Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (96)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Vaughan, J. R.
Right arrow Articles by Wood, N. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vaughan, J. R.
Right arrow Articles by Wood, N. W.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 751-753

Sequencing of the [alpha]-synuclein gene in a large series of cases of familial Parkinson's disease fails to reveal any further mutations
Introduction
Results And Discussion
Materials And Methods
   Patients
   Laboratory methods
Acknowledgements
References


Sequencing of the [alpha]-synuclein gene in a large series of cases of familial Parkinson's disease fails to reveal any further mutations

Sequencing of the [alpha]-synuclein gene in a large series of cases of familial Parkinson's disease fails to reveal any further mutations Jenny R. Vaughan1, Matthew J. Farrer2, Zbigniew K. Wszolek3, Thomas Gasser4, Alexandra Durr5, Yves Agid5, Vincenzo Bonifati6, Giuseppe DeMichele7, Gianpiero Volpe7, Sarah Lincoln2, Monique Breteler8, Giuseppe Meco6, Alexis Brice5, C. David Marsden1, John Hardy2 and Nicholas W. Wood1,* and The European Consortium on Genetic Susceptibility in Parkinson's Disease (GSPD)

1University Department of Clinical Neurology, Institute of Neurology, Queen Square, London WC1N 3BG, UK, 2Mayo Clinic Jacksonville, Neurogenetics, 4500 San Pablo Road, Jacksonville, FL 32224, USA, 3Section of Neurology, University of Nebraska, Omaha, NE, USA, 4Department of Neurology, Klinikum Grosshadern, Munich, Germany, 5INSERM U289, Paris, France, 6Dipartimento di Scienze Neurologiche, Universita `La Sapienza', Roma, Italy, 7Dipartimento di Scienze Neurologiche, Universita Federico 11, Naples, Italy and 8Department of Epidemiology and Biostatistics, Erasmus University Medical School, 3000 Rotterdam, The Netherlands

Received December 18, 1997; Revised and Accepted January 23, 1998

A mutation in exon 4 of the human [alpha]-synuclein gene was reported recently in four families with autosomal dominant Parkinson's disease (PD). In order to examine whether mutations in this exon or elsewhere in the gene are common in familial PD, all seven exons of the [alpha]-synuclein gene were amplified by PCR from index cases of 30 European and American Caucasian kindreds affected with autosomal dominant PD. Each product was sequenced directly and examined for mutations in the open reading frame. No mutations were found in any of the samples examined. We conclude that the A53T change described in the [alpha]-synuclein gene is a rare cause of PD or may even be a rare variant. Mutations in the regulatory or intronic regions of the gene were not excluded by this study.

INTRODUCTION

A recent report described an American-Italian kindred (Contursi kindred) with autosomal dominant inheritance of a levodopa-responsive parkinsonian syndrome. Affected patients exhibited the core triad of tremor, rigidity and bradykinesia characteristic of classical Parkinson's disease (PD) as well as pathological evidence of Lewy bodies. Genomic analysis of this family ultimately led to mapping of a locus to chromosome 4q21-23, designated PD-1 (1). These authors have since identified a G -> A transition at position 209 in exon 4 of the [alpha]-synuclein gene causing an alanine to threonine substitution at position 53 [Ala53Thr (2)] and proposed this as the causative mutation necessary for the development of the parkinsonian phenotype in the kindred. Support for this hypothesis was given by the finding of the same mutation in affected members of three apparently unrelated Greek families. However, shortly before identification of the [alpha]-synuclein gene mutation, polymorphic markers spanning the locus PD-1 were examined in 13 European multigenerational PD families with an autosomal dominant pattern of inheritance, and showed no linkage in 11 out of the 13 families (3). In two small families, positive lod scores were obtained, indicating the possibility of linkage.

Following identification of the Ala53Thr mutation in the [alpha]-synuclein gene, we sequenced all seven exons of [alpha]-synuclein in 30 index cases of familial PD. Some of these families were found previously to be unlinked to the PD-1 locus (3). Sequencing of the [alpha]-synuclein gene would allow us to confirm or refute the linkage data obtained and, more importantly, to estimate the numerical importance of the [alpha]-synuclein gene in autosomal dominant PD.

RESULTS AND DISCUSSION

Polymerase chain reaction (PCR) products were generated from genomic DNA from 30 index cases of familial PD using a panel of primer pairs flanking each exon of the [alpha]-synuclein gene. Each of these products were of a size consistent with published data (2). These were then sequenced directly in order to screen for the presence of polymorphisms and/or mutations, but no coding base pair differences were found relative to the published sequence in any of the 30 families.

The recent description of a mutation in the [alpha]-synuclein gene in four families with autosomal dominant PD may aid in the understanding of the genetic basis of familial PD. The mutation, if it is indeed pathogenic, is a rare cause of PD (4,5). While these authors reported the same amino acid change in the Contursi kindred and in three apparently unrelated Greek kindreds, it remains a possibility that they may share a common origin as the two locations formerly were connected by a trade route. Thus, in the absence of haplotype data, a founder effect cannot be excluded.


Figure 1. Haplotype data obtained from polymorphic markers spanning the PD-1 locus on chromosome 4q21-q23 in family K.

Table 1. Clinical characteristics of 16 of the families
Family No. of affecteds No. of affecteds examined Region of origin Mean age at onset Atypical features Reference
A 12 4 German-Canadian 51 (35-60) Amyotrophy/dementia (9,10)
B 8 4 Danish-American 62 (51-82) Dementia (some) (9,10)
C 11 4 German-American 60 (55-66) None (9,10)
D 18 5 English-American 63 (48-78) None (10,11)
G 11 4 German-American 56 (48-74) Dementia (some) (12)
IT-027 9 4 Italian 55 (46-67) None unpublished
IT-1 6 4 Italian 54 (36-89) None (13)
IT-0 3 2 Italian 56 (28-74) None (14)
K 4 4 German 56 (45-63) None unpublished
L 6 2 English 60 (52-66) None unpublished
M 3 3 English 45 (30-55) None unpublished
N 16 8 English 53 (42-70) None unpublished
O 4 4 English 48 (38-55) None unpublished
P 7 3 English 64 (58-70) None unpublished
Q 3 3 Welsh 63 (59-65) None unpublished
R 8 6 English 64 (42-75) None unpublished
All affected members exhibited at least two out of four of the cardinal parkinsonian signs (akinesia, resting tremor, rigidity, postural instability), and improvement on l-Dopa therapy.

To date, no patients with sporadic PD have been found to carry the Ala53Thr [alpha]-synuclein mutation (2). In addition, the amino acid at position 53 is not conserved between mammalian species, in contrast with neighbouring residues. For instance, in rats, a threonine at position 53 is the native sequence. To test whether the alanine/threonine substitution at this position in the Contursi kindred was a neutral, perhaps ancestral, variant we also sequenced exons 3-5 of African green monkey [alpha]-synuclein cDNA and found that monkey and man have an identical sequence (unpublished data). Therefore, the Contursi Ala53Thr mutation does not reflect the ancestral human gene.

The possibility that the [alpha]-synuclein gene is in linkage disequilibrium with the true causative gene defect should also be considered. In support of this, we previously reported a lod score of 1.5 at the PD-1 locus for family K, close to the theoretical maximum for this small family (3), yet in the present study no mutations were identified in the exons of [alpha]-synuclein. This does not exclude other candidates in the region as responsible for the parkinsonian syndrome in this kindred. The pedigree shown in Figure 1 gives haplotype data obtained for markers spanning the PD-1 locus in family K.

Histopathological studies of brainstem and cortex from patients with sporadic PD and dementia with Lewy bodies have shown that Lewy bodies are strongly immunoreactive for [alpha]-synuclein (6). However, as Lewy bodies are composed of many different proteins, the presence of [alpha]-synuclein in these structures does not necessarily implicate it in their formation.

If mutations in the [alpha]-synuclein gene rarely cause PD, an understanding of its biochemical function and interactions may suggest logical candidate genes for investigation, as mutations in heterogeneous gene products in a biochemical pathway may ultimately lead to a similar parkinsonian phenotype. However, until further novel mutations in the [alpha]-synuclein gene are found, the assignment of the [alpha]-synuclein gene as the PD-1 locus must be regarded as provisional rather than certain.

Table 2. PCR primers for the exonic amplification of [alpha]-synuclein
NACP exon Primers 5'/3', forward and reverse Product
size (bp)
Exons 1 and 2 GAGAAGGAGGAGGACTAGGAGG 499
  CGGCGTTCTCCAGGATTTC  
Exon 3 GTCTCACACTTTGGAGGGTTTC 395
  CACCTACCTACACATACCTCTGACTC  
Exon 4 GCTAATCAGCAATTTAAGGCTAG 215
  GATATGTTCTTAGATGCTCAG  
Exon 5 CGATGGCTAGTGGAAGTGG 325
  CGATGGCTAGTGGAAGTGG  
Exon 6 CGGAGGCATTGTGGAGTTTAG 373
  CCACGTAATGAGCATGTAGAGAGC  
Exon 7 GACTGGGCACATTGGAACTGAG 189
  GCTGTCAGTGCTGATGCGTAATTG  

MATERIALS AND METHODS

Patients

Thirty index cases from Caucasian families exhibiting apparent autosomal dominant inheritance were examined. In these families, at least two affected individuals in each family were personally examined in order to ensure fulfilment of the diagnostic criteria of idiopathic PD, in accordance with a similar study design (7). Post-mortem information was available from members of two kindreds, and this confirmed the presence of Lewy bodies in a typical distribution. Three members of family K, which previously had given a maximum multipoint lod score of 1.5 at locus PD-1, were included in the study (3). Clinical characteristics of 16 kindreds are shown (Table 1). Index cases of seven American Caucasian families were ascertained by The Mayo Clinic (onset ages of the affecteds sequenced were 69, 75, 53, 72, 67 and 45 years), and seven further families are also referenced for information (5).

Laboratory methods

Primers were designed to human genomic non-A[beta] component of Alzheimer's disease amyloid precursor protein, NACP/synuclein (sequences submitted to NCBI database; accession nos U46896-U46901). They were designed to amplify sequences flanking each exon at ~50-100 bp proximal and distal to the coding sequence. The exact exon-intron organisation of the human [alpha]-synuclein gene is not yet known. Primers were designed using Gene Runner 3.05, Hastings Software, Inc. Exons 1 and 2 (untranslated) were amplified together as one product. The 5' intron sequence flanking exon 7 is not known. Thus intron 6-7 was PCR amplified using exon 6F and exon 7R primers and Expand Long Template PCR system (Boeringer Mannheim) (for primers, see Table 2). A 2.8 kb PCR fragment was excised from an agarose gel, TA cloned (Invitrogen) and sequenced. Exon 4 primers used were as published (2). PCR conditions were denaturation at 94°C (3 min), followed by 35 cycles of 94°C (20 s), 55°C (30 s), 72°C (45 s), with a final extension at 72°C (10 min). PCR products were purified using QIAquick columns prior to sequencing using dRhodamine terminators on an ABI377. Sequence chromatograms were analysed using PolyPhredPhrap (8).

ACKNOWLEDGEMENTS

The European Consortium on Genetic Susceptibility in Parkinson's Disease (GSPD) comprises: N. Wood and J.R. Vaughan (UK); A. Brice, A. Durr, J. Tassin, M. Martinez, J. Feingold and Y. Agid (France); T. Gasser, and B. Bereznai (Munich); M. Breteler, S. Harhangi and B. Oostra (The Netherlands); and V. Bonifati, E. Fabrizio, G. Meco, G. De Michele, G. Volpe and G. Campanella (Italy). This work was supported by The Parkinson's Disease Society of Great Britain, The Italian Ministry for University, Scientific and Technological Research (MURST), Association France Parkinson, the French Health Ministry (PHRC), EC Biomed 2, the Brain Research Trust and the Doris Hillier Award (British Medical Association).

REFERENCES

1. Polymeropoulos, M., Higgins, J.J., Golbe, L.I., Johnson, W.G., Ide, S.E., Di Iorio, G., Sanges, G., Stenroos, E.S., Pho, L.T., Schaffer, A.A., Lazzarini, A.M., Nussbaum, R.L. and Duvoisin, R.C. (1996) Mapping of a gene for Parkinson's disease to chromosome 4q21-23. Science, 274, 1197-1199. MEDLINE Abstract

2. Polymeropoulos, M., Lavedan, C., Leroy, E., Ide, S.E., Dehejia, A., Dutra, A., Pike, B., Root, H., Rubenstein, J., Boyer, R., Stenroos, E.S., Chandrasekharappa, S., Athanassiadou, A., Papapetropoulos, T., Johnson, W.G., Lazzarini, A.M., Duvoisin, R.C., Di Iorio, G., Golbe, L.I. and Nussbaum, R.L. (1997) Mutation in the [alpha]-synuclein gene identified in families with Parkinson's disease. Science, 276, 2045-2047. MEDLINE Abstract

3. Gasser, T., Muller-Myhsok, B., Wszolek, Z.K., Durr, A., Vaughan, J.R., Bonifati, V., Meco, G., Bereznai, B., Oehlmann, R., Agid, Y., Brice, A., Wood, N.W. and the European Consortium on Genetic Susceptibility in Parkinson's Disease (GSPD) (1997) Genetic complexity and Parkinson's Disease. Science, 277, 388-389.

4. Zareparsi, S., Kay, J., Camicioli, R., Kramer, P., Nutt, J., Bird, T., Litt, M. and Payami, H. (1998) Analysis of the [alpha]-synuclein G209A mutation in familial Parkinson's disease. Lancet, 351,37-38. MEDLINE Abstract

5. Farrer, M., Wavrant-De Vrieze, F., Crook, R., Perez-Tur, J., Hardy, J., Johnson, W.G., Steele, J., Maraganore, D., Gwinn, K. and Lynch, T. (1998) Low frequencey of alpha-synuclein mutations in familial Parkinson's disease. Ann. Neurol., in press.

6. Spillantini, M.G., Schmidt, M.L., Lee, V.M., Trojanowski, J.Q., Jakes, R. and Goedert, M. (1997) Alpha-synuclein in Lewy bodies. Nature, 388, 839-840. MEDLINE Abstract

7. Maraganore, D., Harding, A.E. and Marsden, C.D. (1991) A clinical and genetic study of familial Parkinson's disease. Movement Disord., 6, 205-211. MEDLINE Abstract

8. Nickerson, D.A., Tobe, V.O. and Taylor, S.L. (1997) PolyPhred: automating the detection and genotyping of single nucleotide substitutions using fluorescence-based resequencing. Nucleic Acids Res., 25, 2745-2751. MEDLINE Abstract

9. Wszolek, Z.K., Cordes, M., Calne, D.B., Munter, M.D., Cordes, I. and Pfeiffer, R.F. (1993) Hereditary Parkinson's disease: report of 3 families with dominant autosomal inheritance. Nervenarzt, 64, 331-335. MEDLINE Abstract

10. Denson, M.A. and Wszolek Z.K. (1995) Familial parkinsonism: our experience and review. In Calne, D. (ed.), Parkinsonism and Related Disorders. Vol. 1, pp.35-46. Elsevier Science, UK.

11. Wszolek, Z.K., Pfeiffer, B., Fulgham, J.R., Parisi, J.R., Thompson, B.M., Uitti, R.J., Calne, D.B. and Pfeiffer R.F. (1995) Western Nebraska family (family D) with autosomal dominant parkinsonism. Neurology, 45, 502-505. MEDLINE Abstract

12. Denson, M.A., Wszolek, Z.K., Pfeiffer, R.F., Wszolek, E.K., Paschall, T.M. and McComb, R.D. (1997) Familial Parkinsonism, dementia and Lewy body disease: study of family G. Ann. Neurol., 42, 638-643. MEDLINE Abstract

13. Bonifati, V., Fabrizio, E., Vanacore, N., Gasparini, M. and Meco, G. (1996) A large Italian family with dominantly inherited levodopa-responsive parkinsonism and isolated tremors. Movement Disord., 11 (Suppl.1), 86 (Abstract).

14. Bonifati,V., Vanacore, N. and Meco, G. (1994) Anticipation of onset age in familial Parkinson's Disease. Neurology, 44, 1978-1979. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +44 171 837 3611; Fax: +44 171 278 5616; Email: n.wood@lon.ucl.ac.uk

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 14 Mar 1998
Copyright© Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 NeurologyHome page
J. Fuchs, C. Nilsson, J. Kachergus, M. Munz, E.-M Larsson, B. Schule, J. W. Langston, F. A. Middleton, O. A. Ross, M. Hulihan, et al.
Phenotypic variation in a large Swedish pedigree due to SNCA duplication and triplication
Neurology, March 20, 2007; 68(12): 916 - 922.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
N. Pankratz, W. C. Nichols, S. K. Uniacke, C. Halter, J. Murrell, A. Rudolph, C. W. Shults, P. M. Conneally, T. Foroud, and the Parkinson Study Group
Genome-wide linkage analysis and evidence of gene-by-gene interactions in a sample of 362 multiplex Parkinson disease families
Hum. Mol. Genet., October 16, 2003; 12(20): 2599 - 2608.
[Abstract] [Full Text] [PDF]

Home page
 NeurologyHome page
A.H. V. Schapira
Neuroprotection in PD--A role for dopamine agonists?
Neurology, September 23, 2003; 61(90063): S34 - 42.
[Full Text]

Home page
 BrainHome page
M. C. J. Dekker, V. Bonifati, and C. M. van Duijn
Parkinson's disease: piecing together a genetic jigsaw
Brain, August 1, 2003; 126(8): 1722 - 1733.
[Abstract] [Full Text] [PDF]

Home page
 ANN INTERN MEDHome page
A. Siderowf and M. Stern
Update on Parkinson Disease
Ann Intern Med, April 15, 2003; 138(8): 651 - 658.
[Abstract] [Full Text] [PDF]

Home page
 NeurologyHome page
J.E. Galvin, S.L. Lee, A. Perry, N. Havlioglu, D.W. McKeel Jr., and J.C. Morris
Familial dementia with Lewy bodies: Clinicopathologic analysis of two kindreds
Neurology, October 8, 2002; 59(7): 1079 - 1082.
[Abstract] [Full Text] [PDF]

Home page
 NeurologyHome page
B. A. Racette, M. Rundle, J. C. Wang, A. Goate, N. L. Saccone, M. Farrer, S. Lincoln, J. Hussey, S. Smemo, J. Lin, et al.
A multi-incident, Old-Order Amish family with PD
Neurology, February 26, 2002; 58(4): 568 - 574.
[Abstract] [Full Text] [PDF]

Home page
 BrainHome page
D. J. Nicholl, J. R. Vaughan, N. L. Khan, S. L. Ho, D. E. W. Aldous, S. Lincoln, M. Farrer, J. D. Gayton, M. B. Davis, P. Piccini, et al.
Two large British kindreds with familial Parkinson's disease: a clinico-pathological and genetic study
Brain, January 1, 2002; 125(1): 44 - 57.
[Abstract] [Full Text] [PDF]

Home page
 J Geriatr Psychiatry NeurolHome page
K. Gwinn-Hardy and A. A. Singleton
Familial Lewy Body Diseases
J Geriatr Psychiatry Neurol, January 1, 2002; 15(4): 217 - 223.
[Abstract] [PDF]

Home page
 NeurologyHome page
R. Kruger, W. Kuhn, K.L. Leenders, R. Sprengelmeyer, T. Muller, D. Woitalla, A.T. Portman, R.P. Maguire, L. Veenma, U. Schroder, et al.
Familial parkinsonism with synuclein pathology: Clinical and PET studies of A30P mutation carriers
Neurology, May 22, 2001; 56(10): 1355 - 1362.
[Abstract] [Full Text] [PDF]

Home page
 NeurologyHome page
H. Payami, N. Lee, S. Zareparsi, M. Gonzales McNeal, R. Camicioli, T.D. Bird, G. Sexton, S. Gancher, J. Kaye, D. Calhoun, et al.
Parkinson's disease, CYP2D6 polymorphism, and age
Neurology, May 22, 2001; 56(10): 1363 - 1370.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurol. Neurosurg. PsychiatryHome page
S Papapetropoulos, C Paschalis, A Athanassiadou, A Papadimitriou, J Ellul, M H Polymeropoulos, and T. Papapetropoulos
Clinical phenotype in patients with {alpha}-synuclein Parkinson's disease living in Greece in comparison with patients with sporadic Parkinson's disease
J. Neurol. Neurosurg. Psychiatry, May 1, 2001; 70(5): 662 - 665.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
S. J. Tabrizi, M. Orth, J. M. Wilkinson, J.-W. Taanman, T. T. Warner, J. M. Cooper, and A. H.V. Schapira
Expression of mutant {alpha}-synuclein causes increased susceptibility to dopamine toxicity
Hum. Mol. Genet., November 1, 2000; 9(18): 2683 - 2689.
[Abstract] [Full Text] [PDF]

Home page
 NeurologyHome page
N. Gouider-Khouja, S. Belal, M. B. Hamida, and F. Hentati
Clinical and genetic study of familial Parkinson's disease in Tunisia
Neurology, April 25, 2000; 54(8): 1603 - 1609.
[Abstract] [Full Text] [PDF]

Home page
 Arch NeurolHome page
D. K. Y. Chan, G. Mellick, H. Cai, X. L. Wang, P. W. Ng, C. P. Pang, J. Woo, and R. Kay
The {alpha}-Synuclein Gene and Parkinson Disease in a Chinese Population
Arch Neurol, April 1, 2000; 57(4): 501 - 503.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J. E. Galvin, K. Uryu, V. M.-Y. Lee, and J. Q. Trojanowski
Axon pathology in Parkinson's disease and Lewy body dementia hippocampus contains alpha -, beta -, and gamma -synuclein
PNAS, November 9, 1999; 96(23): 13450 - 13455.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
M. Farrer, K. Gwinn-Hardy, M. Hutton, and J. Hardy
The genetics of disorders withsynuclein pathology and parkinsonism
Hum. Mol. Genet., September 1, 1999; 8(10): 1901 - 1905.
[Abstract] [Full Text] [PDF]

Home page
 NeurologyHome page
A. Papadimitriou, V. Veletza, G. M. Hadjigeorgiou, A. Patrikiou, M. Hirano, and I. Anastasopoulos
Mutated {alpha}-synuclein gene in two Greek kindreds with familial PD: Incomplete penetrance?
Neurology, February 1, 1999; 52(3): 651 - 651.
[Abstract] [Full Text]

Home page
 Genome ResHome page
C. Lavedan
The Synuclein Family
Genome Res., September 1, 1998; 8(9): 871 - 880.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (96)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Vaughan, J. R.
Right arrow Articles by Wood, N. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vaughan, J. R.
Right arrow Articles by Wood, N. W.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?