Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (228)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Litt, M.
Right arrow Articles by Weleber, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Litt, M.
Right arrow Articles by Weleber, R. G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 471-474  

Autosomal dominant congenital cataract associated with a missense mutation in the human alpha crystallin gene CRYAA
Introduction
Results
Discussion
Materials And Methods
   Family members
   Genotyping and linkage analysis
   PCR and DNA sequencing
   Allele-specific oligonucleotide hybridization
Acknowledgements
References

Autosomal dominant congenital cataract associated with a missense mutation in the human alpha crystallin gene CRYAA

Autosomal dominant congenital cataract associated with a missense mutation in the human alpha crystallin gene CRYAA

Michael Litt1,*, Patricia Kramer1,2, Dante M. LaMorticella1, William Murphey3, Everett W. Lovrien1, Richard G. Weleber1,3

Departments of 1Molecular and Medical Genetics, 2Neurology and 3Ophthalmology, Oregon Health Sciences University, Portland, OR 97201, USA

Received 7 October, 1997; Revised and Accepted 16 December, 1997

DDBJ/EMBL/GenBank accession no. AF026952

Congenital cataracts are a common major abnormality of the eye that frequently cause blindness in infants. At least a third of all cases are familial; autosomal dominant congenital cataract (ADCC) appears to be the most common familial form in the Western world. We have mapped an ADCC gene in family ADCC-2 to chromosome 21q22.3 near the [alpha]-crystallin gene CRYAA. By sequencing the coding regions of CRYAA, we found that a missense mutation, R116C, is associated with ADCC in this family.

INTRODUCTION

Congenital cataracts are a common major abnormality of the eye that frequently cause blindness in infants (1). At least a third of all cases are familial (2); autosomal dominant congenital cataract (ADCC) appears to be the most common familial form in the Western world (3). Twelve distinct loci in humans have been identified for 10 phenotypically distinct forms of ADCC (4-16).

Crystallin genes, which encode major structural proteins in the lens, are obvious candidate genes for cataracts. Five reports of mutations in mammalian crystallin genes associated with hereditary cataracts have been published. Chambers and Russell (17) found an in-frame deletion of 12 nucleotides in the [beta]B2-crystallin gene that was associated with inherited autosomal dominant cataract in the Philly mouse. Litt et al. (18) described a chain termination mutation in the human [beta]B2-crystallin gene that was associated with autosomal dominant cerulean cataract. In the human autosomal dominant Coppock-like cataract, activation of a [gamma]-crystallin pseudogene by a cluster of sequence changes in the promoter region produces a 10-fold increase in the expression of mRNA encoding a truncated polypeptide (19). A splice site mutation in the [gamma]-crystallin gene causes an autosomal dominant cataract in the guinea pig (20), and a single nucleotide deletion in the [gamma]E-crystallin gene of the Elo mouse mutant causes autosomal dominant cataract and microphthalmia (21).

We have been studying a family (ADCC-2) with ADCC (Fig. 1). The cataracts in this family have been described as congenital zonular central nuclear opacities. In some individuals, the cataracts have been also associated with microcornea. As adults in their 30s, patients have had the development of cortical and posterior subcapsular cataracts as well. The time of surgery has varied from infancy to late childhood. Visual acuity following surgery has been as good as 20/40 in older adults, but several patients have had poor vision in each eye associated with nystagmus and often congenital microphthalmia (at least four patients). Other sequelae common in this family included amblyopia, strabismus and glaucoma.


Figure 1. Pedigree of family ADCC-2 showing haplotypes of chromosome 21 markers. Black symbols denote affected individuals; white symbols denote unaffected individuals. Genotypes are listed in the order given by the map at the left of generation 1. Samples were available for all individuals denoted by dots. Inferred haplotypes are denoted by brackets. The haplotype of the disease-bearing chromosome is boxed.

In this report, we describe linkage mapping of the ADCC gene in family ADCC-2 to chromosome 21q22.3. Because the [alpha]A-crystallin gene (CRYAA) maps to this region (22), we hypothesized that this gene might be the site of the ADCC mutation in family ADCC-2. This hypothesis was supported by our discovery of a R116C missense mutation in CRYAA that was present in all affected family members.

RESULTS

Linkage analysis of family ADCC-2 was performed with microsatellite markers mapping close to crystallin genes or mapping close to the reported locations of other ADCC genes. We found evidence for linkage with microsatellite markers D21S212 and D21S171, with pairwise Lod scores exceeding 5.0 (Table 1). Subsequently, we ran additional markers, D21S167, S168 and S1446, spanning 24 cM on chromosome 21q22.3. Of these markers, D21S1446 is the most telomeric on the CHLC map of chromosome 21q (23). Marker haplotypes are illustrated in Figure 1. With the exception of individual III-9, who is recombinant for D21S168 and the ADCC locus, the disease-bearing chromosome has the same haplotype (63924) in all affected individuals. The crossover in affected individual III-9 suggested localization of the ADCC gene telomeric to D21S168.

The [alpha]A-crystallin gene CRYAA is flanked by D21S212 and D21S171 on the yeast artificial chromosome (YAC)-based physical map of chromosome 21q (24). Hence we screened the coding regions of this gene for mutations that might be associated with ADCC in family ADCC-2. PCR primers to amplify the coding regions were designed from the published partial genomic sequence (GenBank accession no. X14789) and the full-length cDNA sequence (GenBank Accession No. U05569). The primers used are described in Table 2 and their locations in the genomic sequence are indicated in Figure 2. PCR products from the proband were sequenced directly. The sequences of exons 1 and 2 from the proband were identical to the published sequences.

Only the 5[prime] most 247 nucleotides of sequence from intron 2 (total length >1 kb) has been published (GenBank accession no. X14789). To design an upstream primer (ex3af) for amplification of exon 3 that could be used together with primer ex3r to yield a product small enough to allow the exon 3 coding sequence to be sequenced on both strands, we determined the reverse sequence of the 1.5 kb PCR product obtained using primers ex3f and ex3r. This sequence has been deposited in GenBank with the accession no. AF026952.

Table 1. Pairwise lod scores for cataracts with chromosome 21q22.3 markers
Marker [thetas]
  0.001 0.01 0.05 0.10 0.20 0.30
D21S167 -2.47 1.51 1.86 1.71 1.02 0.12
D21S168 -2.18 1.79 2.27 2.28 1.94 1.38
D21S212 5.43 5.34 4.97 4.48 3.42 2.25
D21S171 5.35 5.27 4.90 4.42 3.38 2.23
D21S1466 4.92 4.83 4.47 3.99 2.97 1.82

PCR products containing the coding region of exon 3 from the proband (individual IV-6) in family ADCC-2 and from unaffected family member III-8 were sequenced directly. Individual IV-6 (but not unaffected individual III-8) was heterozygous for a C[rarr]T transition at position 413 of the cDNA sequence (data not shown). This corresponds to the first base of the codon normally encoding arginine residue 116, changing this residue to a cysteine (R116C).

Allele-specific oligonucleotides (ASOs) were designed to test for the presence of the mutation in additional family members and unrelated individuals. A Southern blot of PCR products from exon 3 of family members, probed with the ASO 413A corresponding to the mutant sequence, is shown in Figure 3. All of the eight additional family members tested, who were heterozygous for the disease-bearing chromosome as determined by linkage analysis, had the mutation. None of the 14 additional family members tested who lacked this chromosome had the mutation. When the blot was re-probed with the wild-type ASO (413G), all family members gave signals (data not shown). In addition, all 111 unrelated unaffected individuals (CEPH grandparents and parents) tested by this method lacked the mutation (data not shown).

Table 2. Primers used for amplification of CRYAA exons
Exon Primers Product size (bp)
1 1f CTCCAGGTCCCCGTGGTA 250
  ex1r AGGAGAGGCCAGCACCAC
2 ex2f CTGTCTCTGCCAACCCCAG 219
  ex2r CTGTCCCACCTCTCAGTGCC
3 ex3f TCACCATTCCCGAGCTAATGTG 1500a
  ex3r GAGCCAGCCGAGGCAATG
  ex3af GGCAGCTTCTCTGGCATG 308b
aLength of product obtained with primers CRYAex3f/CRYAex3r as estimated from agarose gel electrophoresis.
bLength of product obtained with primers CRYAex3af/CRYAex3r as predicted from the DNA sequence.

DISCUSSION

We have described a family with ADCC associated with a C413T mutation in the human CRYAA gene. Although all 222 chromosomes from unaffected unrelated individuals screened lacked the C413T alteration, it remains possible that this variant could be a rare polymorphism in the normal population. However, for the following reasons, we believe that the C413T alteration is the causative mutation in ADCC-2 rather than than just a polymorphism in strong linkage disequilibrium with the causative mutation. (i) The mutation segregates with the disease phenotype in family ADCC-2 and is absent from the 111 additional unrelated individuals screened. (ii) As illustrated in Figure 4, Arg116, the residue changed by the mutation, is invariant in 28 mammalian species as well as in chicken and frog (25). In addition, the [alpha]-crystallins have a strong tendency to keep their net charge constant throughout evolution (25). (iii) Recent studies of the structure and function of [alpha]A-crystallin using site-directed spin labeling indicate that the conserved Arg112 and Arg116 are in a `buried environment, indicating the presence of buried salt bridges in the core of the [alpha]A-crystallin oligomer and/or the subunits' (26). Substitution of Arg116 by cysteine would be expected to disrupt one of these salt bridges and might also lead to the formation of additional disulfide bonds, thereby destabilizing the native structure of the [alpha]A-crystallin polypeptide.


Figure 2. Exon-intron structure of the CRYAA gene showing approximate locations of primers used in this study. Exons are shown as boxes, coding regions are open, and untranslated regions are hatched.


Figure 3. Allele-specific hybridization of PCR products containing exon 3 from members of family ADCC-2 with ASO 413A. Numbers above the lanes correspond to the ID numbers of family members in the pedigree of Figure 1.


Figure 4. Amino acid sequences of residues 109-130 of [alpha]-crystrallin A chains from 28 mammalian species, chicken and frog. These data were taken from ref. 25.

The importance of [alpha]-crystallins in the maintenance of lens transparency was clearly demonstrated by the work of Brady et al. (27) who showed that mice homozygous for a targeted disruption of the [alpha]A-crystallin gene developed cataracts and had cytoplasmic inclusion bodies containing the small heat shock protein [alpha]B-crystallin. We speculate that the cataracts in family ADCC-2 may result from partial loss of the chaperone function (27) of [alpha]A-crystallin, and/or from an increased tendency of the mutant polypeptide to aggregate because of its decreased positive charge and its gain of a sulfhydryl group. Biophysical studies of the mutant [alpha]A-crystallin may elucidate the mechanism of cataract formation.

Five of those affected in family ADCC-2 had, in conjunction with their cataracts, congenital nystagmus and congenital microphthalmia, often with corneal diameters of ~9 mm. The nystagmus attests to the severity of the visual deprivation from early infancy. Congenital microphthalmia previously has been reported in rare families with ADCCs (28-30). The presence of congenital microphthalmia in our family indicates that [alpha]A-crystallin, similarly to [gamma]E-crystallin in the Elo mutant mouse (21), appears to play an important role in the normal embryological development of the anterior segment of the eye.

MATERIALS AND METHODS

Family members

The family consisted of 13 affected and 11 unaffected members spanning four generations. Subjects were invited to participate and gave informed consent to the study protocol, which was approved by the institutional review board of the Oregon Health Sciences University. A total of 23 family members (nine affected, 11 unaffected and three spouses of affected) gave blood samples, allowed access to ophthalmological records and, in several instances, were examined ophthalmologically by one of the authors (R.G.W.). All affected patients had a history of congenital cataracts requiring surgery on one or both eyes.

Genotyping and linkage analysis

DNA was extracted from buffy coats by a salting out procedure (31). Typing with microsatellite markers was performed as previously described (14). Pairwise linkage analyses were conducted as previously described (14). We assumed autosomal dominant inheritance of a rare gene (frequency 0.0001) with nearly complete penetrance (0.95). Since onset occurs by childhood, we did not incorporate an age correction.

PCR and DNA sequencing

Three-temperature `touchdown' PCR was performed using an initial annealing temperature of 75°C which was decreased by 1°C in each of the first 15 cycles, then maintained at 60°C for 29 more cycles. Each cycle consisted of a 15 s, 94°C denaturing step, a 30 s annealing step, and a 3 min 72°C extension. The PCR reaction mixtures contained standard Perkin-Elmer/Cetus PCR buffer and AmpliTaq polymerase with 2.5 mM MgCl2. Primers (Table 2 ) were present at 0.5 µM. PCR products were gel purified (Qiaex-II kit, Qiagen) and sequenced on an ABI 373 sequencer. Both strands were sequenced using either the forward or reverse primer used for PCR together with the Amplitaq FS cycle sequencing kit with dye-labeled terminators.

Allele-specific oligonucleotide hybridization

ASOs corresponding to the mutant (413A) and wild-type (413G) sequences were as follows: 413A, 5[prime]-GTAGCGGCAGTGGAACT-3[prime]; and 413G, 5[prime]-GTAGCGGCGGTGGAACT-3[prime]. ASOs were labeled individually with digoxigenin using the DIG oligonucleotide 3[prime] end labeling kit (Boehringer). Following electrophoresis on 1.6% agarose gels, PCR products containing CRYAA exon 3 were transferred to Hybond N+ membranes (Amersham). After pre-hybridization for 2-4 h, blots were probed overnight with the digoxigenin-labeled ASO 413A at 2 µM in the presence of a 20-fold excess of the unlabeled ASO 413G. Hybridizations and pre-hybridizations were performed at 37°C in 5× SSC, 1% blocking reagent (Boehringer catalogue no. 1-096-176), 0.2% SDS, 1% N-lauroyl sarcosine. Blots were washed at room temperature briefly in 2× SSC/0.1% SDS and then in TMAC wash (3 M tetramethylammonium chloride, 50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.1% SDS). Blots were then washed twice for 10 min each time at 52°C in TMAC wash (32). Labeled fragments were detected colorimetrically using the DIG Nucleic Acid Detection Kit (Boehringer).

ACKNOWLEDGEMENTS

We thank Robin Schwartz for her assistance with family studies and we thank the Vollum Institute sequencing core facility for DNA sequencing. This work was funded by NIH grant 1RO1-EY11710 to M.L.

REFERENCES

1. Lund, A., Eiberg, H., Rosenburg, T. and Warburg, M. (1992) Autosomal dominant congenital cataract: linkage relations, clinical and genetic heterogeneity. Clin. Genet., 41, 65-69. MEDLINE Abstract

2. Reese, P., Truck-Muller C. and Maumenee, I. (1987) Autosomal dominant congenital cataract associated with chromosomal translocation [t(3;4)(p26.2;p15)]. Arch. Opthalmol., 105, 1382-1384.

3. Marner, E., Rosenburg, T. and Eiberg, H. (1989) Autosomal dominant congenital cataract: morphology and genetic mapping. Acta Opthalmol., 67, 151-158.

4. Renwick, J. and Lawler, S. (1963) Probable linkage between a congenital cataract locus and the Duffy blood group locus. Ann. Hum. Genet., 27, 67-84.

5. Lubsen, N., Renwick, J. and Schoenmakers, J. (1986) Hereditary cataract: perspective for prenatal screening. Opthalmic Paediatr. Genet., 7, 195-200.

6. Richards, J., Maumenee, I., Rowe, S. and Lovrien, E. (1984) Congenital cataract possibly linked to haptoglobin. Cytogenet. Cell. Genet., 37, 570.

7. Eiberg, H., Marner, E., Rosenberg, T. and Mohr, J. (1988) Marner's cataract (CAM) assigned to chromosome 16: linkage to haptoglobin. Clin. Genet., 34, 272-275. MEDLINE Abstract

8. Eiberg, H., Lund, A.M., Warburg, M. and Rosenberg, T. (1995) Assignment of congenital cataract Volkmann type (CCV) to chromosome 1p36. Hum. Genet., 96, 33-38. MEDLINE Abstract

9. Glaser, T., Jepeal, L., Edwards, J.G., Young, S.R., Favor, J. and Maas, R.L. (1994) PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nature Genet., 7, 463-471. MEDLINE Abstract

10. Armitage, M.M., Kivlin, J.D. and Ferrell, R.E. (1995) A progressive early onset cataract gene maps to human chromosome 17q24. Nature Genet., 9, 37-40. MEDLINE Abstract

11. Berry, V., Ionides, A.C.W., Moore, A.T., Plant, C., Bhattacharya, S.S. and Shiels, A. (1996) A locus for autosomal dominant anterior polar cataract on chromosome 17p. Hum. Mol. Genet., 5, 415-419. MEDLINE Abstract

12. Padma, T., Ayyagari, R., Murty, J.S., Basti, S., Fletcher, T., Rao, G.N., Kaiserkupfer, M. and Hejtmancik, J.F. (1995) Autosomal dominant zonular cataract with sutural opacities localized to chromosome 17q11-12. Am. J. Hum. Genet., 57, 840-845. MEDLINE Abstract

13. Rogaev, E.I., Rogaeva, E.A., Korovaitseva, G.I., Farrer, L.A., Petrin, A.N., Keryanov, S.A., Turaeva, S., Chumakov, I., St George-Hyslop, P. and Ginter, E.K. (1996) Linkage of polymorphic congenital cataract to the [gamma]-crystallin gene locus on human chromosome 2q33-q35. Hum. Mol. Genet., 5, 699-703. MEDLINE Abstract

14. Kramer, P., Yount, J., Mitchell, T., LaMorticella, D., Carrero-Valenzuela, R., Lovrien, E., Maumenee, I. and Litt, M. (1996) A second gene for cerulean cataracts maps to the [beta]-crystallin region on chromosome 22. Genomics, 35, 539-542. MEDLINE Abstract

15. Ionides, A.C.W., Berry, V., Mackay, D.S., Moore, A.T., Bhattacharya, S.S. and Shiels, A. (1997) A locus for autosomal dominant posterior polar cataract on chromosome 1p. Hum. Mol. Genet., 6, 47-51. MEDLINE Abstract

16. Mackay, D., Ionides, A., Berry, V., Moore, A., Bhattacharya, S. and Shiels, A. (1997) A new locus for dominant 'zonular pulverulent" cataract, on chromosome 13. Am. J. Hum. Genet., 60, 1474-1478. MEDLINE Abstract

17. Chambers, C. and Russell, P. (1991) Deletion mutation in an eye lens [beta]-crystallin: an animal model for inherited cataracts. J. Biol. Chem., 266, 6742-6746. MEDLINE Abstract

18. Litt, M., Carrero-Valenzuela, R., LaMorticella, D.M., Schultz, D.W., Mitchell, T.N., Kramer, P. and Maumenee, I.H. (1997) Autosomal dominant cerulean cataract is associated with a chain termination mutation in the human beta crystallin gene CRYBB2. Hum. Mol. Genet., 6, 665-668. MEDLINE Abstract

19. Brakenhoff, R.H., Henskens, H.A.M., Vanrossum, M.W.P.C., Lubsen, N.H. and Schoenmakers, J.G.G. (1994) Activation of the [gamma]E-crystallin pseudogene in the human hereditary Coppock-like cataract. Hum. Mol. Genet., 3, 279-283. MEDLINE Abstract

20. Rodriguez, I.R., Gonzalez, P., Zigler, J.S. and Borras T. (1992) A guinea-pig hereditary cataract contains a splice-site deletion in a crystallin gene. Biochim. Biophys. Acta, 1180, 44-52. MEDLINE Abstract

21. Cartier, M., Breitman, M.L. and Tsui, L.-C. (1992) A frameshift mutation in the [gamma]E-crystallin gene of the Elo mouse. Nature Genet., 2, 42-45. MEDLINE Abstract

22. Hawkins, J.W., Van Keuren, M.L., Piatigorsky, J., Law, M.L., Patterson, D. and Kao, F.-T. (1987) Confirmation of assignment of the human alpha-1-crystallin gene (CRYA1) to chromosome 21 with regional localization to q22.3. Hum. Genet., 76, 375-380. MEDLINE Abstract

23. Cooperative Human Linkage Center, URL: http://www.chlc. org:80/cgi-bin/CHLCMapsChr?v4.recmin.v3.recmin.sexave

24. Chumakov, I., Rigault, P., Guillou, S., Ougen, P., Billaut, A., Guasconi, G., Gervy P., LeGall, I., Soularue, P., Grinas, L., Bougueleret, L., Bellanne-Chantelot, C., Lacroix, B., Barillot, E., Gesnouin, P., Pook, S., Vaysseix, G., Frelat, G., Schmitz, A., Sambucy, J.-L., Bosch, A., Estivill, X., Weissenbach, J., Vignal, A., Riethman, H., Cox, D., Patterson, D., Gardiner, K., Hattori, M., Sakai, Y., Ichikawa, H., Ohki, M., Le Paslier, D., Heilig, R., Antonarakis, S. and Cohen, D. (1992) Continuum of overlapping clones spanning the entire human chromosome 21q. Nature, 359, 380-387. MEDLINE Abstract

25. deJong, W.W., Zweers, A., Versteeg, M. and Nuy-Terwindt, E.C. (1984) Primary structures of the [alpha]-crystallin A chains of twenty-eight mammalian species, chicken and frog. Eur. J. Biochem., 141, 131-140.

26. Berengian, A.R., Bova, M.P. and Mchaourab, H.S. (1997) Structure and function of the conserved domain in [alpha]A-crystallin. Site-directed spin labeling identifies a [beta]-strand located near a subunit interface. Biochemistry, 36, 9951-9957. MEDLINE Abstract

27. Brady, J.P., Garland, D., Duglas-Tabor, Y., Robison, W.G., Groome, A. and Wawrousek, E.F. (1997) Targeted disruption of the mouse alpha A-crystallin gene induces cataract and cytoplasmic inclusion bodies containing the small heat shock protein alpha B-crystallin. Proc. Natl Acad. Sci. USA, 94, 884-889. MEDLINE Abstract

28. Capella, J.A., Kaufman, H.E., Lill, F.J. and Cooper, G. (1963) Hereditary cataracts and microphthalmia. Am. J. Ophthalmol., 56, 454-458.

29. Yokoyama, Y., Narahara, K., Tsuji, K., Ninomiya, S. and Seino, Y. (1992) Autosomal dominant congenital cataract and microphthalmia associated with a familial t(2;16) translocation. Hum. Genet., 90, 177-178. MEDLINE Abstract

30. Zeiter, H.J. (1963) Congenital microphthalmus: a pedigree of 4 affected siblings and an additional report of 44 sporadic cases. Am. J. Ophthalmol., 55, 910-922.

31. Miller, S.A., Dykes, D.D. and Polesky, H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res., 16, 1215.

32. Avidor, B., Zakut, H. and Kerem, B. (1996) Simple, noradioactive method to detect major cystic fibrosis mutations in Ashkenazi Jews. Clin. Chem., 47, 103-105.

*To whom correspondence should be addressed. Tel: +1 503 494 7717; Fax: +1 503 494 8393; Email: litt@ohsu.edu

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 14 Feb 1998
Copyright© Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
N. Jaya, V. Garcia, and E. Vierling
Substrate binding site flexibility of the small heat shock protein molecular chaperones
PNAS, September 15, 2009; 106(37): 15604 - 15609.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Y. Munemasa, J. M. K. Kwong, J. Caprioli, and N. Piri
The Role of {alpha}A- and {alpha}B-Crystallins in the Survival of Retinal Ganglion Cells after Optic Nerve Axotomy
Invest. Ophthalmol. Vis. Sci., August 1, 2009; 50(8): 3869 - 3875.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Q. Huang, L. Ding, K. B. Phan, C. Cheng, C.-h. Xia, X. Gong, and J. Horwitz
Mechanism of Cataract Formation in {alpha}A-crystallin Y118D Mutation
Invest. Ophthalmol. Vis. Sci., June 1, 2009; 50(6): 2919 - 2926.
[Abstract] [Full Text] [PDF]

Home page
 NeurologyHome page
H. Houlden, M. Laura, F. Wavrant-De Vrieze, J. Blake, N. Wood, and M. M. Reilly
Mutations in the HSP27 (HSPB1) gene cause dominant, recessive, and sporadic distal HMN/CMT type 2
Neurology, November 18, 2008; 71(21): 1660 - 1668.
[Abstract] [Full Text] [PDF]

Home page
 J BiochemHome page
A. Biswas, S. Lewis, B. Wang, M. Miyagi, P. Santoshkumar, M. H. Gangadhariah, and R. H. Nagaraj
Chemical Modulation of the Chaperone Function of Human {alpha}A-Crystallin
J. Biochem., July 1, 2008; 144(1): 21 - 32.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J.-h. Xi, F. Bai, J. Gross, R. R. Townsend, A. S. Menko, and U. P. Andley
Mechanism of Small Heat Shock Protein Function in Vivo: A KNOCK-IN MOUSE MODEL DEMONSTRATES THAT THE R49C MUTATION IN {alpha}A-CRYSTALLIN ENHANCES PROTEIN INSOLUBILITY AND CELL DEATH
J. Biol. Chem., February 29, 2008; 283(9): 5801 - 5814.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
D. Cohen, U. Bar-Yosef, J. Levy, L. Gradstein, N. Belfair, R. Ofir, S. Joshua, T. Lifshitz, R. Carmi, and O. S. Birk
Homozygous CRYBB1 Deletion Mutation Underlies Autosomal Recessive Congenital Cataract
Invest. Ophthalmol. Vis. Sci., May 1, 2007; 48(5): 2208 - 2213.
[Abstract] [Full Text] [PDF]

Home page
 Arch OphthalmolHome page
A. Shiels and J. F. Hejtmancik
Genetic Origins of Cataract
Arch Ophthalmol, February 1, 2007; 125(2): 165 - 173.
[Full Text] [PDF]

Home page
 Arch OphthalmolHome page
F. Beby, C. Commeaux, M. Bozon, P. Denis, P. Edery, and L. Morle
New Phenotype Associated With an Arg116Cys Mutation in the CRYAA Gene: Nuclear Cataract, Iris Coloboma, and Microphthalmia
Arch Ophthalmol, February 1, 2007; 125(2): 213 - 216.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. B. Bateman, L. Richter, P. Flodman, D. Burch, S. Brown, P. Penrose, O. Paul, D. D. Geyer, D. G. Brooks, and M. A. Spence
A new locus for autosomal dominant cataract on chromosome 19: linkage analyses and screening of candidate genes.
Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3441 - 3449.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
M. Liu, T. Ke, Z. Wang, Q. Yang, W. Chang, F. Jiang, Z. Tang, H. Li, X. Ren, X. Wang, et al.
Identification of a CRYAB Mutation Associated with Autosomal Dominant Posterior Polar Cataract in a Chinese Family.
Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3461 - 3466.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
C.-h. Xia, H. Liu, B. Chang, C. Cheng, D. Cheung, M. Wang, Q. Huang, J. Horwitz, and X. Gong
Arginine 54 and Tyrosine 118 Residues of {alpha}A-Crystallin Are Crucial for Lens Formation and Transparency.
Invest. Ophthalmol. Vis. Sci., July 1, 2006; 47(7): 3004 - 3010.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
K. Goishi, A. Shimizu, G. Najarro, S. Watanabe, R. Rogers, L. I. Zon, and M. Klagsbrun
{alpha}A-crystallin expression prevents {gamma}-crystallin insolubility and cataract formation in the zebrafish cloche mutant lens
Development, July 1, 2006; 133(13): 2585 - 2593.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. A. Koteiche and H. S. Mchaourab
Mechanism of a Hereditary Cataract Phenotype: MUTATIONS IN {alpha}A-CRYSTALLIN ACTIVATE SUBSTRATE BINDING
J. Biol. Chem., May 19, 2006; 281(20): 14273 - 14279.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
C.-D. Hsu, S. Kymes, and J. M. Petrash
A Transgenic Mouse Model for Human Autosomal Dominant Cataract
Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 2036 - 2044.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Y. Liu, X. Zhang, L. Luo, M. Wu, R. Zeng, G. Cheng, B. Hu, B. Liu, J. J. Liang, and F. Shang
A Novel {alpha}B-Crystallin Mutation Associated with Autosomal Dominant Congenital Lamellar Cataract.
Invest. Ophthalmol. Vis. Sci., March 1, 2006; 47(3): 1069 - 1075.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
F. Y. Lee, H. R. Kast-Woelbern, J. Chang, G. Luo, S. A. Jones, M. C. Fishbein, and P. A. Edwards
{alpha}-Crystallin Is a Target Gene of the Farnesoid X-activated Receptor in Human Livers
J. Biol. Chem., September 9, 2005; 280(36): 31792 - 31800.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Y. V. Sergeev, L. V. Soustov, E. V. Chelnokov, N. M. Bityurin, P. S. Backlund Jr, P. T. Wingfield, M. A. Ostrovsky, and J. F. Hejtmancik
Increased Sensitivity of Amino-Arm Truncated {beta}A3-Crystallin to UV-Light-Induced Photoaggregation
Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3263 - 3273.
[Abstract] [Full Text] [PDF]

Home page
 Arch NeurolHome page
B. Tang, X. Liu, G. Zhao, W. Luo, K. Xia, Q. Pan, F. Cai, Z. Hu, C. Zhang, B. Chen, et al.
Mutation Analysis of the Small Heat Shock Protein 27 Gene in Chinese Patients With Charcot-Marie-Tooth Disease
Arch Neurol, August 1, 2005; 62(8): 1201 - 1207.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Liu, X. Du, M. Wang, Q. Huang, L. Ding, H. W. McDonald, J. R. Yates III, B. Beutler, J. Horwitz, and X. Gong
Crystallin {gamma}B-I4F Mutant Protein Binds to {alpha}-Crystallin and Affects Lens Transparency
J. Biol. Chem., July 1, 2005; 280(26): 25071 - 25078.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
S. Carra, M. Sivilotti, A. T. Chavez Zobel, H. Lambert, and J. Landry
HspB8, a small heat shock protein mutated in human neuromuscular disorders, has in vivo chaperone activity in cultured cells
Hum. Mol. Genet., June 15, 2005; 14(12): 1659 - 1669.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
W. Ferrini, D. F. Schorderet, P. Othenin-Girard, S. Uffer, E. Heon, and F. L. Munier
CRYBA3/A1 Gene Mutation Associated with Suture-Sparing Autosomal Dominant Congenital Nuclear Cataract: A Novel Phenotype
Invest. Ophthalmol. Vis. Sci., May 1, 2004; 45(5): 1436 - 1441.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
O. K. Argirov, B. Lin, and B. J. Ortwerth
2-Ammonio-6-(3-oxidopyridinium-1-yl)hexanoate (OP-lysine) Is a Newly Identified Advanced Glycation End Product in Cataractous and Aged Human Lenses
J. Biol. Chem., February 20, 2004; 279(8): 6487 - 6495.
[Abstract] [Full Text] [PDF]

Home page
 Br J OphthalmolHome page
K P Burdon, M G Wirth, D A Mackey, I M Russell-Eggitt, J E Craig, J E Elder, J L Dickinson, and M M Sale
Investigation of crystallin genes in familial cataract, and report of two disease associated mutations
Br J Ophthalmol, January 1, 2004; 88(1): 79 - 83.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Y. Pasta, B. Raman, T. Ramakrishna, and Ch. M. Rao
Role of the Conserved SRLFDQFFG Region of {alpha}-Crystallin, a Small Heat Shock Protein: EFFECT ON OLIGOMERIC SIZE, SUBUNIT EXCHANGE, AND CHAPERONE-LIKE ACTIVITY
J. Biol. Chem., December 19, 2003; 278(51): 51159 - 51166.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
D. W. Schultz, M. L. Klein, A. J. Humpert, C. W. Luzier, V. Persun, M. Schain, A. Mahan, C. Runckel, M. Cassera, V. Vittal, et al.
Analysis of the ARMD1 locus: evidence that a mutation in HEMICENTIN-1 is associated with age-related macular degeneration in a large family
Hum. Mol. Genet., December 15, 2003; 12(24): 3315 - 3323.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. A. Sathish, R. A. Stein, G. Yang, and H. S. Mchaourab
Mechanism of Chaperone Function in Small Heat-shock Proteins: FLUORESCENCE STUDIES OF THE CONFORMATIONS OF T4 LYSOZYME BOUND TO {alpha}B-CRYSTALLIN
J. Biol. Chem., November 7, 2003; 278(45): 44214 - 44221.
[Abstract] [Full Text] [PDF]

Home page
 Integr. Comp. Biol.Home page
M. Posner
A Comparative View of Alpha Crystallins: The contribution of comparative studies to understanding function
Integr. Comp. Biol., August 1, 2003; 43(4): 481 - 491.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. T. Chavez Zobel, A. Loranger, N. Marceau, J. R. Theriault, H. Lambert, and J. Landry
Distinct chaperone mechanisms can delay the formation of aggresomes by the myopathy-causing R120G {alpha}B-crystallin mutant
Hum. Mol. Genet., July 1, 2003; 12(13): 1609 - 1620.
[Abstract] [Full Text] [PDF]

Home page
 Br J OphthalmolHome page
R V Jamieson, F Munier, A Balmer, N Farrar, R Perveen, and G C M Black
Pulverulent cataract with variably associated microcornea and iris coloboma in a MAF mutation family
Br J Ophthalmol, April 1, 2003; 87(4): 411 - 412.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
J. H. Xi, F. Bai, and U. P. Andley
Reduced survival of lens epithelial cells in the {alpha}A-crystallin-knockout mouse
J. Cell Sci., March 15, 2003; 116(6): 1073 - 1085.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
L. Fu and J. J.-N. Liang
Alteration of Protein-Protein Interactions of Congenital Cataract Crystallin Mutants
Invest. Ophthalmol. Vis. Sci., March 1, 2003; 44(3): 1155 - 1159.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. den Engelsman, V. Keijsers, W. W. de Jong, and W. C. Boelens
The Small Heat-shock Protein alpha B-Crystallin Promotes FBX4-dependent Ubiquitination
J. Biol. Chem., February 7, 2003; 278(7): 4699 - 4704.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Y. Pasta, B. Raman, T. Ramakrishna, and Ch. M. Rao
Role of the C-terminal Extensions of alpha -Crystallins. SWAPPING THE C-TERMINAL EXTENSION OF alpha A-CRYSTALLIN TO alpha B-CRYSTALLIN RESULTS IN ENHANCED CHAPERONE ACTIVITY
J. Biol. Chem., November 22, 2002; 277(48): 45821 - 45828.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. S. Mchaourab, E. K. Dodson, and H. A. Koteiche
Mechanism of Chaperone Function in Small Heat Shock Proteins. TWO-MODE BINDING OF THE EXCITED STATES OF T4 LYSOZYME MUTANTS BY alpha A-CRYSTALLIN
J. Biol. Chem., October 18, 2002; 277(43): 40557 - 40566.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. P. Bova, Q. Huang, L. Ding, and J. Horwitz
Subunit Exchange, Conformational Stability, and Chaperone-like Function of the Small Heat Shock Protein 16.5 from Methanococcus jannaschii
J. Biol. Chem., October 4, 2002; 277(41): 38468 - 38475.
[Abstract] [Full Text] [PDF]

Home page
 Br J OphthalmolHome page
M G Wirth, I M Russell-Eggitt, J E Craig, J E Elder, and D A Mackey
Aetiology of congenital and paediatric cataract in an Australian population
Br J Ophthalmol, July 1, 2002; 86(7): 782 - 786.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
N. B. Haider, A. Ikeda, J. K. Naggert, and P. M. Nishina
Genetic modifiers of vision and hearing
Hum. Mol. Genet., May 15, 2002; 11(10): 1195 - 1206.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
U. P. Andley, H. C. Patel, and J.-H. Xi
The R116C Mutation in alpha A-crystallin Diminishes Its Protective Ability against Stress-induced Lens Epithelial Cell Apoptosis
J. Biol. Chem., March 15, 2002; 277(12): 10178 - 10186.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Fu and J. J-N Liang
Detection of Protein-Protein Interactions among Lens Crystallins in a Mammalian Two-hybrid System Assay
J. Biol. Chem., February 1, 2002; 277(6): 4255 - 4260.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
K. J. Lampi, M. Shih, Y. Ueda, T. R. Shearer, and L. L. David
Lens Proteomics: Analysis of Rat Crystallin Sequences and Two-Dimensional Electrophoresis Map
Invest. Ophthalmol. Vis. Sci., January 1, 2002; 43(1): 216 - 224.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. Graw, J. Loster, D. Soewarto, H. Fuchs, B. Meyer, A. Reis, E. Wolf, R. Balling, and M. H. de Angelis
Characterization of a New, Dominant V124E Mutation in the Mouse {alpha}A-Crystallin-Encoding Gene
Invest. Ophthalmol. Vis. Sci., November 1, 2001; 42(12): 2909 - 2915.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. P. Brady, D. L. Garland, D. E. Green, E. R. Tamm, F. J. Giblin, and E. F. Wawrousek
{alpha}B-Crystallin in Lens Development and Muscle Integrity: A Gene Knockout Approach
Invest. Ophthalmol. Vis. Sci., November 1, 2001; 42(12): 2924 - 2934.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
Vanita, V. Sarhadi, A. Reis, M. Jung, D. Singh, K. Sperling, J. R. Singh, and J. Bürger
A unique form of autosomal dominant cataract explained by gene conversion between {beta}-crystallin B2 and its pseudogene
J. Med. Genet., June 1, 2001; 38(6): 392 - 396.
[Full Text]

Home page
 Br J OphthalmolHome page
P. Francis, V. Berry, S. Bhattacharya, and A. Moore
Congenital progressive polymorphic cataract caused by a mutation in the major intrinsic protein of the lens, MIP (AQP0)
Br J Ophthalmol, December 1, 2000; 84(12): 1376 - 1379.
[Abstract] [Full Text]

Home page
 IOVSHome page
J. B. Bateman, D. D. Geyer, P. Flodman, M. Johannes, J. Sikela, N. Walter, A. T. Moreira, K. Clancy, and M. A. Spence
A New {beta}A1-Crystallin Splice Junction Mutation in Autosomal Dominant Cataract
Invest. Ophthalmol. Vis. Sci., October 1, 2000; 41(11): 3278 - 3285.
[Abstract] [Full Text]

Home page
 IOVSHome page
E. Pras, M. Frydman, E. Levy–Nissenbaum, T. Bakhan, J. Raz, E. I. Assia, B. Goldman, and E. Pras
A Nonsense Mutation (W9X) in CRYAA Causes Autosomal Recessive Cataract in an Inbred Jewish Persian Family
Invest. Ophthalmol. Vis. Sci., October 1, 2000; 41(11): 3511 - 3515.
[Abstract] [Full Text]

Home page
 IOVSHome page
J. B. Bateman, M. Johannes, P. Flodman, D. D. Geyer, K. P. Clancy, C. Heinzmann, T. Kojis, R. Berry, R. S. Sparkes, and M. A. Spence
A New Locus for Autosomal Dominant Cataract on Chromosome 12q13
Invest. Ophthalmol. Vis. Sci., August 1, 2000; 41(9): 2665 - 2670.
[Abstract] [Full Text]

Home page
 Hum Mol GenetHome page
S. Kmoch, J. Brynda, B. Asfaw, K. Bezouska, P. Novak, P. Rezacova, L. Ondrova, M. Filipec, J. Sedlacek, and M. Elleder
Link between a novel human {gamma}D-crystallin allele and a unique cataract phenotype explained by protein crystallography
Hum. Mol. Genet., July 22, 2000; 9(12): 1779 - 1786.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
P J Francis, V Berry, S S Bhattacharya, and A T Moore
The genetics of childhood cataract
J. Med. Genet., July 1, 2000; 37(7): 481 - 488.
[Abstract] [Full Text]

Home page
 IOVSHome page
P. L. Kramer, D. LaMorticella, K. Schilling, A. M. Billingslea, R. G. Weleber, and M. Litt
A New Locus for Autosomal Dominant Congenital Cataracts Maps to Chromosome 3
Invest. Ophthalmol. Vis. Sci., January 1, 2000; 41(1): 36 - 39.
[Abstract] [Full Text]

Home page
 IOVSHome page
D. Gill, R. Klose, F. L. Munier, M. McFadden, M. Priston, G. Billingsley, N. Ducrey, D. F. Schorderet, and E. Héon
Genetic Heterogeneity of the Coppock-like Cataract: A Mutation in CRYBB2 on Chromosome 22q11.2
Invest. Ophthalmol. Vis. Sci., January 1, 2000; 41(1): 159 - 165.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
S. A. Datta and Ch. M. Rao
Differential Temperature-dependent Chaperone-like Activity of alpha A- and alpha B-crystallin Homoaggregates
J. Biol. Chem., December 3, 1999; 274(49): 34773 - 34778.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. D. Perng, P. J. Muchowski, P. van den IJssel, G. J. S. Wu, A. M. Hutcheson, J. I. Clark, and R. A. Quinlan
The Cardiomyopathy and Lens Cataract Mutation in alpha B-crystallin Alters Its Protein Structure, Chaperone Activity, and Interaction with Intermediate Filaments in Vitro
J. Biol. Chem., November 19, 1999; 274(47): 33235 - 33243.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. J. Muchowski, L. G. Hays, J. R. Yates III, and J. I. Clark
ATP and the Core "alpha -Crystallin" Domain of the Small Heat-shock Protein alpha B-crystallin
J. Biol. Chem., October 15, 1999; 274(42): 30190 - 30195.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. V. S. Kumar, T. Ramakrishna, and Ch. M. Rao
Structural and Functional Consequences of the Mutation of a Conserved Arginine Residue in alpha A and alpha B Crystallins
J. Biol. Chem., August 20, 1999; 274(34): 24137 - 24141.
[Abstract] [Full Text] [PDF]

Home page
 Br J OphthalmolHome page
A. Ionides, P. Francis, V. Berry, D. Mackay, S. Bhattacharya, A. Shiels, and A. Moore
Clinical and genetic heterogeneity in autosomal dominant cataract
Br J Ophthalmol, July 1, 1999; 83(7): 802 - 808.
[Abstract] [Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. P. Bova, O. Yaron, Q. Huang, L. Ding, D. A. Haley, P. L. Stewart, and J. Horwitz
Mutation R120G in alpha B-crystallin, which is linked to a desmin-related myopathy, results in an irregular structure and defective chaperone-like function
PNAS, May 25, 1999; 96(11): 6137 - 6142.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
D. A. Stephan, E. Gillanders, D. Vanderveen, D. Freas-Lutz, G. Wistow, A. D. Baxevanis, C. M. Robbins, A. Van Auken, M. I. Quesenberry, J. Bailey-Wilson, et al.
Progressive juvenile-onset punctate cataracts caused by mutation of the gamma D-crystallin gene
PNAS, February 2, 1999; 96(3): 1008 - 1012.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. V. S. Kumar and Ch. M. Rao
Domain Swapping in Human alpha A and alpha B Crystallins Affects Oligomerization and Enhances Chaperone-like Activity
J. Biol. Chem., July 14, 2000; 275(29): 22009 - 22013.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (228)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Litt, M.
Right arrow Articles by Weleber, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Litt, M.
Right arrow Articles by Weleber, R. G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?