Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (29)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mitchell, M. J.
Right arrow Articles by Graves, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitchell, M. J.
Right arrow Articles by Graves, J. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 429-434  

The origin and loss of the ubiquitin activating enzyme gene on the mammalian Y chromosome
Introduction
Results
   UBE1 maps to the pairing region of the monotreme X chromosome
   Identification of UBE1 homologues in primates
   Functional UBE1 genes on the primate Y chromosome
   UBE1 pseudogenes on the primate Y chromosome
Discussion
Materials And Methods
   Southern blot analysis
   Isolation and verification of male-specific fragments
Acknowledgements
References

The origin and loss of the ubiquitin activating enzyme gene on the mammalian Y chromosome

The origin and loss of the ubiquitin activating enzyme gene on the mammalian Y chromosome

Michael J. Mitchell1,*, Stephen A. Wilcox2,+, Jaclyn M. Watson2, Jody L. Lerner3, Diane R. Woods3, Joan Scheffler4, John P. Hearn4, Colin E. Bishop5, Jennifer A. Marshall Graves2

1INSERM U406, Faculté de Médecine La Timone, 13385 Marseille, France, 2Department of Genetics and Human Variation, La Trobe University, Bundoora, Victoria 3083, Australia, 3Department of Obstetrics and Gynecology, University of Tennessee, Memphis, TN 38105, USA, 4Wisconsin Regional Primate Research Center, University of Wisconsin, Madison, WI 53715, USA and 5Department of Obstetrics and Gynecology, Baylor College of Medicine, Houston, TX, USA

Received September 18, 1997; Revised and Accepted December 9, 1997

DDBJ/EMBL/GenBank accession nos AJ003104-AJ003111

Mammalian sex chromosomes are thought to be descended from a homologous pair of autosomes: a testis-determining allele which defined the Y chromosome arose, recombination between the nascent X and Y chromosomes became restricted and the Y chromosome gradually lost its non-essential genetic functions. This model was originally inferred from the occurrence of few Y-linked genetic traits, pairing of the X and Y chromosomes during male meiosis and, more recently, the existence of X-Y homologous genes. The comparative analysis of such genes is a means by which the validity of this model can be evaluated. One well-studied example of an X-Y homologous gene is the ubiquitin activating enzyme gene (UBE1), which is X-linked with a distinct Y-linked gene in many eutherian (`placental') and metatherian (marsupial) mammals. Nonetheless, no UBE1 homologue has yet been detected on the human Y chromosome. Here we describe a more extensive study of UBE1 homologues in primates and a prototherian mammal, the platypus. Our findings indicate that UBE1 lies within the X-Y pairing segment of the platypus but is absent from the human Y chromosome, having been lost from the Y chromosome during evolution of the primate lineage. Thus UBE1 illustrates the key steps of `autosomal to X-specific' evolution of genes on the sex chromosomes.

INTRODUCTION

It is generally believed that specialized sex chromosomes evolved from a pair of autosomes (1-3). In mammals this specialization is thought to have begun with the appearance of a testis-determining allele on an autosome which created the nascent Y chromosome and led eventually to suppression of recombination with its homologous partner, the nascent X chromosome. This lack of recombination in turn promoted degeneration of the Y chromosome in a process termed `Muller's ratchet', because of the chromosome's inability to segregate genes carrying deleterious mutations and recreate a non-deleterious haplotype (4). On the basis of this theory, sex chromosome genes are expected to evolve from autosomal genes to X-Y homologous genes to X-specific genes.

Molecular evidence for this evolution of sex chromosomes from autosomes, with eventual loss of genes from the Y chromosome, is fragmentary, deriving from the comparison of different genes in different species (5,6). A common origin of genes on the mammalian sex chromosomes is suggested indirectly by the presence of the pseudoautosomal region, in mouse and human at least, where the X and Y chromosomes are identical and pairing and recombination occurs during male meiosis (7). In addition, outside the pseudoautosomal region several diverged X-Y homologous genes have been identified, showing that such genes can be conserved on the Y chromosome in the absence of recombination (8-12). With the exceptions of the rodent species Ellobius lutescens and E.tancrei, in which the Y chromosome is entirely lacking (13), there is no direct evidence that genes are lost from the Y chromosome and, indeed, there are several examples of genes which have apparently remained conserved on the Y chromosome for over 130 million years ago day (14-16).

This is the case for homologues of the ubiquitin activating enzyme E1 gene (UBE1), which are located on the Y chromosome in many orders of therian mammal (eutherian and metatherian mammals). UBE1 is necessary for diverse cellular processes, including selective protein degradation, DNA repair and progression of the cell cycle (17-19). In mouse, human and marsupials UBE1 has been localized to the X chromosome (9,15). A homologue of UBE1 (85% nucleic acid identity) was cloned from the mouse Y chromosome, thus establishing the presence of distinct sex chromosome UBE1 genes in the mouse: Ube1x on the X chromosome and Ube1y on the Y chromosome (9,20). In keeping with its important cellular function, Ube1x is widely expressed, but expression of Ube1y is limited to the testis (9,21). Ube1y represents a candidate spermatogenesis gene, as it is located in the [Delta]Sxrb deletion interval (9,20), which is required for spermatogonial proliferation (22).

Comparative Southern analysis of UBE1 homologues indicates the presence of distinct UBE1 homologues on the X and Y chromosomes in most therian mammals. This shows that UBE1 homologues have been conserved on the mammalian Y chromosome since the divergence of the eutherian and metatherian lineages, >130 million years ago (9,15). In these studies, however, no homologue was detected on the Y chromosome in human or chimpanzee, thus indicating either an increased rate of divergence of the UBE1 Y chromosome gene in the primate lineage or loss of the UBE1 gene from the primate Y chromosome. In the hope that resolution of this question might lead to isolation of a UBE1 gene from the human Y chromosome we have extended our studies of UBE1 to include several different species of primate. In addition, to provide a more complete picture of the evolution of UBE1 on the sex chromosomes and thereby test some of the predictions of sex chromosome evolution theory, we have mapped UBE1 homologues in the monotremes, which diverged 150 million-170 million years ago from the metatherian-eutherian lineage. Our results indicate that there is not a UBE1 gene on the human Y chromosome and provide strong evidence for the classical model of sex chromosome evolution.a


Figure 1. Mapping of UBE1 homologous sequences in the platypus by chromosomal in situ hybridization. The mouse Ube1x clone was hybridized to metaphase chromosomes from female platypus. A total of 206 grains were scored over 50 metaphase chromosome spreads. The distribution was analysed using the BASIC Zmax program (34). Zmax and significance (1%) values are indicated, the latter in parentheses. There was one significant (1%) point of hybridization, on distal Xp.

RESULTS

UBE1 maps to the pairing region of the monotreme X chromosome

Monotremes (three species of egg-laying mammals of the Infraclass Prototheria, consisting of the platypus and two species of echidna) have a basic XX female:XY male system of sex determination, although the sex chromosomes are part of a unique translocation complex (23). The platypus and echidna X chromosomes are cytogenetically identical (24) and contain the same suite of genes (25). The gene content of the monotreme X chromosome establishes that it is homologous with the long arm and proximal region of the short arm of the human X chromosome (including UBE1), a region conserved on the X chromosome in all mammals and thought to represent the ancestral mammalian X chromosome (5). The large submetacentric monotreme X and Y chromosomes (constituting ~6 and 4% of the haploid complement) undergo homologous pairing at meiosis over the entire short arm of the X and long arm of the Y chromosomes (23; J.M.Watson and J.A.Marshall Graves, unpublished observations), suggesting that the process of X-Y differentiation has not proceeded as far in monotremes as in therian mammals.

To test whether UBE1 is present on the monotreme sex chromosomes Southern blot analysis and in situ hybridization were undertaken with a mouse full-length Ube1x cDNA. Southern analysis revealed three male-female common bands but no male-specific fragments (data not shown), suggesting that platypus UBE1 homologues are either exclusively autosomal or X-linked. To distinguish between these possibilities, radioactive in situ hybridization, using the mouse Ube1x cDNA as probe, was performed on female chromosomes (it is not possible to make a direct localization to the Y chromosome because the platypus Y is indistinguishable from several medium sized autosomes). Significant hybridization was only observed on the distal short arm of the X (Fig. 1b). Since this region is seen to pair with the Y chromosome (23; J.M.Watson and J.A.Marshall Graves, unpublished observations), it is most likely that UBE1 is located on the large pseudoautosomal region in monotremes.

Identification of UBE1 homologues in primates

The failure to detect UBE1 genes on the human or chimpanzee Y chromosome (9) could result from sequence divergence or gene loss. The detection and characterization of UBE1 genes on the Y chromosomes of other primates should allow these two possibilities to be distinguished. To this end a male and a female of two species of old world monkey and new world monkey and one species of lemur were initially analysed by Southern analysis using as probes the full-length mouse X cDNA and a 400 bp fragment from the 3[prime]-end of its coding segment. No male-specific fragments were detected in the old world monkeys. Male-specific fragments were, however, detected with both probes in ring-tailed lemur, squirrel monkey and marmoset (Fig. 2). A subset of bands detected by the full-length probe were detected by the 3[prime]-end probe and these were isolated and partially sequenced to reveal the nature of the UBE1 Y chromosome genes in these three primate species (Fig. 3).


Figure 2. Southern blot analysis of UBE1 homologous sequences in primates. (a) Hybridization of the full-length mouse Ube1x cDNA to EcoRI-digested DNA from male and female human, rhesus monkey and stump-tailed macaque. (b) Hybridization of the full-length mouse Ube1x cDNA (left) and a 400 bp SacI-AatII fragment from the 3[prime]-end of Ube1x (right) to EcoRI-digested DNA from male and female squirrel monkey, marmoset and ring-tailed lemur. The fragments marked SM3.1, SM7, M2.8 and RTL9.7 were cloned and partially sequenced. The increased hybridization to the male/female common bands in the female DNA is consistent with UBE1 homologues being X-linked as in mouse and human. The squirrel monkey bands marked with an * probably represent two alleles of an X-linked restriction fragment length polymorphism.ab



Figure 3. Sequence analysis of new world monkey and lemur male-specific UBE1 homologous sequences. The sequences, represented by solid horizontal lines, are all Y chromosome derived. Exons (boxes with solid outline) were identified by homology to human UBE1 (GenBank accession no. M58028) and percent identity to UBE1 is shown. Figures in brackets over an intron represent percent identity of this intron with the X gene of the same species. The gray boxes correspond to the 3[prime]-UTR and the polyadenylation signal in RTL9.7 is marked. Figures in the boxes with a dotted outline indicate percent identity for RTL9.7 versus SM3.1 or SM3.1 versus SM7. The triangles above the marmoset fragment represent putative exon junctions. The truncation of sequences was dictated by the subcloning and does not indicate the absence of further sequences corresponding to other UBE1 exons at these loci. The only exception is the marmoset sequences, which represent the entirety of the UBE1 sequences at this locus and on the Y chromosome as they are contained within a LINE element. GenBank accession nos for the primate UBE1 Y genes are AJ003104-AJ003108 and UBE1X introns AJ003109-AJ003111

Functional UBE1 genes on the primate Y chromosome

In the 3.1 kb squirrel monkey band (SM3.1) and the 9.7 kb lemur band (RTL9.7) apparently functional UBE1 genes with intron-exon structure were revealed by sequence comparison with human UBE1. The male specificity of these fragments was confirmed by PCR (data not shown; see Materials and Methods). Splicing together the UBE1 homologous sequences using bordering splice sites revealed an open reading frame (ORF) extending from the 5[prime]-end. This ORF codes for a putative peptide of 231 amino acids from SM3.1 (six exons) and 112 amino acids (three exons) from RTL9.7. These are respectively 87.5 and 93% identical to the C-terminal end of UBE1.

Nucleotide sequence comparisons between the SM3.1, RTL9.7 and UBE1 X homologues reveal greater identity between coding than non-coding sequences, suggesting that these genes have been selectively maintained on the Y chromosome during primate evolution. The 3[prime]-UTRs and the two introns shared by SM3.1 and RTL9.7 are only 70-73% identical, while the coding regions share 86-90% identity. The coding exons of SM3.1 and RTL9.7 were respectively 81-89 and 85-91% identical to human UBE1, but the putative 3[prime]-UTRs have only 41% identity. In the lemur this latter region remains co-linear with human UBE1 and a polyadenylation signal sequence is in an identical position in both genes. Furthermore, primers derived from human UBE1 were used to amplify the second last intron from the X genes in human, squirrel monkey and lemur female DNA. This intron of ~105 bp shows 85-87% identity between X genes, but only 65% identity between respective X and Y genes. This establishes that these Y genes were not derived through recent X-Y transposition and that they truly represent descendants of an ancestral X-Y identical gene pair, which remain conserved as functional genes on the Y chromosomes of lemur and squirrel monkey.

UBE1 pseudogenes on the primate Y chromosome

The other two bands characterized were found to contain UBE1 pseudogenes. In the maramoset the 2.8 kb fragment (M2.8) was found to contain a region with 94% identity to the four 3[prime] exons of human UBE1 including the 3[prime]-UTR, suggesting that the marmoset Y chromosome carries a partially processed UBE1 pseudogene derived from the X chromosome and not a functional copy of UBE1. The 7 kb squirrel monkey fragment (SM7) contains a gene with 94% nucleotide identity to that in SM3.1 across introns and exons, but four stop codons in the exons indicate that it is a pseudogene derived by genomic duplication of the gene in SM3.1. Interestingly, this strongly reinforces the conclusion that the ORF in SM3.1 has been maintained for functional reasons.

DISCUSSION

Prior to our extended analysis of primate species there was a strong possibility that the failure to detect UBE1 homologous genes on the human and other primate Y chromosomes was due to rapid sequence divergence of the UBE1 Y gene during the estimated 80 million year evolution of the primate lineage. Based on current estimates of primate phylogeny (26), the identification of a UBE1 gene on the Y chromosome of a new world monkey shows that a functional UBE1 gene was present on the Y chromosome in an ancestor of humans less than 40 million years ago (prior to the emergence of separate hominoid, old world and new world lineages) and in an ancestor of the marmoset less than 34 million years ago (prior to the emergence of separate marmoset and squirrel monkey lineages). In these shorter time intervals it is unlikely that a functional gene would have diverged sufficiently to be undetectable in our Southern analyses. Our results therefore strongly suggest that the failure to detect a Y chromosome UBE1 homologue in human, chimpanzee, old world monkeys and marmoset is because UBE1 is not on the Y chromosome in these species.

The radiation of new world monkey species occurred in isolation in South America and distinct marmoset and squirrel monkey lineages are estimated to have emerged ~34 million years ago, shortly after the new world lineage separated from the old world and hominoid lineages 40 million years ago (26). It therefore appears that UBE1 genes were lost at two independent points in primate evolution: <40 million years ago in the old world monkey and hominoid lineage and <34 million years ago in the marmoset lineage. The proposed evolution of UBE1 genes on the mammalian sex chromosomes is summarized in Figure 4. The alternative, more parsimonious conclusion, that UBE1 has only been lost once from the primate Y chromosome, would dictate that this loss occurred in an ancestor common to marmoset, old world monkeys and hominoids but not squirrel monkey. This would imply that the split of the new world monkey lineage from the old world monkey and hominoid lineage occurred in two steps: first the squirrel monkey lineage and then the marmoset lineage. This challenges the generally accepted view of primate phylogeny and should be treated with caution until more is known about the dynamics of gene loss from the primate Y chromosome.


Figure 4. Schematic of proposed UBE1 evolution on the mammalian sex chromosomes. The exact position of events relative to branch points should be treated with caution as the same event may have occurred independently in different lineages. This appears to be the case for loss of UBE1 from the primate Y chromosome. The dates of primate phylogenetic branch points are as derived by Purvis (26). X, UBE1 only on X chromosome; X,Y, distinct UBE1 genes on the X and the Y chromosomes; X=Y, UBE1 is pseudoautosomal.

Differentiated copies of UBE1 have been evidenced in most therian mammals, indicating that UBE1 genes have been conserved on the Y chromosome for >130 million years. Here we show that despite this strong selection UBE1 homologues are not present on some primate Y chromosomes, including human. This strongly supports the hypothesis behind `Muller's ratchet', that genes in non-recombining segments of the genome accumulate deleterious mutations leading inevitably to loss of function (3,4). The localization of the monotreme UBE1 homologue to the distal end of the XY pairing region indicates that the X and Y differentiated UBE1 genes had an `autosomal' origin, suggesting that the initial reason for conservation of a distinct Y copy, once it had left the pseudoautosomal region, was to maintain the UBE1 dose in males at the level produced from the two active X chromosome copies in females. One can reasonably assume that loss of the UBE1 dose from the Y chromosome in males was compensated for by the remaining X copy, whose expression may have gradually increased as the Y allele mutated. In females increased transcription from the X chromosome would initially have led to inefficient over-production of UBE1 transcripts from two active X chromosome copies. This may have been corrected by inactivation of the UBE1 copy on the inactive X chromosome in females. Consistent with this proposed sequence of events, the UBE1 gene remains transcribed from the inactive X chromosome in human, but at only 20% of the level produced from the active X chromosome (27), suggesting that becoming susceptible to X-inactivation is indeed one of the later steps in the autosomal to X-specific evolution of sex chromosome genes.

That this is not the exclusive mode of gene evolution on the sex chromosomes has been emphasized recently by the demonstration that the multicopy gene DAZ (deleted in azoospermia) arose by transposition of an autosomal gene, DAZLA, to the Y chromosome during evolution of the primate lineage (28). In addition, the testis-specific expression of Y-borne genes with widely expressed X homologues (9,10) suggests that acquisition of a male-specific function may be a defence against inactivation and loss. Equally, the observation that many genes, including SRY, are amplified on the Y chromosome (16,28-33) implies selection for increased copy number of a partially disabled gene. The strong hybridization of the male-specific bands presented here in lemur and squirrel monkey and those previously seen in horse, rabbit and cattle (9) imply that UBE1 has recently been amplified on the Y chromosome independently in several different lineages. Alternatively, these amplifications may have no functional significance, simply reflecting reduced structural constraints on a chromosome which contains few genes and does not recombine along most of its length. Moreover, this interpretation is supported in the mouse, where there are five or six genomic copies of Ube1y, only one of which has been maintained as a functional gene (9).

In conclusion, comparative mapping of mammalian ubiquitin activating enzyme E1 gene (UBE1) homologues illustrates that a pseudoautosomal gene can evolve on the sex chromosomes to non-recombining X and Y restricted genes and then finally be lost from the Y chromosome to become an X-specific gene. Thus UBE1 confirms at the gene level the classical model of sex chromosome evolution from an autosomal pair. The isolation and comparative mapping of more genes on mammalian Y chromosomes should further elucidate the process of sex chromosome evolution.

MATERIALS AND METHODS

Southern blot analysis

Southern blots were performed as previously described (9). The full-length cDNA probe is a 3.9 kb clone pmCzJ isolated from a C57BL6 adult testis cDNA library (C.E.Bishop, unpublished results). The 3[prime] probe is a 400 bp SacI-AatII fragment corresponding to the 3[prime]-end of the coding region. It is derived from pmCzJ. The non-human genomic DNAs used were from Ornithorhyncus anaticus (platypus), Macaca arctoides (stump-tailed macaque), Macaca mulatta (rhesus monkey), Saimiri sciureus (squirrel monkey), Callithrix jacchus jacchus (marmoset) and Lemur catta (ring-tailed lemur).

Isolation and verification of male-specific fragments

Male-specific EcoRI fragments were isolated using the full-length Ube1x cDNA pmCzJ to screen libraries of size-selected fractions of EcoRI-digested DNA made as previously described (15). Hybridizing clones were subloned into pBluescript II KS+ (Stratagene). Restriction sub-fragments of those clones that hybridized to the 400 bp Ube1x cDNA probe were then subcloned and sequenced as previously described using specific oligonucleotides and ExoIII/mung bean exonuclease-generated deletions (9). The male specificity of the sequences was confirmed using primers derived from the SM3.1 sequence: oMJ153 (AAGAGTGGACACTGTGGGAT) with oMJ157 (TCTTCACCACTCTTGTCACT); oMJ155 (TTCATGCCAGCTTCCAAGCT) with oMJ157 (annealing 50°C). A strong band of the expected size was amplified from male but not female DNA of squirrel monkey and lemur. The UBE1 X gene intron sequences were amplified by PCR from female squirrel monkey, lemur and human using primers oMJ214 (ACCAAGAGTGGACATTGTGG) and oMJ216 (TGATCCAACCGTTCCTTGAG), derived from the flanking introns of the human gene. They were cloned into the plasmid vector and sequenced.

ACKNOWLEDGEMENTS

We are extremely grateful to the Duke University Primate Research Center for the ring-tailed lemur samples. This work was initiated in the Department of Obstetrics and Gynecology, University of Tennessee, Memphis, TN, and we thank J.L.Simpson for his support.

REFERENCES

1. Muller,H. (1914) A gene for the fourth chromosome of Drosophila. J. Exp. Zool., 17, 325-336.

2. Ohno,S. (1967) Sex Chromosomes and Sex-linked Genes. Springer Verlag, Berlin, Germany.

3. Charlesworth,B. (1978) Model for evolution of Y chromosomes and dosage compensation. Proc. Natl. Acad. Sci. USA, 75, 5618-5622. MEDLINE Abstract

4. Muller,H. (1964) The relation of recombination to mutational advance. Mutat. Res., 1, 2-9.

5. Graves,J. (1995) The origin and function of the mammalian Y chromosome and Y-borne genes-an evolving understanding. BioEssays, 17, 311-321. MEDLINE Abstract

6. Affara,N., Bishop,C., Brown,W., Cooke,H., Davey,P., Ellis,N., Graves,J., Jones,M., Mitchell,M., Rappold,G., Tyler-Smith,C., Yen,P. and Lau,Y.-F. (1996) Report of the second international workshop on Y chromosome mapping 1995. Cytogenet. Cell Genet., 73, 33-76. MEDLINE Abstract

7. Ellis,N. and Goodfellow,P.N. (1989) The mammalian pseudoautosomal region. Trends Genet., 5, 406-410. MEDLINE Abstract

8. Greenfield,A., Scott,D., Penniis,D., Ehrmann,I., Ellis,P., Cooper,L., Simpson,E. and Koopman,P. (1996) An H-YDb epitope is encoded by a novel mouse Y chromosome gene. Nature Genet., 14, 474-478. MEDLINE Abstract

9. Mitchell,M.J., Woods,D.R., Tucker,P.K., Opp,J.S. and Bishop,C.E. (1991) Homology of a candidate spermatogenic gene from the mouse Y chromosome to the ubiquitin-activating enzyme E1. Nature, 354, 483-486. MEDLINE Abstract

10. Mardon,G., Luoh,S.-W., Simpson,E., Gill,G., Brown,L. and Page,D. (1990) Mouse Zfx protein is similar to Zfy-2: each contains an acidic domain and 13 zinc fingers. Mol. Cell. Biol., 10, 681-688. MEDLINE Abstract

11. Schneider-Gädicke,A., Beer-Romero,P., Brown,L.G., Nussbaum,R. and Page,D.C. (1989) ZFX has a gene structure similar to ZFY, the putative human sex determinant, and escapes X inactivation. Cell, 57, 1247-1258. MEDLINE Abstract

12. Agulnik,A.I., Mitchell,M.J., Lerner,J.L., Woods,D.R. and Bishop,C.E. (1994) A mouse Y chromosome gene encoded by a region essential for spermatogenesis and expression of male-specific minor histocompatibility antigens. Hum. Mol. Genet., 3, 873-878. MEDLINE Abstract

13. Just,W., Rau,W., Vogel,W., Akhverdian,M., Fredga,K., Graves,J.A.M. and Lyapunova,E. (1995) Absence of Sry in species of the vole Ellobius. Nature Genet., 11, 117-118. MEDLINE Abstract

14. Foster,J.W., Brennan,F.E., Hampikian,G.K., Goodfellow,P.N., Sinclair,A.H., Lovell-Badge,R., Selwood,L., Renfree,M.B., Cooper,D.W. and Graves,J.A.M. (1992) Evolution of sex determination and the Y chromosome:SRY-related sequences in marsupials. Nature, 359, 531-533. MEDLINE Abstract

15. Mitchell,M.J., Woods,D.R., Wilcox,S.A., Graves,J.A.M. and Bishop,C.E. (1992) Marsupial Y chromosome encodes a homologue of the mouse Y-linked candidate spermatogenesis gene Ube1y. Nature, 359, 528-531. MEDLINE Abstract

16. Delbridge,M.L., Harry,J.L., Toder,R., Oneill,R.J.W., Ma,K., Chandley,A.C. and Graves,J.A.M. (1997) A human candidate spermatogenesis gene, RBM1, is conserved and amplified on the marsupial Y chromosome. Nature Genet., 15, 131-136. MEDLINE Abstract

17. Jentsch,S., Seufert,W., Sommer,T. and Reins,H.A. (1990) Ubiquitin-conjugating enzymes: novel regulators of eukaryotic cells. Trends Biochem. Sci., 15, 195-198. MEDLINE Abstract

18. Zacksenhaus,E. and Sheinin,R. (1990) Molecular cloning, primary structure and expression of the human X linked A1S9 gene cDNA which complements the ts A1S9 mouse L cell defect in DNA replication. EMBO J., 9, 2923-2929. MEDLINE Abstract

19. Handley-Gearhart,P.M., Trausch-Azar,J.S., Ciechanover,A. and Schwartz,A.L. (1994) Rescue of the complex temperature-sensitive phenotype of Chinese hamster ovary E36ts20 cells by expression of the human ubiquitin-activating enzyme cDNA. Biochem. J., 304, 1015-1020. MEDLINE Abstract

20. Kay,G.F., Ashworth,A., Penny,G.D., Dunlop,M., Swift,S., Brockdorf,N. and Rastan,S. (1991) A candidate spermatogenesis gene on the mouse Y chromosome is homologous to ubiquitin activating enzyme E1. Nature, 354, 486-489. MEDLINE Abstract

21. Odorisio,T., Mahadevaiah,S.K., McCarrey,J.R. and Burgoyne,P.S. (1996) Transcriptional analysis of the candidate spermatogenesis gene Ube1y and of the closely related Ube1x shows that they are coexpressed in spermatogonia and spermatids but are repressed in pachytene spermatocytes. Dev. Biol., 180, 336-343. MEDLINE Abstract

22. Sutcliffe,M.J. and Burgoyne,P.S. (1989) Analysis of the testis of H-Y negative XOSxrb mice suggests that the spermatogenesis gene (Spy) acts during the differentiation of the A spermatogonia. Development, 107, 373-380. MEDLINE Abstract

23. Murtagh,C. (1977) A unique cytogenetic system in monotremes. Chromosoma, 65, 37-57.

24. Wrigley,J.M. and Graves,J.A.M. (1988) Karyotypic conservation in the mammalian order Monotremata (Subclass Prototheria). Chromosoma, 96, 231-247. MEDLINE Abstract

25. Watson,J.M., Riggs,A. and Graves,J.A.M. (1992) Gene-mapping studies confirm the homology between the Platypus X and Echidna X(1)-chromosomes and identify a conserved ancestral monotreme X chromosome. Chromosoma, 101, 596-601. MEDLINE Abstract

26. Purvis,A. (1995) A composite estimate of primate phylogeny. Phil. Trans. R. Soc. Lond. B Biol. Sci., 348, 405-421. MEDLINE Abstract

27. Brown,C.J. and Willard,H.F. (1989) Non-inactivation of a selectable human X-linked gene that complements a murine temperature-sensitive cell cycle defect. Am. J. Med. Genet., 45, 592-598.

28. Saxena,R., Brown,L.G., Hawkins,T., Alagappan,R.K., Skaletsky,H., Reeve,M.P., Reijo,R., Rozen,S., Dinulos,M.B., Disteche,C.M. and Page,D.C. (1996) The DAZ gene-cluster on the human Y-chromosome arose from an autosomal gene that was transposed, repeatedly amplified and pruned. Nature Genet., 14, 292-299. MEDLINE Abstract

29. Manz,E., Schnieders,F., Brechlin,A. and Schmidtke,J. (1993) TSPY-related sequences represent a microheterogeneous gene family organised as constitutive elements in DYZ5 tandem repeat units on the human Y chromosome. Genomics, 17, 726-731. MEDLINE Abstract

30. Bishop,C.E. and Hatat,D. (1987) Molecular cloning and sequence analysis of a mouse Y chromosome transcript expressed in the testis. Nucleic Acids Res., 15, 2959-2969. MEDLINE Abstract

31. Laval,S., Glenister,P., Rasberry,C., Thornton,C., Mahadevaiah,S., Cooke,H., Burgoyne,P. and Cattanach,B. (1995) Y chromosome short arm-Sxr recombination in XSxr/Y males causes deletion of Rbm and XY female sex reversal. Proc. Natl. Acad. Sci. USA, 92, 10403-10407. MEDLINE Abstract

32. Bianchi,N., Bianchi,M., Bailliet,G. and de la Chapelle,A. (1993) Characterisation and sequencing of the sex determining region Y gene (Sry) in Akodon (Cricetidae) species with sex reversed females. Chromosoma, 102, 389-395. MEDLINE Abstract

33. Bianchi,N., Bianchi,M., Pamilo,P., Vidal-Rioja,L. and de la Chapelle,A. (1992) Evolution of the zinc finger-X and the zinc finger-Y genes in oryzomyne-akondtine rodents (Cricetidae). J. Mol. Evol., 34, 54-61. MEDLINE Abstract

34. Ewens,W.J., Griffiths,R.C., Ethier,S.N., Wilcox,S.A. and Graves,J.A.M. (1992) Statistical analysis of in situ hybridization data-derivation and use of the Z(max) test. Genomics, 12, 675-682. MEDLINE Abstract

*To whom correspondence should be addressed. Tel +33 4 91 25 71 54; Fax: +33 4 91 80 43 19; Email: mitchell@ibdm.univ-mrs.fr
+Present address: Murdoch Institute, Royal Children's Hospital, Melbourne, Australia

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 14 Feb 1998
Copyright© Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Genome ResHome page
F. Veyrunes, P. D. Waters, P. Miethke, W. Rens, D. McMillan, A. E. Alsop, F. Grutzner, J. E. Deakin, C. M. Whittington, K. Schatzkamer, et al.
Bird-like sex chromosomes of platypus imply recent origin of mammal sex chromosomes
Genome Res., June 1, 2008; 18(6): 965 - 973.
[Abstract] [Full Text] [PDF]

Home page
 Mol Biol EvolHome page
J. Pecon-Slattery, A. J. Pearks Wilkerson, W. J. Murphy, and S. J. O'Brien
Phylogenetic Assessment of Introns and SINEs Within the Y Chromosome Using the Cat Family Felidae As a Species Tree
Mol. Biol. Evol., December 1, 2004; 21(12): 2299 - 2309.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
W. Rens, F. Grutzner, P. C. M. O'Brien, H. Fairclough, J. A. M. Graves, and M. A. Ferguson-Smith
From The Cover: Resolution and evolution of the duck-billed platypus karyotype with an X1Y1X2Y2X3Y3X4Y4X5Y5 male sex chromosome constitution
PNAS, November 16, 2004; 101(46): 16257 - 16261.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. Pask, M. B. Renfree, and J. A. Marshall Graves
The human sex-reversing ATRX gene has a homologue on the marsupial Y chromosome, ATRY: Implications for the evolution of mammalian sex determination
PNAS, November 2, 2000; (2000) 230424497.
[Abstract] [Full Text]

Home page
 Biol. Reprod.Home page
J. A. Marshall Graves
Human Y Chromosome, Sex Determination, and Spermatogenesis--A Feminist View
Biol Reprod, September 1, 2000; 63(3): 667 - 676.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
L. Carrel, A. A. Cottle, K. C. Goglin, and H. F. Willard
From the Cover: A first-generation X-inactivation profile of the human X chromosome
PNAS, December 7, 1999; 96(25): 14440 - 14444.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
B. T. Lahn and D. C. Page
Four Evolutionary Strata on the Human X Chromosome
Science, October 29, 1999; 286(5441): 964 - 967.
[Abstract] [Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. Pask, M. B. Renfree, and J. A. Marshall Graves
The human sex-reversing ATRX gene has a homologue on the marsupial Y chromosome, ATRY: Implications for the evolution of mammalian sex determination
PNAS, November 21, 2000; 97(24): 13198 - 13202.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (29)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mitchell, M. J.
Right arrow Articles by Graves, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitchell, M. J.
Right arrow Articles by Graves, J. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?