Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (73)
Right arrowRequest Permissions
Citing Articles
Right arrowScopus Links
Google Scholar
Right arrow Articles by Mahadevaiah, S. K.
Right arrow Articles by Burgoyne, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mahadevaiah, S. K.
Right arrow Articles by Burgoyne, P. S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 715-727


Mouse homologues of the human AZF candidate gene RBM are expressed in spermatogonia and spermatids, and map to a Y chromosome deletion interval associated with a high incidence of sperm abnormalities
Introduction
Results
   Mouse Rbm is a component of the Sx1 repeat
   Variation between genomic copies and their organization
   Mouse Rbm cDNAs
   Expression analysis
   The consequences of a deletion removing the majority of Rbm copies
   Sex reversal
   Rbm expression and spermatogenesis in Yd1 males
Discussion
Materials And Methods
   Mice
   Sperm analysis
   Testis cell purification
   Rbm genomic and cDNA clones
   Sequencing
   Probes and primers
   Southern analysis
   Transcriptional analysis
   RBM immunostaining
Acknowledgements
References


Mouse homologues of the human AZF candidate gene RBM are expressed in spermatogonia and spermatids, and map to a Y chromosome deletion interval associated with a high incidence of sperm abnormalities

Mouse homologues of the human AZF candidate gene RBM are expressed in spermatogonia and spermatids, and map to a Y chromosome deletion interval associated with a high incidence of sperm abnormalities Shantha K. Mahadevaiah1, Teresa Odorisio1,+, David J. Elliott2, Áine Rattigan1, Maria Szot1, Steven H. Laval5, Linda L. Washburn3, John R. McCarrey4, Bruce M. Cattanach5, Robin Lovell-Badge1 and Paul S. Burgoyne1,*

1Laboratory of Developmental Genetics, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK, 2MRC Human Genetics Unit, Western General Hospital, Crewe Road, Edinburgh EH4 2XU, UK, 3The Jackson Laboratory, Bar Harbor, ME 04609, USA, 4Department of Genetics, Southwest Foundation for Biomedical Research, PO Box 28147, San Antonio, TX 78228, USA and 5MRC Mammalian Genetics Unit, Harwell, Didcot, Oxon OX11 0RD, UK

Received December 2, 1997; Revised and Accepted January 26, 1998

DDBJ/EMBL/GenBank accession no. Y15131

An RNA-binding motif (RBM) gene family has been identified on the human Y chromosome that maps to the same deletion interval as the `azoospermia factor' (AZF). We have identified the homologous gene family (Rbm) on the mouse Y with a view to investigating the proposal that this gene family plays a role in spermatogenesis. At least 25 and probably >50 copies of Rbm are present on the mouse Y chromosome short arm located between Sry and the centromere. As in the human, a role in spermatogenesis is indicated by a germ cell-specific pattern of expression in the testis, but there are distinct differences in the pattern of expression between the two species. Mice carrying the deletion Yd1, that maps to the proximal Y short arm, are female due to a position effect resulting in non-expression of Sry; sex-reversing such mice with an Sry transgene produces males with a high incidence of abnormal sperm, making this the third deletion interval on the mouse Y that affects some aspect of spermatogenesis. Most of the copies of Rbm map to this deletion interval, and the Yd1 males have markedly reduced Rbm expression, suggesting that RBM deficiency may be responsible for, or contribute to, the abnormal sperm development. In man, deletion of the functional copies of RBM is associated with meiotic arrest rather than sperm anomalies; however, the different effects of deletion are consistent with the differences in expression between the two species.

INTRODUCTION

The mammalian Y chromosome, although once widely assumed to be devoid of genes other than the testis determinant, now has a steadily increasing list of genes to its credit. In man, several of these genes have closely related X homologues which are not X-inactivated (1,2) and may simply function to equalize the expressed dose in males and females. However, Y chromosome deletion mapping has assigned essential spermatogenic functions to specific regions of the human and mouse Y chromosomes (3,4); with respect to the human Y, deletions covering the region Yq11 are associated with spermatogenic failure, thus defining a Y-linked azoospermia factor (AZF). More detailed mapping of this region using molecular markers identified a series of microdeletions in infertile men with cytologically normal Y chromosomes (5-8), and this led to the mapping of members of two RNA-binding motif gene families to the AZF deletion interval. The first to be identified and proposed as a candidate for AZF was the RBM (formerly YRRM) family; RBM is expressed in the testis, and deletions removing some of the gene copies are associated with male sterility (9-15). The second AZF candidate gene, DAZ,is alsotranscribed in the testis and encodes a protein with an RNA-binding motif (8). Initially thought to be single copy, it is now clear that DAZ is also represented by more than one related copy on the Y chromosome (14,16).

On `zooblots', RBM-related genes appear to be present on the Y chromosome of most mammals, including the marsupial Y (9,17). In the mouse, hybridization to an ~6 kb EcoRI fragment was taken to indicate the presence of a single copy gene (9), raising the possibility of targeted mutagenesis of the mouse locus. However, we now know that the mouse Rbm locus is also present in multiple copies, all of which map to the mouse Y short arm between Sry and the centromere (18,19). Here we provide further details of the genomic organization of the locus, cDNA sequence information and detailed expression data, and we describe the consequences of a deletion removing most copies of Rbm. The results provide strong support for the view that the Rbm/RBM gene family plays a role in the spermatogenic process

RESULTS

Mouse Rbm is a component of the Sx1 repeat

Three mouse Rbm-positive [lambda] genomic clones were identified by screening a mouse genomic library with the human RBM cDNA MK5. All three clones contained an ~6.5 kb MK5-positive EcoRI fragment, while two also contained an ~3 kb MK5-positive EcoRI fragment (Fig. 1A). The 6.5 kb fragment, when used to probe a `mouse Y mapping blot' of various EcoRI-digested mouse genomic DNAs (see Fig. 1B for summary of deletion variants), hybridized in a Y-specific fashion to the ~6 kb band (=6.5 kb) originally identified with the human RBM cDNA probe (Fig. 1C). However, hybridization intensity varied markedly between genotypes in a manner reminiscent of the hybridization with the probe pSx1 to a multiple copy 2.6 kb EcoRI fragment (20), raising the possibility that Rbm sequences were part of the same repeating unit. This 2.6 kb fragment has been mapped to the proximal short arm of the mouse Y (21). The filter was therefore reprobed with pSx1 and the variation in hybridization to the 2.6 kb EcoRI fragment was almost indistinguishable from that obtained with Rbm (Fig. 1C). Probing digests of the [lambda] clones revealed that they contain a pSx1-hybridizing fragment. In [lambda]7 it is an incomplete 1.3 kb SalI-EcoRI fragment, but in [lambda]8 and [lambda]11 the complete 2.6 kb EcoRI fragment is present (Fig. 1A). Recently, Navin et al. (22) estimated that there are at least 50 copies of the 2.6 kb Sx1 repeat unit in normal male mice, so it is likely that Rbm is similarly repeated (see below).

Figure 1. Mouse Rbm is part of the previously identified Sx1 repeat. (A) SalI-EcoRI restriction map of three genomic clones showing the 3 2 and 6.5 kb 4 EcoRI fragments that hybridized to human RBM cDNA MK5. An Sx1-positive fragment 7 is also present in all three clones. Probe LSM15 is an MboI subclone derived from fragment 1; this fragment is flanked on one side by an EcoRI site (E*) that is absent from many genomic copies. Consequently, LSM15 detects a 1.2 kb (= 1) and a 4.2 kb (= 1 + 2) fragment on Southern blots of EcoRI-digested DNA (see Fig. 2A). (B) Diagram summarizing the `Y deletion' variants providing DNA for the Southern blot in (C) (for references, see Materials and Methods). Ytdym1 has a 14 kb deletion that has removed the testis derminant Sry. Yd1 is known to involve deletion of a repeat, located between Sry and the centromere, detected by the probe pSx1. The present results suggest that the deletion is at least 3-4 Mb. Sxra is Y short arm-derived fragment located distal to the pseudoautosomal region (PAR) of the X or Y. For example, in XSxraO males, there is a single sex chromosome comprising the X with an attached copy of Sxra. Sxrb is a deletion variant of Sxra that has a >900 kb deletion. The deletion breakpoints lie within Zfy2 and Zfy1, creating a transcribed Zfy2-Zfy1 fusion gene. (C) Southern blot containing EcoRI-digested DNAs of various Y variant genotypes (B) together with the control YRIII (from which Sxra and Sxrb are derived), probed with the 6.5 kb EcoRI fragment 4 and probe pSx1. The pSx1 probe detects a single copy 1.8 kb fragment that is deleted in Sxrb, and a 2.6 kb fragment that is present in ~50 copies on the normal Y (ref. 22); the 2.6 kb fragment is markedly reduced in copy number in Sxra, Sxrb and Yd1 (ref. 20). The variation in signal intensity is very similar to that for Rbm. Details of the genotypes are given in Materials and Methods.

Variation between genomic copies and their organization

We have also used the 3 kb MK5-positive fragment to probe the `mouse Y mapping blot'. This gave a more complex pattern, hybridizing to an ~1.4 kb fragment in males and females, and to Y-specific ~1.9, ~3 and ~4.2 kb fragments which showed dosage differences between the genotypes (not shown). We subsequently found that these Y-specific fragments are also detected by an Rbm cDNA (see next section, Fig. 3A), suggesting that the 4.2, 3 and 1.9 kb fragments are restriction fragment length variants (RFLVs) represented among the >50 copies of Rbm.The 4.2 kb (but not the 3 kb) fragment hybridizes to a probe, LSM15 (18), that derives from the 1.2 kb EcoRI fragment adjacent to the 3 kb fragment in [lambda]7; this RFLV is therefore explained by the loss of the intervening EcoRI site (E* in Fig. 1A).

Since probe LSM15 detects the 1.2 kb fragment adjacent to the 3 kb fragment and also the 4.2 kb fragment, we used it to investigate the number of Rbm copies and RFLV type further in mouse Y deletion variants (see Materials and Methods). Figure 2A shows a Southern blot of Sxra DNA and a series of Yd DNAs, together with appropriate controls, probed first with LSM15 and subsequently with an Rbm cDNA and pSx1. The Yd series of deletions were generated by unequal crossing-over in XSxra/Y males between the Rbm/Sx1 repeat on the Y and the copies present in Sxra (18; see also Fig. 2B). In generating Yd5 and Yd6, a genetically distinct AKR Y (Mus musculus domesticus in origin) was used to enable the origin (Y or Sxra) of Y short arm markers to be tracked. Two important conclusions can be drawn from the LSM15 blot. First, all the deletion variants have retained more than one copy of the Rbm/Sx1 repeat, including at least one of each of the two RFLVs. The second conclusion relates to the ordering of the RFLVs. The fragments detected by LSM15 on the YAKR chromosome differ in size from those on YRIII (from which Sxra originated), enabling the origin of the copies remaining in Yd5 and Yd6 to be determined. Both in fact have one or more copies of the 4.2 kb fragment derived from Sxra and one or more copies of a 1.3 kb fragment derived from YAKR. Yd5 has, in addition, a YAKR-derived ~7 kb fragment. This allows us to conclude that the most distal copies in Sxra have the EcoRI- RFLV. It follows from this that Yd1 must have obtained the EcoRI+ RFLV copies from the Y, and these must be the most proximal copies. In Figure 2B, it is assumed that the distal location of the copies with the EcoRI- RFLV seen in Sxra is a feature of musculus-type Y chromosomes, and hence that the copies with the larger EcoRI fragments must be internal to the other copies.

Figure 2. Rbm copy number and the origin of the Yd series of deletions. (A) A Southern blot of EcoRI-digested DNAs hybridized with probe LSM15, Rbm cDNA 2 (only the 6.5 kb hybridizing band is shown) and pSx1. LSM15 detects two major bands of 1.2 and 4.2 kb in control YRIII (M.musculus Y) DNA due to a +/- EcoRI site polymorphism (see Fig. 1A), together with some larger fragments. In YAKR (M.domesticus Y), LSM15 detects a band of 1.3 kb and a doublet of ~7 kb. In Yd1 and Yd3, which are recombinants between an M.musculus Y and Sxra, the 1.2 and 4.2 kb bands are present, both of which are more intense in Yd3. In Yd5 and Yd6, which are recombinants between YAKR and Sxra, the Sxra-derived 4.2 kb and the YAKR 1.3 kb bands are present, the 1.3 kb band being more intense in Yd5. In Yd5, a copy of the upper band of the ~7 kb YAKR doublet is also present. (B) Diagrammatic representation of the recombination event that is thought to have generated Yd1, showing the deduced organization of the EcoRI+ and - copies. The axis of the resulting Yd1 chromosome is shown in bold. The Rbm copies are labelled + or - to denote the EcoRI site polymorphism, or > for the copies containing the >4.2 kb LSM15-positive fragments. (C) Estimated Rbm and Sx1 copy number for YRIII, Sxra, Yd1 and Yd3. The relative copy number was first estimated by PhosphorImager analysis of band intensities corrected for loading using the single copy 1.8 kb band. Copy number was then calculated based on (i) the conclusion from the LSM15 blot that at least two copies are present in Yd1, or (ii) that a minimum of 50 copies of the Sx1 repeat are present on the M.musculus Y (ref. 22).

Figure 3. Analysis of Rbm cDNAs. (A) The Southern blot from Figure 1B reprobed with Rbm cDNA 2. The 6.5, 3.0 and 0.8 kb bands are fragments 4, 2 and  in Figure 1A. The 4.2 and 1.9 kb bands are also detected when fragment 2 is used as a probe, and represent RFLVs between genomic copies. (B) Comparison of the amino acid sequence predicted from the RIII strain (mus) Rbm cDNA 8 [CD1 (dom) sequence differences are indicated above] with that of the human RBM cDNA MK5. The repeated 37 amino acid `SRGY box' present in the human protein (ref. 9) has been split into two subrepeats, a and b, that are aligned to show that the mouse has a single copy of the b subrepeat. Also shown is the homologous segment of hnRNPG, that has a b-a-b subrepeat structure. The RNP motifs of the RNA-binding domain are shaded. The SRGY motifs are in bold.

The results of Phosphorimager analysis are given in Figure 2C. Using the minimum estimate of two copies of the Rbm/Sx1 repeat in Yd1, we estimated that there are 25 copies on YRIII. However, if Navin et al.'s estimate of at least 50 copies is true for YRIII, then Yd1 has at least four copies. One feature of the quantitation apparent on three independent blots is that Sxra has fewer copies of Sx1 relative to Rbm than the other genotypes; this suggests that the original event that generated Sxra was associated with the loss of more copies of Sx1 than of Rbm.

Mouse Rbm cDNAs

Sixteen independent Rbm cDNA clones were obtained by screening a pre-pubertal testis cDNA library with a 159 bp PCR product (see Materials and Methods) amplified from testis cDNA; from sequence comparison with the human cDNA MK5, this PCR product was known to derive from the RNA-binding domain. Automated sequencing of the 5' and 3' ends established that 14 of the cDNAs had both ends of the open reading frame (ORF) predicted from MK5. All 14 of these cDNAs produced a protein of the expected size when translated in vitro, indicating that they all had an intact ORF (not shown). One of the cDNAs, when hybridized to the `Y mapping blot' (Fig. 3A), detected EcoRI fragments of 6.5, 4.2, 3, 1.9 and 0.8 kb. The 6.5, 3 and 0.8 kb fragments are present in EcoRI digests of [lambda]7 (Fig. 1A). The 4.2 and 1.9 kb fragments are not present in [lambda]7 (or in our other two [lambda] clones), but were detected on Southern blots probed with the 3 kb EcoRI fragment from this clone, and must represent RFLVs (see above).

The longest cDNA (#8) was fully sequenced (EMBL Y15131 MMRBM) and the sequence within the ORF was found to be 99% identical to another recently reported mouse Rbm cDNA (GenBank MMU36929); the differences could reflect the fact that cDNA 8 originates from a M.musculus (RIII strain) Y chromosome whereas the cDNA of Elliot et al. (19) is of M.domesticus Y chromosomal origin (CD-1 strain). A C in place of a T at position 244 in the CD-1 sequence introduces a PstI site. By utilizing PCR primers to amplify across this site in testis cDNA from RIII (musculus) and AKR (domesticus), and then digesting with PstI, we have shown that this site is absent from RIII transcripts but is present in most, if not all, AKR transcripts. Thus, at least for this site, it appears that we are dealing with a strain difference (probably a musculus/domesticus difference), rather than a difference arising from sampling different copies of this multiple copy gene. Despite the close similarity within the ORF, the two cDNAs differed to some extent in both the 3'- and 5'-untranslated regions. The major difference in the 5' end was the presence of a 151 bp insert in cDNA 8 as compared with the CD-1cDNA. The predicted proteins encoded by the two mouse cDNAs are compared with that of the human in Figure 3B. Comparison of the mouse and human proteins is discussed in detail by Elliot et al. (19). The RNA-binding domain is highly conserved, but there is less homology outside this region. In the figure, we have drawn attention to the fact that the 37 amino acid `SRGY box' repeat of the human RBM protein divides into two subrepeats (a and b) each ending in SRGY or variants thereof. Mouse RBM has only one copy of SRGY due to the presence of one copy of the b subrepeat; in human hnRNPG, which is the hnRNPG most closely related to RBM, this region is represented by a `b-a-b' subrepeat structure-a feature that was overlooked by Elliot et al. (19). The RIII strain RBM sequence differs from the published CD-1 strain sequenceby seven amino acids.

In an attempt to obtain evidence for transcription from more than one genomic copy of Rbm, manual sequence data were obtained towards the 3' end (bp 1266-1510 or 1477-1655) of the 13 unsequenced clones and all were found to be identical to cDNA 8, and different from the published CD-1 sequence. Sequencing from the 5' end of four of these cDNAs revealed a number of differences. First, they all lack the same 151 bp that are missing from the CD-1 cDNA. By using a primer specific to this 151 bp region, we have checked all the remaining cDNAs and they failed to amplify with this primer. Nevertheless, cDNA from normal males did amplify, indicating that cDNA 8 is not a cloning artefact. By using forward and reverse primers within this 151 bp stretch to obtain flanking genomic sequence from [lambda] clone 7, we found that this 151 bp sequence is flanked by consensus splice sites. Two of the other cDNAs (10 and 17) included some sequence close to the 5' end that is not present in cDNA 8.

Expression analysis

The adult tissue distribution of Rbm transcripts was assayed initially by RT-PCR . This only detected appreciable transcription in testis; no transcripts were detected in adult XXSxrb testes which lack germ cells, raising the possibility that Rbm expression is restricted to spermatogenic cells (Fig. 4A). An analysis of purified testis cell populations is shown in Figure 4B. Rbm transcripts are abundant in spermatogonia, and, in common with other mouse X and Y genes analysed, are markedly reduced or absent in pachytene spermatocytes where the X and Y are condensed to form the heterochromatic sex body (`sex vesicle'). However, transcript levels return to high levels in round spermatids, showing that transcription is resumed. The changes in Rbm transcript levels for the whole testis from birth to adult (Fig. 4C and D) reflect this pattern of expression in the germ line. From birth to 14.5 days, there is a steady increase in transcript levels as spermatogonia proliferate, then a marked drop occurs as large numbers of non-transcribing pachytene spermatocytes appear, but by 21.5 days the appearance of transcribing round spermatids stems the fall. This is very similar to the pattern of transcription for Ube1y (23).


Figure 4. Analysis of Rbm transcription. (A) RT-PCR showing levels of Rbm in various adult tissues compared with the ubiquitously expressed Hprt. Of the tissues analysed, appreciable levels of Rbm transcripts are restricted to the testis and are absent from adult XXSxrb testes, that lack germ cells. (B) Northern blot analysis of Rbm transcript levels in purified testicular cells, with actin providing a loading control and the spermatid-specific YMT2/B monitoring the level of contamination of the pachytene spermatocyte fraction with spermatids. After allowing for the spermatid contamination, there are few if any Rbm transcripts in pachytene spermatocytes from the adult testis, but there are substantial levels in round spermatids (some contamination with elongating spermatids). Purified A spermatogonia from 1-week-old testes also have high levels of Rbm, while Sertoli cells have few if any transcripts. (C) Northern analysis of Rbm transcript levels from birth to adult on a whole testis basis. Once again, no transcripts are detectable in adult XXSxrb which lack germ cells. (D) Changes in level of Rbm transcripts from birth to adult compared with those for Ube1y which were assessed using the same filter. Adjustments for loading were made by comparison with actin. (E) RT-PCR analysis of Rbm transcription in the developing fetal testis, compared with the ubiquitously expressed Hprt. In the left panel, Rbm transcripts are observed throughout the development of the fetal testis (note that in the first lane the level is underestimated because the whole urogenital complex has been assayed). In the right panel, it can be seen that Rbm transcripts are markedly reduced in We homozygotes which are severely depleted in germ cells (but still detectable in the Southern blot below).

Because Rbm transcripts are already present on the day of birth, we looked for transcripts in the fetal testis. Transcripts are detectable by RT-PCR from the earliest age (11.5 dpc) analysed (Fig. 4E). Fetal homozygous We testes, which are severely depleted of germ cells, have markedly reduced levels of Rbm transcripts, suggesting that transcription in the fetal testis may also be germ cell dependent.

The consequences of a deletion removing the majority of Rbm copies

Three genotypes with markedly reduced copies of Rbm were seen in the `mapping blot' (Fig. 1C), which potentially could have phenotypic effects attributable to decreased Rbm function. The Yd1 deletion is potentially the most informative, because deletion of multiple copies of the Rbm/Sx1 repeat unit has occurred, while leaving the remainder of the Y chromosome intact (18,20).

Sex reversal

The most dramatic phenotypic effect associated with the Yd1 deletion is sex reversal, which is a consequence of a near absence of Sry transcripts in the developing gonads (18,20). It has been argued that Sry transcription has been inhibited by a `position effect', the deletion having brought Sry into a region of transcriptional repression (perhaps associated with proximity to the centromere). However, the fact that the Rbm gene family is actively transcribed from this region in normal males, together with the observation that Yd1-derived Sry transcripts are abundant in adult XYYd1 testes (18), led us to question this explanation-might the paucity of Sry transcripts in embryonic XYd1 gonads be a consequence of reduced Rbm activity? RBM protein might, for example, be needed to stabilize the Sry transcript. To test this possibility, we producedXYd1Ytdym1miceto determine whether the intact Rbm region on the Sry-negative Ytdym1 chromosome [that carries a 14 kb deletion that has removed Sry (24)] would restore the testis-determining activity of the copy of Sry on the Yd1 chromosome. Eight mice of this genotype were produced, and all developed as females. We conclude that the presence in trans of a full complement of Rbm genes (and of anything else encompassed by the Yd1 deletion) does not correct the sex reversal. This strengthens the view that the sex reversal is a consequence of a position effect that interferes with Sry transcription in the fetal gonad.

Rbm expression and spermatogenesis in Yd1 males

The starting point for thisproject was the suggestion that the human RBM gene family has a role in spermatogenesis. In view of the marked reduction in Rbm copy number associated with the Yd1 deletion, it was important to establish whether this causes any spermatogenic impairment. Since XYd1 mice are female, we introduced a fully penetrant Sry transgene to generate males with the Yd1 deletion.

We have assessed transcript levels in adult testes and 14.5 dpp testes (when expression is maximal) of these mice by northern analysis. At both ages, Rbm transcripts were barely detectable (Fig. 5). By using PCR primers specific for the two splice variants identified among cDNA clones, we found that both types of transcripts are produced by these Yd1 males, and sequencing of cloned RT-PCR products established that transcripts with an intact ORF are produced.


Figure 5. Rbm transcription in XYd1Sry males. Northern analysis of Rbm transcripts in (left panel) adult testes and (right panel) 14.5 dpp testes. Testis RNA from adult XXSxrb (no germ cells) and XOSry mice (no Rbm) are negative controls. XSxraO mice have reduced Rbm copy number (but more copies than XYd1Sry mice) and have few if any spermatids in the adult (note lack of spermatid-specific YMT2/B transcripts); at 14.5 dpp, XSxraO mice have the same germ cell complement as control mice. XSxrbO mice have the same Rbm copy number as XSxraO mice, but have an early spermatogenic failure such that only a few spermatogonia remain in the adult.

The question arises as to whether the reduction in Rbm transcripts in XYd1Sry males is due to the same position effect that inhibits Sry transcription in the fetal testis, or whether it is due to the reduction in Rbm gene copies. The northern blots in Figure 5 include RNA from XY, XYd1Sry and XSxraO males. Although adult XSxraO males have a meiotic block and consequently almost totally lack spermiogenic stages, at 14.5 dpp when control levels are maximal, XSxraO males have the same spermatogenic cell complement as normal males (25). Since in XSxraO males the Y-derived Sxra fragment is attached distal to the pseudoautosomal region of the X chromosome, and Sry is transcribed and functions normally, there is no reason to expect inhibition of the Rbm copies due to a position effect. Nevertheless, as seen in Figure 5, there is a marked reduction in transcript levels compared with controls in both XSxraO and XYd1Sry males. We therefore favour the view that Rbm is transcribed from multiple copies, and that the reduced transcript levels in XSxraO and XYd1Sry males is, at least in part, due to the reduced gene copy number. Nevertheless, the reduction in XYd1Sry males as compared with XSxraO males is greater (by PhophorImager analysis) than that predicted from the relative copy number, suggesting that the position effect that inhibits Sry transcription also plays a part in reducing Rbm transcription.

Recently, we generated a mouse RBM-specific antibody that reacts with spermatogonia, early spermatocytes and elongating spermatids in control testis sections; this staining is abolished by pre-absorbtion with the immunizing peptide (Fig. 6). In Yd1 males, there is no detectable RBM protein in spermatogonia, but quite strong staining of some elongating spermatid stages is retained; nevertheless, the level of elongating spermatid staining is markedly reduced and more restricted as to stage when compared with controls (Fig. 6).


Figure 6. Immunocytochemical analysis of RBM protein in control and XYd1Sry testes. First row: stage XI, I and VII tubules from a control male showing the intense nuclear RBM staining in spermatogonia (stained nuclei in basal layer) and elongating spermatids (XI and I, inner layer). The elongating spermatid staining is absent at stage VII (step 16 spermatids). Second row: stage XI tubule from control male stained with antibody pre-absorbed (PA) with the immunizing peptide, in which only background cytoplasmic staining is seen, and stage X tubules at higher power showing clear RBM staining (cf. pre-absorbed, PA) of zygotene spermatocyte (z) and elongating spermatid (es) nuclei, and weak (not consistently above background) staining of pachytene spermatocyte nuclei (p). Third row: stage XI, I and VII tubules from XYd1Sry testes showing weakened RBM staining of elongating spermatids and lack of spermatogonial staining. Bottom panel: the changing pattern of RBM staining in spermatid nuclei from testes of (top row) a normal male showing the absence of clear staining in step 4 round spermatids (cf. PA control below), the appearance of staining at step 9, the gradual localization of staining to the post-acrosomal region and the eventual loss of staining by step 16, and (bottom row) the much weaker staining and earlier loss in an XYd1Sry male (note also the abnormal shape to the back of the head already evident at step 12).

Despite the marked reduction in Rbm expression, Yd1 males were fertile, although testis weights and sperm counts were perhaps somewhat lower than expected for outbred mice. To ascertain whether this represents spermatogenic impairment due to the Yd1 deletion, or whether it is associated with the genetic background or some inadequacy of the Sry transgene, we sex-reversed XYtdym1 females, which are deleted for Sry (26-28)by introducing the same Sry transgene, and then by mating these XYtdym1Sry males to XYd1 females we produced XYtdym1Sry and XYd1Sry sibs for comparison. As can be seen from Table 1, there is no evidence of reduced sperm production in XYd1Sry males as compared with XYtdym1Sry males.

Finally, we assessed sperm quality in these two genotypes. This revealed that the Yd1 deletion is associated with a marked increase in abnormal sperm development; 32% of sperm entering the epididymis having grossly distorted heads, and a further 14% have more subtle anomalies (Fig. 7A and B). We have found that in normal males and in males with increased levels of abnormal sperm associated with Yq deletions, there is strong selection against abnormal forms during passage through the caput epididymis (M.S., S.K.M. and P.S.B., unpublished). This selection is also seen in XYtdym1Sry males but, for some reason, there is very little selection against the abnormal sperm in XYd1Sry males (Fig. 7C).

Figure 7. Sperm abnormalities in XYd1 males. (A) Sperm from the initial segment of the caput epididymis of an XYd1Sry male with (inset) sperm from a control XYtdym1Sry male. The abnormal sperm are classified as to category (1a, etc., see B). (B) The numbers of abnormal sperm by category in a sample of 600 sperm from the initial segment of the caput of three XYd1Sry and three XYtdym1Sry males. The `other' category consists predominantly of degenerating sperm (these are almost completely absent lower down the tract). (C) A comparison of the degree of selection against abnormal sperm during passage down the male tract of the XYd1Sry and XYtdym1Sry males (C1, initial segment of the caput epididymis; C2, remainder of the caput epididymis; Cd, cauda epididymis; V, vas deferens). The frequency in caput 1 was equated to 1, and the frequencies lower down the tract were expressed relative to caput 1. In controls, there is a highly significant selection against abnormal forms between caput 1 and caput 2, while in XYd1Sry males there is a non-significant increase in slightly abnormal sperm between caput 1 and caput 2, and slight selection against grossly abnormal forms (heterogeneity [chi]2s on original numbers: control slightly abnormal, [chi]2 = 24.8, P < 0.0005; control grossly abnormal, [chi]2 = 14.0, P < 0.0005; XYd1Sry slightly abnormal, [chi]2 = 1.4, P NS; XYd1Sry grossly abnormal, [chi]2 = 3.9, P = 0.05-0.025).

In this study, we have shown that the previously identified deletion, Yd1, that is associated with male to female sex reversal due to position effect inibition of Sry transcription (18, and present study), is also associated with a markedly increased incidence of abnormal sperm development when present in XYd1 Sry transgenic males. We have ruled out the possibility that the sperm abnormality is due to some inadequacy of the Sry transgene, so this mouse Y deletion interval now becomes the third to be associated with a spermatogenic defect (29).

Table 1. A comparison of testis weights, sperm counts and the frequency of X-Y separation at the first meiotic metaphase in XYd1Sry males and XYtdym1Sry controls produced in the same cross
Male Age
 
(days)
Mean testis
 
weight
Sperm/caput 1
 
(×10-3)
X-Y
separation
(%, n = 50)
XYd1Sry 1 73 107.8 2457 12
2 77 100.2 2830 8
3 66 98.5 3143 8
4 78 107.5 2647 16
Mean ± SEM 73 ± 3 103.5 ± 2.4 2769 ± 146 11.0 ± 1.9
XYtdym1Sry 1 72 113.5 2287 12
2 72 121.5 2873 6
3 70 97.5 2490 18
4 73 109.5 2757 12
5 65 94.4 2763 20
6 77 110.4 3243 16
7 68 93.9 2507 18
8 68 15.2 3137 16
9 66 102.8 3673 14
10 78 109.8 2860 14
Mean ± SEM 71 ± 1 106.8 ± 3.0 2859 ± 129 14.6 ± 1.3

DISCUSSION

The Yd1 deletion, originally described by Capel et al. (20), is one of a series of deletions that are the result of unequal recombination events between the Y short arm and the short arm-derived factor Sxra; these events occur within a region of repeated DNA that includes the 2.6 kb Sx1 repeat (18). It has been estimated by pulsed-field analysis that the repeating unit containing the 2.6 kb Sx1 repeat is ~70 kb (Dr Michael Mitchell, personal communication); if there are at least 50 copies on the normal Y (22) and only ~4 remain in Yd1 (present data), this would make the Yd1 deletion at least 3-4 Mb. We now show that Rbm, the mouse homologue of the human AZF candidate gene RBM, is part of the same repeating unit, making this gene a candidate for providing the spermatogenic function defined by the Yd1 deletion.

How strong is the case supporting Rbm's candidature? Aside from the map position, the case is supported by evolutionary arguments and by the expression analysis. The fact that the Rbm gene family is represented on the Y of mammals from man (9) to marsupial (17) is proof enough that Rbm has a function that engendered sufficient selective pressure for it to be retained on the Y in the face of the attrition that besets genes on this chromosome (2,30). If, as it appears, Rbm expression is restricted to the male germ line, then we must conclude that this function is related to spermatogenesis; this need not be a mandatory function, since any improvement in the efficiency of spermatogenesis would be strongly selected for (29,31). Thus, there are strong a priori reasons for expecting loss of Rbm expression to be associated with some disturbance of the spermatogenic process.

Our transcription analysis, in agreement with that of Elliot et al. (19), shows that Rbm is transcribed almost exclusively in the testis and that this testicular transcription is germ cell dependent. The pattern of transcription is, in fact, very similar to that of Ube1y. For both, transcripts are present throughout the development of the fetal testis; post-natally there are high levels in spermatogonia, they all but disappear in pachytene spermatocytes when the X and Y are in a transcriptionally repressed state and they reappear in round spermatids. In our view, these features of Rbm (and Ube1y) expression constitute compelling evidence for a role in the spermatogenic process.

In some respects, it is the mildness and stage of the defects in Yd1 males that are surprising. Rbm is expressed throughout testis development, and some of the strongest expression revealed by the antibody staining is in spermatogonial stages; yet there is no evidence of reduced sperm output in the Yd1 males and they are fertile despite the high incidence of abnormal sperm. The lack of an effect of a nearly complete absence of RBM in spermatogonia may mean that there is redundancy for hnRNP function in the earlier spermatogenic stages. This is supported by the study of Kamma et al. (32), who found that hnRNPs A1, C, D, F/H, K/J, L and U are all expressed in mouse spermatogonia, all but A1 in spermatocytes, but none is expressed in spermatids. The reactivation of Rbm expression in spermatids may therefore be of particular significance. Indeed, the fertility of Yd1 males may be wholly dependent on the appreciable levels of RBM protein that are retained in the elongating spermatid stages of these mice.

The retention of Rbm expression in spermatids of Yd1 males despite the near extinction of expression in spermatogonia is reminiscent of the situation with Sry which is not transcribed in the embryonic gonad but is transcribed from the Yd1 chromosome in adult XYYd1 testes (18). This latter transcription is almost certainly in spermatids since this is the predominant source of Sry transcripts in the adult testis (33,34). It may be that in both cases this represents an escape from position effect inhibition as a consequence of the chromatin restructuring that occurs during spermatid stages as histones are replaced with protamines. If a position effect is operating to inhibit transcription of Sry and the remaining copies of Rbm on the Yd1 chromosome, it follows that the amplification of Rbm/Sx1 on the normal Y is serving as a `buffer' to allow Sry and the more distal copies of Rbm to be transcribed.

What is the phenotype associated with RBM deletions in man? Assessing this has been complicated by the presence of some RBM copies outside the AZF deletion interval and by the fact that many of the deletions studied also removed copies of the other AZF candidate DAZ. Recently, evidence has been presented that the only functional copies of RBM are restricted to the AZFb deletion interval (35,36); deletion of this interval is associated with azoospermia due to spermatocyte arrest (14). In agreement with this, two patients studied by Elliot et al. (36) that had these functional RBM copies deleted but were DAZ positive were azoospermic with spermatocyte arrest at the pachytene stage. As in Yd1 mice, the lack of RBM in spermatogonia seems to have no obvious effect on spermatogonial function. However, an arrest at pachytene does not tally with our finding of sperm abnormalities but normal sperm counts in Yd1 males; even without the residual RBM expression seen in elongating spermatids in Yd1 mice, there would seem to be no reason to expect arrest earlier than the round spermatid stage.

Why are the effects of RBM/Rbm deletion different in the two species? A likely answer is provided by the differences in expression pattern apparent from the antibody staining in the two species. In both species, the protein is located predominantly in the nucleus. In man, RBM protein is detected at high levels in spermatogonia, continues to be expressed throughout the primary spermatocyte stages, is clearly detected in round spermatids, but has disappeared by the elongating spermatid stages (36). By contrast, in the mouse, we have seen that after the strong expression in spermatogonia, RBM expression is extinguished rapidly in spermatocyte stages and does not reappear until elongating spermatid stages. The difference in expression in primary spermatocytes has been corroborated at the level of transcription-in man, RNA in situ hybridization revealed high levels of transcripts in pachytene spermatocytes (37), while in the mouse few if any Rbm transcripts are present in purified pachytene cells. Thus it is possible that in man RBM provides an essential function during pachytene that is provided by a different hnRNP in the mouse, and that the converse is true for elongating spermatid stages.

It is becoming increasingly clear that there is a distinct lack of concordance with respect to the genes represented on the Y chromosomes of different mammalian species (29). The present results further suggest that even with a gene such as RBM/Rbm, that is present on the Y of a wide range of mammals, there may be substantial differences in function. This has implications for those who seek to use targeted mutagenesis of Y chromosomal genes in the mouse to provide pointers to the function of the human homologues, and highlights the need for detailed expression studies. Nevertheless, we would argue that the present results do provide further support for the view that many (perhaps all) of the genes on mammalian Y chromosomes that have a predominantly testicular expression pattern are likely to function in spermatogenesis (31), and the challenge for the future is to define these functions fully.

MATERIALS AND METHODS

Mice

The control YRIII, the YRIII short arm derivatives Sxra (38,39) and Sxrb (40), and the Ytdym1 deletion [a 14kb deletion in the short arm which removed Sry (26,27)] are maintained at NIMR on a random-bred MF1 (OLAC) background. The Yd series of deletions (18,20) were generated by B.M.C. at the MRC Radiobiology Unit. XYtdym1Yd1 mice were produced by mating XYtdym1YRIII-del males, that transmit almost exclusively X and Ytdym1 gametes (28), to XYd1 females which produce X, Yd1, XYd1 and `0' gametes (20). To produce males carrying Yd1, XYd1 females were mated to males carrying the X-linked marker Paf (41) and an Sry transgene derived from the transgenic line C57BL/6Ei-YAKR/JTgN(Sry-129)2Ei [produced at The Jackson Laboratory by injecting C57BL/6 YAKR pronuclear stage embryos with the 14 kb Sry-positive genomic clone previously used by Koopman et al. (42)]. The Paf marker was used to facilitate identification of males who carried the Yd1 chromosome since these were also hemizygous for Paf; the marker subsequently was removed by back-crossing the Yd1 males to MF1 females.XYtdym1 males were produced by introducing the same Sry transgene, once again using the Paf marker for identification. To produce XYd1Sry and XYtdym1Sry males in the same litters, XYtdym1Sry males were mated to XYd1 females.

Sperm analysis

Sperm counts were carried out as described previously (43) except that the sperm sample was derived only from the initial segment of the caput epididymis (up to the third blood vessel). For the analysis of sperm abnormality frequencies in different regions of the male tract, sperm were sampled from three XYd1 Sry males and three XYtdym1 Sry males of each genotype, samples being obtained in each case from the vas deferens, the three regions of the epididymis-`caput 1' (the initial segment), `caput 2' (the remainder of the caput) and the cauda. Sperm were suspended in phosphate-buffered saline and the suspension was smeared on slides and fixed in 3:1 methanol:acetic acid. Two slides were prepared from each region for each male. The slides were then dipped in 0.4% Photoflo for 2 min, air dried and stained with silver nitrate (44). Scoring was carried out `blind' as to genotype using the categories defined by Styrna et al. (45), but with the addition of an extra class (see 1b in Fig. 7B). It appeared from the data obtained that there was selection against abnormal forms during passage through the male tract. To assess the degree of selection, the ratios of abnormal to normal sperm were calculated for each region of the tract, the ratio for caput 1 was equated with 1 and the proportion of abnormal sperm remaining in subsequent regions of the tract was calculated relative to caput 1.

Testis cell purification

Testis cell purification was as previously described by Odorisio et al.(23). Briefly, pachytene spermatocytes (75-80% pure, contaminated predominantly with round and elongated spermatids) and round spermatids (80-85% pure, contaminated predominantly with elongating spermatids) were separated from adult testis cell suspensions by elutriation (46). Type A spermatogonia (85% pure) and Sertoli cells (90% pure) were isolated from 6 dpp testes using a small StaPut chamber (Johns Scientific) (47).

Rbm genomic and cDNA clones

Except where stated, routine molecular techniques throughout were as described by Sambrook et al. (48). Three Rbm-positive genomic clones were obtained by screening a 129/SvEv-GpiIc (49) male genomic library in [lambda] Fix II vector (Stratagene) (24) with the human RBM cDNA clone MK5 (9). Southern blotting analysis of EcoRI-digested DNA showed that all three clones contained a 6.5 kb MK5-positive EcoRI fragment, while two also contained a 3 kb MK5-positive EcoRI fragment. All the MK5-hybridizing material subsequently was localized to a 3.8 kb BglII fragment that was partially sequenced using a transposon insertion approach (50) to provide multiple entry points for sequencing. Comparison of the sequences obtained with the published sequence of MK5 identified two intron-exon boundaries and enabled the design of PCR primers (see `Probes and primers') that amplified the predicted 159 bp product from cDNA. This 159 bp product was cloned and sequenced.

Sixteen Rbm cDNA clones were obtained by screening a 17.5 dpp pre-pubertal testis cDNA library [MF1YRIII strain in which the Y originated from an Sxra stock (51)] in Uni-ZAPtm XR vector (Stratagene) with the 159 bp Rbm fragment. The library was prepared following the manufacturer's instructions using RNA extracted from testis tubules separated from interstitial tissue by treatment with collagenase (0.5 mg/ml) and hyaluronidase (0.5 mg/ml) in HEPES-buffered Dulbecco modified Eagle's medium for 20 min at 32°C, followed by a further 10 min incubation in hyaluronidase. This library is enriched in meiotic and pre-meiotic germ cell cDNAs. The cDNA clones were used to generate mRNAs that were then translated in vitro using nuclease-treated rabbit reticulocyte lysate (Promega) following the manufacturer's instructions.

Sequencing

Automated sequencing of `transposon' clones derived from the 3.8 kb BglII fragment and the 3' end of the cDNA clones was carried out using an ABI 373s sequencer with an ABI (Perkin Elmer) Prism Dye Terminator Cycle Sequencing Ready Reaction Kit. To obtain a full sequence for cDNA 8, unidirectional clones produced using the Erase-a-Base system (Promega) were sequenced manually from both strands with the Sequenasetm version 2.0 DNA sequencing kit (USB, Amersham Life Sciences).

Probes and primers

For Rbm, (i) a 6.5 kb EcoRI fragment from genomic clone [lambda]7; (ii) LSM15, the0.3 kb MboI fragment from [lambda]7 (18); (iii) 1.6 kb cDNA 2; and (iv) forward primer 5' CAAGAAGAGACCACCATCCT, reverse primer 5' CTCCCAGAAGAACTCACATT were used. The probe for actin was a mouse [alpha]-actin cDNA 1.15 kb Pst fragment which recognizes [alpha]- and [beta]-actin transcripts (52). pSx1 is a 1.8 kb EcoRI fragment mapping to the Sxrb deletion region of the mouse Y short arm (53), and pYMT2/B is a 1.3 kb Ssty cDNA clone(54). For Hprt primers, see Koopman et al. (55)

Southern analysis

Genomic DNA was isolated from tail biopsies (56). Twelve µg of each DNA was restricted with EcoRI, electrophoresed through a 0.8% agarose gel and transferred to a Hybond N+ membrane (Amersham). Membranes were hybridized with 32P-labelled probes (Prime It kit, Stratagene) and washed at high stringency (0.1* SSC, 0.1% SDS, at 65°C twice for 1 h). When hybridizing the 6.5 kb EcoRI fragment from genomic clone [lambda]7, it was necessary to compete with total mouse male and female genomic DNA to reduce hybridization to repetitive sequences. The filters were exposed to phosphor screens and scanned with a PhosphorImager (Molecular Dynamics) to allow subsequent imaging and quantitation with ImageQuant software (using `integrate volume' and individual track background). For sequential hybridizations, labelled probes were removed by washing the filters in 50% formamide in 10 mM NaH2PO4 (pH 6.8) at 60°C for 1 h.

Transcriptional analysis

Total RNA was isolated using the AGPC method (57) except for the 6 dpp spermatogonia and Sertoli samples, that were isolated using guanidinium isothiocyanate-caesium chloride (58). Poly(A)+ RNA used for some northern analyses was isolated with a QuickPrep Micro mRNA purification kit (Pharmacia Biotech).

For RT-PCR, 2 µg of total RNA from each tissue was reverse transcribed in a 60 µl reaction using standard procedures. A 2.5 µl aliquot was then added to a 25 µl PCR reaction containing 250 ng of Rbm primers (159 bp product) and 200 ng of Hprt primers (352 bp product). cDNA was amplified for 32 cycles of 20 s at 96°C, 45 s at 54°C and 50 s at 72°C, and with an 8 min extension at 72°C. Products were separated on a 3% agarose gel and stained with ethidium bromide.

For northern blot analysis 2-5 µg of poly(A)+ RNA or 10 µg of total RNA, together withRNA size markers, were electrophoresed in a 1.4% agarose gel containing 1.9 M formaldehyde.RNA was transferred to Hybond-N membrane (Amersham) using 20* SSC, and the membrane was hybridized overnight to 32P-labelled probes (Prime It kit, Stratagene) using 1-2*106 c.p.m. of each probe. Filters were washed at 60°C for 30 min in 0.5* SSC, 0.1% SDS, then 30 min in 0.2* SSC, 0.1% SDS and 40 min in 0.1* SSC, 0.1%SDS, and the filters were then exposed to phosphor screens to allow subsequent imaging and quantitation.

RBM immunostaining

Rbm cDNA in Bluescript was digested with BglII and XhoI and the released 1 kb Rbm fragment was subcloned into pET32a (Novagen) digested with BamHI and XhoI. The resulting plasmid (pM4) was transformed into Escherichia coli AD494 (Novagen), and a single polypeptide of 45 kDa was induced on addition of 1 mM isopropyl-[beta]-d-thiogalactopyranoside (IPTG). This polypeptide is a fusion between thioredoxin and RBM. The RBM sequence starts GSATSAQTRS (after the RNA-binding domain) and continues to the end of the protein. The first glycine is converted from an arginine in RBM as a result of the BglII-BamHI ligation. This polypeptide was purified as an inclusion body after cell lysis in 20 mM sodium phosphate/500 mM sodium chloride pH 7.8, and then solubilized in 0.1 M sodium bicarbonate/0.05% SDS pH 9.6. The soluble protein was injected into a rabbit as an emulsion with TitreMax adjuvant (CytRx Corporation, GA, USA). The rabbit was boosted after 7 weeks, and blood collected after a further 2 weeks. Antibodies directed against RBM were purified by affinity selection against the bacterially produced immunizing polypeptide immobilized on an Immobilon filter. Sections were prepared from testes fixed in Bouin picro formol solution and embedded in paraffin wax. Immunostaining was carried out as previously described (36) using a 1:10 dilution of purified antibody.

ACKNOWLEDGEMENTS

We thank all those colleagues who have provided help and encouragement throughout this study. Adam Hacker (advice in molecular techniques) and Treena Titley (countless tail biopsies) deserve special mention. P.S.B. thanks Ann Chandley for the probe MK5, Howard Cooke for sharing Rbm sequence information and Eva Eicher for comments on the manuscript. T.O. was the recipient of a European Communities HCM fellowship, and M.S. a European Communities Tempus fellowship. Production of the Sry transgenic was carried out under grant NIH GM20919 to E.M. Eicher.

REFERENCES

1. Disteche, C.M. (1995) Escape from X inactivation in human and mouse. Trends Genet., 11,17-22. MEDLINE Abstract

2. Graves, J.A.M. (1995) The origin and function of the mammalian Y chromosome and Y-borne genes-an evolving understanding. BioEssays,17, 311-321.

3. Tiepolo, L. and Zuffardi, O. (1976) Localization of factors controlling spermatogenesis in the nonfluorescent portion of the human Y chromosome long arm. Hum. Genet., 34, 119-124. MEDLINE Abstract

4. Burgoyne, P.S., Levy, E.R. and McLaren, A. (1986) Spermatogenic failure in male mice lacking H-Y antigen. Nature,320, 170-172. MEDLINE Abstract

5. Bardoni, B., Zuffardi, O., Guioli, S., Ballabio, A., Simi, P., Cavalli, P., Grimoldi, M.G., Fraccaro, M. and Camerino, G. (1991) A deletion map of the human Yq11 region: implications for the evolution of the Y chromosome and tentative mapping of a locus involved in spermatogenesis. Genomics,11, 443-451. MEDLINE Abstract

6. Ma, K., Sharkey, A., Kirsch, S., Vogt, P., Keil, R., Hargreave, T.B., McBeath, S. and Chandley, A.C. (1992) Towards the molecular localisation of the AZF locus: mapping of microdeletions in azoospermic men within 14 subintervals of interval 6 of the human Y chromosome. Hum. Mol. Genet., 1, 29-33. MEDLINE Abstract

7. Vogt, P., Chandley, A.C., Hargreave, T.B., Keil, R., Ma, K. and Sharkey, A. (1992) Microdeletions in interval 6 of the Y chromosome of males with idiopathic sterility point to disruption of AZF, a human spermatogenesis gene. Hum. Genet., 89, 491-496. MEDLINE Abstract

8. Reijo, R., Lee, T.-Y., Salo, P., Alagappan, R., Brown, L.G., Rosenberg, M., Rozen, S., Jaffe, T., Straus, D., Hovatta, O., de la Chapelle, A., Silber, S. and Page, D.C. (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nature Genet., 10, 383-393. MEDLINE Abstract

9. Ma, K., Inglis, J.D., Sharkey, A., Bickmore, W.A., Hill, R.E., Prosser, E.J., Speed, R.M., Thomson, E.J., Jobling, M., Taylor, K., Wolfe, J., Cooke, H.J., Hargreave, T.B. and Chandley, A.C. (1993) A Y chromosome gene family with RNA-binding protein homology: candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell,75,1-20.

10. Kobayashi, K., Mizuno, K., Hida, A., Komaki, R., Tomita, K., Matsushita, I., Namiki, M., Iwamoto, T., Tamura, S., Minowada, S., Nakahori, Y. and Nakagome, Y. (1994) PCR analysis of the Y chromosome long arm in azoospermic patients: evidence for a second locus required for spermatogenesis. Hum. Mol. Genet.,3,1965-1967. MEDLINE Abstract

11. Najmabadi, H., Huang, V., Yen, P., Subbarao, M.N., Bhasin, D., Banaag, L., Naseeruddin, S., de Kretser, D.M., Baker, H.W.G., McLachlan, R.I., Loveland, K.A. and Bhasin, S. (1996) Substantial prevalence of microdeletions of the Y-chromosome in infertile men with idiopathic azoospermia and oligospermia detected using a sequence-tagged site-based mapping strategy. J. Clin. Endocrinol. Metab., 81,1347-1352. MEDLINE Abstract

12. Nakahori, Y., Kuroki, Y., Komaki, R., Kondoh, N., Namiki, M., Iwamoto, T., Toda, T. and Kobayashi, K. (1996) The Y chromosome region essential for spermatogenesis. Horm. Res.,46, 20-23. MEDLINE Abstract

13. Qureshi, S.J., Ross, A.R., Ma, K., Cooke, H.J., McIntyre, M.A., Chandley, A.C. and Hargreave, T.B. (1996) Polymerase chain reaction screening for Y chromosome microdeletions: a first step towards the diagnosis of genetically-determined spermatogenic failure in men. Mol. Hum. Reprod., 2,775-779. MEDLINE Abstract

14. Vogt, P.H., Edelmann, A., Kirsch, S., Henegariu, O., Hirschmann, P., Kiesewetter, P., Köhn, F.M., Schill, W.B., Farah, S., Ramos, C., Hartmann, M., Hartschuh, W., Meschede, D., Behre, H.M., Castel, A., Nieschlag, E., Weidner, W., Gröne, H.-J., Jung, A., Engel, W. and Haidl, G. (1996) Human Y chromosome azoospermia factors mapped to different subregions in Yq11. Hum. Mol. Genet.,5,933-943. MEDLINE Abstract

15. Pryor, J.L., Kent-First, M., Muallem, A., Van Bergen, A.H., Nolten, W.E., Meisner, L. and Roberts, K.P. (1997) Microdeletions in the Y chromosome of infertile men. N. Engl. J. Med., 336, 535-539.

16. Saxena, R., Brown, L.G., Hawkins, T., Alagappan, R.K., Skaletsky, H., Reeve, M.P., Reijo, R., Rozen, S., Dinulos, M.B., Disteche, C.M. and Page, D.C. (1996) The DAZ gene cluster on the human Y chromsome arose from an autosomal gene that was transposed, repeatedly amplified and pruned. Nature Genet., 14,292-299. MEDLINE Abstract

17. Delbridge, M.L., Harry, J.L., Toder, R., O'Neill, R.J.W., Ma, K., Chandley, A.C. and Graves, J.A.M. (1997) A human candidate spermatogenesis gene, RBM1, is conserved and amplified on the marsupial Y chromosome. Nature Genet., 15, 131-136. MEDLINE Abstract

18. Laval, S.H., Glenister, P.H., Rasberry, C., Thornton, C.E., Mahadevaiah, S.K., Cooke, H.J., Burgoyne, P.S. and Cattanach, B.M. (1995) Y chromosome short arm-Sxr recombination in XSxr/Y males causes deletion of Rbm and XY female sex reversal. Proc. Natl Acad. Sci. USA,92, 10403-10407. MEDLINE Abstract

19. Elliot, D.J., Ma, K., Kerr, S.M., Thakrar, R., Speed, R., Chandley, A.C. and Cooke, H. (1996) An RBM homologue maps to the mouse Y chromosome and is expressed in germ cells. Hum. Mol. Genet., 5, 869-874.

20. Capel, B., Rasberry, C., Dyson, J., Bishop, C.E., Simpson, E., Vivian, N., Lovell-Badge, R., Rastan, S. and Cattanach, B.M. (1993) Deletion of Y chromosome sequences located outside the testis determining region can cause XY female sex reversal. Nature Genet.,5, 301-307. MEDLINE Abstract

21. King, T.R., Christianson, G.J., Mitchell, M.J., Bishop, C.E., Scott, D., Ehrmann, I., Simpson, E., Eicher, E.M. and Roopenian, D.C. (1994) Deletion mapping by immmunoselection against the H-Y histocompatibility antigen further resolves the Sxra region of the mouse Y chromosome and reveals complexity of the Hya locus. Genomics, 24,159-168. MEDLINE Abstract

22. Navin, A., Prekeris, R., Lisitsyn, N.A., Sonti, M.M., Grieco, D.A., Narayanswami, S., Lander, E.S. and Simpson, E.M. (1996) Mouse Y-specific repeats isolated by whole chromosome representational difference analysis. Genomics, 36, 349-353. MEDLINE Abstract

23. Odorisio, T., Mahadevaiah, S.K., McCarrey, J.R. and Burgoyne, P.S. (1996) Transcriptional analysis of the candidate spermatogenesis gene Ube1y and of the closely related Ube1x shows that they are coexpressed in spermatogonia and spermatids but are repressed in pachytene spermatocytes. Dev. Biol., 180, 336-343. MEDLINE Abstract

24. Gubbay, J., Collignon, J., Koopman, P., Capel, B., Economou, A., Münsterberg, A., Vivian, N., Goodfellow, P. and Lovell-Badge, R. (1990) A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature, 346, 245-250. MEDLINE Abstract

25. Sutcliffe, M.J., Darling, S.M. and Burgoyne, P.S. (1991) Spermatogenesis in XY, XYSxra and XOSxra mice: a quantitative analysis of spermatogenesis throughout puberty. Mol. Reprod. Dev., 30,81-89. MEDLINE Abstract

26. Lovell-Badge, R. and Robertson, E. (1990) XY female mice resulting from a heritable mutation in the primary testis-determining gene, Tdy. Development, 109, 635-646. MEDLINE Abstract

27. Gubbay, J., Vivian, N., Economou, A., Jackson, D., Goodfellow, P. and Lovell-Badge, R. (1992) Inverted repeat structure of the Sry locus in mice. Proc. Natl Acad. Sci. USA, 89,7953-7957. MEDLINE Abstract

28. Mahadevaiah, S.K., Lovell-Badge, R. and Burgoyne, P.S. (1993) Tdy-negative XY, XXY and XYY female mice: breeding data and synaptonemal complex analysis. J. Reprod. Fertil.,97, 151-160. MEDLINE Abstract

29. Burgoyne, P.S. (1998) The role of Y encoded genes in mammalian spermatogenesis. Semin. Cell Dev. Biol., in press.

30. Fisher, R.A. (1931) The evolution of dominance. Biol. Rev., 6, 345-368.

31. Burgoyne, P.S. (1996) Male sterility: fruit(less) flies provide a clue. Nature,381,740-741. MEDLINE Abstract

32. Kamma, H., Portman, D.S. and Dreyfuss, G. (1995) Cell type-specific expression of hnRNP proteins. Exp. Cell Res., 221, 187-196. MEDLINE Abstract

33. Rossi, P., Dolci, S., Albanesi, C., Grimaldi, P. and Geremia, R. (1993) Direct evidence that the mouse sex-determining gene Sry is expressed in the somatic cells of male fetal gonads and in the germ cell line in the adult testis. Mol. Reprod. Dev.,34,369-373. MEDLINE Abstract

34. Hendriksen, P.J.M., Hoogerbrugge, J.W., Themmen, A.P.N., Koken, M.H.M., Hoeijmakers, J.H.J., Oostra, B.A., van der Lende, T. and Grootegoed, J.A. (1995) Postmeiotic transcription of X and Y chromosomal genes during spermatogenesis in the mouse. Dev. Biol.,170,730-733.

35. Chai, N.N., Salido, E.C. and Yen, P.H. (1997) Multiple functional copies of the RBM gene family, a spermatogenesis candidate on the human Y chromosome. Genomics, 45, 355-361 MEDLINE Abstract

36. Elliot, D.J., Millar, M.R., O'Ghene, K., Ross, A., Kiesewetter, F., Pryor, J., McIntyre, M., Hargreave, T.B., Saunders, P.T.K., Vogt, P.H., Chandley, A.C. and Cooke, H. (1997) Expression of RBM in the nuclei of human germ cells is dependent on a critical region of the Y chromosome long arm. Proc. Natl Acad. Sci. USA, 94,3848-3853.

37. Chandley, A.C. and Cooke, H.J. (1994) Human male fertility-Y-linked genes and spermatogenesis. Hum. Mol. Genet., 3,1449-1452. MEDLINE Abstract

38. Cattanach, B.M. (1987) Sex-reversed mice and sex determination. Ann. NY Acad. Sci., 513,27-29. MEDLINE Abstract

39. Cattanach, B.M., Pollard, C.E. and Hawkes, S.G. (1971) Sex reversed mice: XX and XO males. Cytogenetics, 10, 318-337. MEDLINE Abstract

40. McLaren, A., Simpson, E., Tomonari, K., Chandler, P. and Hogg, H. (1984) Male sexual differentiation in mice lacking H-Y antigen. Nature, 312, 552-555. MEDLINE Abstract

41. Lane, P.W. and Davisson, M.T. (1990) Patchy fur (Paf), a semidominant X-linked gene associated with a high level of X-Y nondisjunction in male mice. J. Hered., 81,43-50. MEDLINE Abstract

42. Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P. and Lovell-Badge, R. (1991) Male development of chromosomally female mice transgenic for Sry. Nature, 351, 117-121. MEDLINE Abstract

43. Searle, A.G. and Beechey, C.V. (1974) Sperm count, egg fertilisation and dominant lethality after X-irradiation in mice. Mutat. Res., 22,63-72. MEDLINE Abstract

44. Howell, W.M. and Black, D.A. (1980) Controlled silver-staining of nucleolus organizer regions with protective colloidal developer; a 1-step method. Experientia, 36, 1014-1015. MEDLINE Abstract

45. Styrna, J., Imai, H.T. and Moriwaki, K. (1991) An increased level of sperm abnormalities in mice with a partial deletion of the Y chromosome. Genet. Res., 57,195-199. MEDLINE Abstract

46. Meistrich, M.L. (1977) Separation of spermatogenic cells and nuclei from rodent testes. In Prescott, D.M. (ed.), Methods in Cell Biology. Academic Press, New York, San Francisco, London,pp. 15-54. MEDLINE Abstract

47. Bellvé, A.R., Millette, C.F., Bhatnagar, Y.M. and O'Brien, D.A. (1977) Dissociation of the mouse testis and characterization of isolated spermatogenic cells. J. Histochem. Cytochem., 25, 480-494. MEDLINE Abstract

48. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

49. Simpson, E.M., Linder, C.C., Sargent, E.E., Davisson, M.T., Mobraaten, L.E. and Sharp, J.J. (1997) Genetic variation among 129 substrains and its importance for targeted mutagenesis in mice. Nature Genet., 16, 19-27. MEDLINE Abstract

50. Morgan, B.A., Conlon, F.L., Manzanares, M., Millar, J.B.A., Kanuga, N., Sharpe, J., Krumlauf, R., Smith, J.C. and Sedgwick, S.G. (1996) Transposon tools for recombinant DNA manipulation: characterisation of transcriptional regulators in yeast, Xenopus and mouse. Proc. Natl Acad. Sci., USA,93, 2801-2806.

51. Tease, C. and Cattanach, B.M. (1989) Sex chromosome pairing patterns in male mice of novel Sxr genotypes. Chromosoma, 97,390-395. MEDLINE Abstract

52. Minty, A.J., Caravatti, M., Robert, B., Cohen, A., Daubas, P., Weydert, A., Gros, F. and Buckingham, M.E. (1981) Mouse actin mRNAs. Construction and characterization of a recombinant plasmid molecule containing a complementary DNA transcript of mouse [alpha]-actin mRNA. J. Biol. Chem., 256,1008-1014. MEDLINE Abstract

53. Mitchell, M.J. and Bishop, C.E. (1992) A structural analysis of the Sxr region of the mouse Y chromosome. Genomics,12,26-34. MEDLINE Abstract

54. Bishop, C.E. and Hatat, D. (1987) Molecular cloning and sequence analysis of a mouse Y chromosome RNA transcript expressed in the testis. Nucleic Acids Res., 15,2959-2969. MEDLINE Abstract

55. Koopman, P., Gubbay, J., Collignon, J. and Lovell-Badge, R. 1989. Zfy gene expression patterns are not compatible with a primary role in mouse sex determination. Nature, 342,940-942. MEDLINE Abstract

56. Hogan, B.L.M., Constantini, F. and Lacy, E. (1986) Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

57. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156-159. MEDLINE Abstract

58. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979) Isolation of biologically active ribonucleic acid from sources enriched with ribonuclease. Biochemistry, 18,5294-5299. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +44 181 959 3666; Fax: +44 181 906 4477; Email: pburgoy@mrc.nimr.ac.uk
+Present address: Laboratorio di Biologia Molecolare e Cellulare, Istituto Dermopatico dell'Immacolata, Via dei Monti di Creta 104, 00167 Roma, Italy


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 14 Mar 1998
Copyright© Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Biol. Reprod.Home page
Y. Yamauchi, J. M. Riel, S. J. Wong, O. A. Ojarikre, P. S. Burgoyne, and M. A. Ward
Live Offspring from Mice Lacking the Y Chromosome Long Arm Gene Complement
Biol Reprod, August 1, 2009; 81(2): 353 - 361.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
I. Ehrmann, C. Dalgliesh, A. Tsaousi, M. P. Paronetto, B. Heinrich, R. Kist, P. Cairns, W. Li, C. Mueller, M. Jackson, et al.
Haploinsufficiency of the germ cell-specific nuclear RNA binding protein hnRNP G-T prevents functional spermatogenesis in the mouse
Hum. Mol. Genet., September 15, 2008; 17(18): 2803 - 2818.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. Zeng, H. Sun, S. Chen, X. Wang, Y. Yang, Y. Liu, D. Tao, Z. Yang, S. Zhang, and Y. Ma
Identification of target messenger RNA substrates for mouse RBMY
Mol. Hum. Reprod., June 1, 2008; 14(6): 331 - 336.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
D. L. Smith-Bouvier, A. A. Divekar, M. Sasidhar, S. Du, S. K. Tiwari-Woodruff, J. K. King, A. P. Arnold, R. R. Singh, and R. R. Voskuhl
A role for sex chromosome complement in the female bias in autoimmune disease
J. Exp. Med., May 12, 2008; 205(5): 1099 - 1108.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
M. Alton, M. P. Lau, M. Villemure, and T. Taketo
The behavior of the X- and Y-chromosomes in the oocyte during meiotic prophase in the B6.YTIR sex-reversed mouse ovary
Reproduction, February 1, 2008; 135(2): 241 - 252.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Y. Costa, R. M. Speed, P. Gautier, C. A. Semple, K. Maratou, J. M.A. Turner, and H. J. Cooke
Mouse MAELSTROM: the link between meiotic silencing of unsynapsed chromatin and microRNA pathway?
Hum. Mol. Genet., August 1, 2006; 15(15): 2324 - 2334.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Durcova-Hills, P. Hajkova, S. Sullivan, S. Barton, M. A. Surani, and A. McLaren
Influence of sex chromosome constitution on the genomic imprinting of germ cells
PNAS, July 25, 2006; 103(30): 11184 - 11188.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. A. Ward and P. S. Burgoyne
The Effects of Deletions of the Mouse Y Chromosome Long Arm on Sperm Function--Intracytoplasmic Sperm Injection (ICSI)-Based Analysis
Biol Reprod, April 1, 2006; 74(4): 652 - 658.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. D. Gatewood, A. Wills, S. Shetty, J. Xu, A. P. Arnold, P. S. Burgoyne, and E. F. Rissman
Sex chromosome complement and gonadal sex influence aggressive and parental behaviors in mice.
J. Neurosci., February 22, 2006; 26(8): 2335 - 2342.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
A. Hellani, S. Al-Hassan, A. Al-Duraihim, and S. Coskun
Y chromosome microdeletions: are they implicated in teratozoospermia?
Hum. Reprod., December 1, 2005; 20(12): 3505 - 3509.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
P. J. Wang, D. C. Page, and J. R. McCarrey
Differential expression of sex-linked and autosomal germ-cell-specific genes during spermatogenesis in the mouse
Hum. Mol. Genet., October 1, 2005; 14(19): 2911 - 2918.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. M. Palaszynski, D. L. Smith, S. Kamrava, P. S. Burgoyne, A. P. Arnold, and R. R. Voskuhl
A Yin-Yang Effect between Sex Chromosome Complement and Sex Hormones on the Immune Response
Endocrinology, August 1, 2005; 146(8): 3280 - 3285.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. B. Becker, A. P. Arnold, K. J. Berkley, J. D. Blaustein, L. A. Eckel, E. Hampson, J. P. Herman, S. Marts, W. Sadee, M. Steiner, et al.
Strategies and Methods for Research on Sex Differences in Brain and Behavior
Endocrinology, April 1, 2005; 146(4): 1650 - 1673.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
K. Almstrup, J. E. Nielsen, M. A. Hansen, M. Tanaka, N. E. Skakkebaek, and H. Leffers
Analysis of Cell-Type-Specific Gene Expression During Mouse Spermatogenesis
Biol Reprod, June 1, 2004; 70(6): 1751 - 1761.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
J. Lee, J. Hong, E. Kim, K. Kim, S. W. Kim, H. Krishnamurthy, S. S.W. Chung, D. J. Wolgemuth, and K. Rhee
Developmental stage-specific expression of Rbm suggests its involvement in early phases of spermatogenesis
Mol. Hum. Reprod., April 1, 2004; 10(4): 259 - 264.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. K. Wagner, J. Xu, J. L. Pfau, P. S. Quadros, G. J. De Vries, and A. P. Arnold
Neonatal Mice Possessing an Sry Transgene Show a Masculinized Pattern of Progesterone Receptor Expression in the Brain Independent of Sex Chromosome Status
Endocrinology, March 1, 2004; 145(3): 1046 - 1049.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. P. Arnold, J. Xu, W. Grisham, X. Chen, Y.-H. Kim, and Y. Itoh
Minireview: Sex Chromosomes and Brain Sexual Differentiation
Endocrinology, March 1, 2004; 145(3): 1057 - 1062.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Toure, M. Szot, S. K. Mahadevaiah, A. Rattigan, O. A. Ojarikre, and P. S. Burgoyne
A New Deletion of the Mouse Y Chromosome Long Arm Associated With the Loss of Ssty Expression, Abnormal Sperm Development and Sterility
Genetics, February 1, 2004; 166(2): 901 - 912.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H. Ishikawa, A. Rattigan, R. Fundele, and P. S. Burgoyne
Effects of Sex Chromosome Dosage on Placental Size in Mice
Biol Reprod, August 1, 2003; 69(2): 483 - 488.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
A Ferlin, E Moro, A Rossi, B Dallapiccola, and C Foresta
The human Y chromosome's azoospermia factor b (AZFb) region: sequence, structure, and deletion analysis in infertile men
J. Med. Genet., January 1, 2003; 40(1): 18 - 24.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. M. A. Turner, S. K. Mahadevaiah, D. J. Elliott, H.-J. Garchon, J. R. Pehrson, R. Jaenisch, and P. S. Burgoyne
Meiotic sex chromosome inactivation in male mice with targeted disruptions of Xist
J. Cell Sci., November 1, 2002; 115(21): 4097 - 4105.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
G. J. De Vries, E. F. Rissman, R. B. Simerly, L.-Y. Yang, E. M. Scordalakes, C. J. Auger, A. Swain, R. Lovell-Badge, P. S. Burgoyne, and A. P. Arnold
A Model System for Study of Sex Chromosome Effects on Sexually Dimorphic Neural and Behavioral Traits
J. Neurosci., October 15, 2002; 22(20): 9005 - 9014.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Xu, P. S. Burgoyne, and A. P. Arnold
Sex differences in sex chromosome gene expression in mouse brain
Hum. Mol. Genet., June 1, 2002; 11(12): 1409 - 1419.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. Foresta, E. Moro, and A. Ferlin
Y Chromosome Microdeletions and Alterations of Spermatogenesis
Endocr. Rev., April 1, 2001; 22(2): 226 - 239.
[Abstract] [Full Text]


Home page
Hum Mol GenetHome page
D. J. Elliott, J. P. Venables, C. S. Newton, D. Lawson, S. Boyle, I. C. Eperon, and H. J. Cooke
An evolutionarily conserved germ cell-specific hnRNP is encoded by a retrotransposed gene
Hum. Mol. Genet., September 1, 2000; 9(14): 2117 - 2124.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. J. Elliott, C. F. Bourgeois, A. Klink, J. Stevenin, and H. J. Cooke
A mammalian germ cell-specific RNA-binding protein interacts with ubiquitously expressed proteins involved in splice site selection
PNAS, May 23, 2000; 97(11): 5717 - 5722.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J.P. Venables, D.J. Elliott, O.V. Makarova, E.M. Makarov, H.J. Cooke, and I.C. Eperon
RBMY, a probable human spermatogenesis factor, and other hnRNP G proteins interact with Tra2{beta} and affect splicing
Hum. Mol. Genet., March 22, 2000; 9(5): 685 - 694.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
T. Vogel, R.M. Speed, P. Teague, and H.J. Cooke
Mice with Y chromosome deletion and reduced Rbm genes on a heterozygous Dazl1 null background mimic a human azoospermic factor phenotype
Hum. Reprod., December 1, 1999; 14(12): 3023 - 3029.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (73)
Right arrowRequest Permissions
Right arrowScopus Links
Google Scholar
Right arrow Articles by Mahadevaiah, S. K.
Right arrow Articles by Burgoyne, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mahadevaiah, S. K.
Right arrow Articles by Burgoyne, P. S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?