived from exon 10.

REFERENCES

1. Ohno, S. (1967) Sex Chromosomes and Sex-Linked Genes. Springer-Verlag, Berlin.

2. Burgoyne, P.S. (1982) Genetic homology and crossing over in the X and Y chromosomes of mammals. Hum. Genet., 61, 85-90. MEDLINE Abstract

3. Ellis, N. and Goodfellow, P.N. (1989) The mammalian pseudoautosomal region. Trends Genet., 5, 406-410. MEDLINE Abstract

4. Disteche, C.M., Brannan, C.I., Larsen, A., Adler, D.A., Schorderet, D.F., Gearing, D., Copeland, N.G., Jenkins, N.A. and Park, L.S. (1992) The human pseudoautosomal GM-CSF receptor alpha subunit gene is autosomal in mouse. Nature Genet., 1, 333-336. MEDLINE Abstract

5. Miyajima, I., Levitt, L., Hara, T., Bedell, M.A., Copeland, N.G., Jenkins, N.A. and Miyajima, A. (1995) The murine interleukin-3 receptor alpha subunit gene: chromosomal localization, genomic structure, and promoter function. Blood, 85, 1246-1253. MEDLINE Abstract

6. Rao, E., Weiss, B., Fukami, M., Rump, A., Niesler, B., Mertz, A., Muroya, K., Binder, G., Kirsch, S., Winkelmann, M., Nordsiek, G., Heinrich, U., Breuning, M.H., Ranke, M.B., Rosenthal, A., Ogata, T. and Rappold, G.A. (1997) Pseudoautosomal deletions encompassing a novel homeobox gene cause growth failure in idiopathic short stature and Turner syndrome. Nature Genet., 16, 54-63. MEDLINE Abstract

7. Ellison, J.W., Wardak, Z., Young, M.F., Robey, P.G., Laig-Webster, M. and Chiong, W. (1997) PHOG, a candidate gene for involvement in the short stature of Turner syndrome. Hum. Mol. Genet., 6, 1341-1347. MEDLINE Abstract

8. Salido, E.C., Li, X.M., Yen, P.H., Martin, N., Mohandas, T.K. and Shapiro, L.J. (1996) Cloning and expression of the mouse pseudoautosomal steroid sulphatase gene (Sts). Nature Genet., 13, 83-86. MEDLINE Abstract

9. Yen, P.H., Allen, E., Marsh, B., Mohandas, T., Wang, N., Taggart, R.T. and Shapiro, L.J. (1987) Cloning and expression of steroid sulfatase cDNA and the frequent occurrence of deletions in STS deficiency: implications for X-Y interchange. Cell, 49, 443-454. MEDLINE Abstract

10. Salido, E.C., Yen, P.H., Koprivnikar, K., Yu, L.C. and Shapiro, L.J. (1992) The human enamel protein gene amelogenin is expressed from both the X and the Y chromosomes. Am. J. Hum. Genet., 50, 303-316. MEDLINE Abstract

11. Palmer, S., Perry, J. and Ashworth, A. (1995) A contravention of Ohno's law in mice. Nature Genet., 10, 472-476. MEDLINE Abstract

12. Rugarli, E.I., Adler, D.A., Borsani, G., Tsuchiya, K., Franco, B., Hauge, X., Disteche, C., Chapman, V. and Ballabio, A. (1995) Different chromosomal localization of the Clcn4 gene in Mus spretus and C57BL/6J mice. Nature Genet., 10, 466-471. MEDLINE Abstract

13. Dinulos, M.B., Bassi, M.T., Rugarli, E.I., Chapman, V., Ballabio, A. and Disteche, C.M. (1996) A new region of conservation is defined between human and mouse X chromosomes. Genomics, 35, 244-247. MEDLINE Abstract

14. Graves, J.A. and Watson, J.M. (1991) Mammalian sex chromosomes: evolution of organization and function. Chromosoma, 101, 63-68. MEDLINE Abstract

15. Graves, J.A.M., Cooper, D.W., McKenzie, L.M., Hope, R.M. and Watson, J.M. (1993) Genetic maps of marsupial and monotreme mammals. In O'Brien, S.J. (ed.), Genetic Maps. Locus Maps of Complex Genomes. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 282-289.

16. Graves, J.A. (1995) The origin and function of the mammalian Y chromosome and Y-borne genes-an evolving understanding. BioEssays, 17, 311-320. MEDLINE Abstract

17. Palmer, S., Perry, J., Kipling, D. and Ashworth, A. (1997) A gene spans the pseudoautosomal boundary in mice. Proc. Natl Acad. Sci. USA, 94, 12030-12035. MEDLINE Abstract

18. Saurin, A.J., Borden, K.L., Boddy, M.N. and Freemont, P.S. (1996) Does this have a familiar RING? Trends Biochem. Sci., 21, 208-214. MEDLINE Abstract

19. Reddy, B.A., Etkin, L.D. and Freemont, P.S. (1992) A novel zinc finger coiled-coil domain in a family of nuclear proteins. Trends Biochem. Sci., 17, 344-345. MEDLINE Abstract

20. Reddy, B.A., Kloc, M. and Etkin, L. (1991) The cloning and characterization of a maternally expressed novel zinc finger nuclear phosphoprotein (xnf7) in Xenopus laevis. Dev. Biol., 148, 107-116. MEDLINE Abstract

21. Inoue, S., Orimo, A., Hosoi, T., Kondo, S., Toyoshima, H., Kondo, T., Ikegami, A., Ouchi, Y., Orimo, H. and Muramatsu, M. (1993) Genomic binding-site cloning reveals an estrogen-responsive gene that encodes a RING finger protein. Proc. Natl Acad. Sci. USA, 90, 11117-11121. MEDLINE Abstract

22. Ellison, J.W., Li, X., Francke, U. and Shapiro, L.J. (1996) Rapid evolution of human pseudoautosomal genes and their mouse homologs. Mammalian Genome, 7, 25-30. MEDLINE Abstract

23. Gyapay, G., Schmitt, K., Fizames, C., Jones, H., Vega-Czarny, N., Spillett, D., Muselet, D., Prud'Homme, J.F., Dib, C., Auffray, C., Morissette, J., Weissenbach, J. and Goodfellow, P.N. (1996) A radiation hybrid map of the human genome. Hum. Mol. Genet., 5, 339-346. MEDLINE Abstract

24. Hudson, T.J. et al). (1995) An STS-based map of the human genome. Science, 270, 1945-1954. MEDLINE Abstract

25. Gyapay, G., Morissette, J., Vignal, A., Dib, C., Fizames, C., Millasseau, P., Marc, S., Bernardi, G., Lathrop, M. and Weissenbach, J. (1994) The 1993-94 Genethon human genetic linkage map. Nature Genet., 7, 246-339. MEDLINE Abstract

26. Ferrero, G.B. et al). (1995) An integrated physical and genetic map of a 35 Mb region on chromosome Xp22.3-Xp21.3. Hum. Mol. Genet., 4, 1821-1827. MEDLINE Abstract

27. van Slegtenhorst, M.A. et al). (1994) A gene from the Xp22.3 region shares homology with voltage-gated chloride channels. Hum. Mol. Genet., 3, 547-552. MEDLINE Abstract

28. Cao, T., Borden, K.L., Freemont, P.S. and Etkin, L.D. (1997) Involvement of the rfp tripartite motif in protein-protein interactions and subcellular distribution. J. Cell Sci., 110, 1563-1571.

29. Jack, L.J. and Mather, I.H. (1990) Cloning and analysis of cDNA encoding bovine butyrophilin, an apical glycoprotein expressed in mammary tissue and secreted in association with the milk-fat globule membrane during lactation. J. Biol. Chem., 265, 14481-14486. MEDLINE Abstract

30. Sabath, D.E., Broome, H.E. and Prystowsky, M.B. (1990) Glyceraldehyde-3-phosphate dehydrogenase mRNA is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte. Gene, 91, 185-191. MEDLINE Abstract

31. Duke, V.M., Winyard, P.J., Thorogood, P., Soothill, P., Bouloux, P.M. and Woolf, A.S. (1995) KAL, a gene mutated in Kallmann's syndrome, is expressed in the first trimester of human development. Mol. Cell. Endocrinol., 110, 73-79. MEDLINE Abstract

32. Larsen, W.J. (1993) Development of the Urogenital System. Churchill Livingstone, Edinburgh, UK, pp. 235-279.

33. Anand, R., Ogilvie, D.J., Butler, R., Riley, J.H., Finniear, R.S., Powell, S.J., Smith, J.C. and Markham, A.F. (1991) A yeast artificial chromosome contig encompassing the cystic fibrosis locus. Genomics, 9, 124-130. MEDLINE Abstract

34. Church, G.M. and Gilbert, W. (1984) Genomic sequencing. Proc. Natl Acad. Sci. USA, 81, 1991-1995. MEDLINE Abstract

35. Takahashi, M. and Cooper, G.M. (1987) ret transforming gene encodes a fusion protein homologous to tyrosine kinases. Mol. Cell. Biol., 7, 1378-1385. MEDLINE Abstract

36. Tissot, C. and Mechti, N. (1995) Molecular cloning of a new interferon-induced factor that represses human immunodeficiency virus type I long terminal repeat expression. J. Biol. Chem., 270, 14891-14898. MEDLINE Abstract

37. LeDouarin, B., Zechel, C., Garnier, J.M., Lutz, Y., Tora, L., Pierrat, P., Heery, D., Gronemeyer, H., Chambon, P. and Losson, R. (1995) The N-terminal part of TIF1, a putative mediator of the ligand-dependent activation function (AF-2) of nuclear receptors, is fused to B-raf in the oncogenic protein T18. EMBO J., 14, 2020-2033. MEDLINE Abstract

38. Ellis, N.A., Ye, T.Z., Patton, S., German, J., Goodfellow, P.N. and Weller, P. (1994) Cloning of PDBX, a MIC2-related gene that spans the pseudoautosomal boundary on chromosome Xp. Nature Genet. 6, 394-400. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +44 171 352 8133; Fax: +44 171 352 3299; Email: alana@icr.ac.uk
+Present address: The Walter and Eliza Hall Institute of Medical Research, Post Office, Royal Melbourne Hospital, Melbourne, Victoria 3050, Australia


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 6 Jan 1998
Copyright© Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Biol EvolHome page
J.-R. Landry, A. Rouhi, P. Medstrand, and D. L. Mager
The Opitz Syndrome Gene Mid1 Is Transcribed from a Human Endogenous Retroviral Promoter
Mol. Biol. Evol., November 1, 2002; 19(11): 1934 - 1942.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
F. Gianfrancesco, R. Sanges, T. Esposito, S. Tempesta, E. Rao, G. Rappold, N. Archidiacono, J. A.M. Graves, A. Forabosco, and M. D'Urso
Differential Divergence of Three Human Pseudoautosomal Genes and Their Mouse Homologs: Implications for Sex Chromosome Evolution
Genome Res., December 1, 2001; 11(12): 2095 - 2100.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
J. Perry, S. Palmer, A. Gabriel, and A. Ashworth
A Short Pseudoautosomal Region in Laboratory Mice
Genome Res., November 1, 2001; 11(11): 1826 - 1832.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
T. C. Cox, L. R. Allen, L. L. Cox, B. Hopwood, B. Goodwin, E. Haan, and G. K. Suthers
New mutations in MID1 provide support for loss of function as the cause of X-linked Opitz syndrome
Hum. Mol. Genet., October 1, 2000; 9(17): 2553 - 2562.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Perry, J.
Right arrow Articles by Ashworth, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perry, J.
Right arrow Articles by Ashworth, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?