Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (85)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Li, S. H.
Right arrow Articles by Li, X. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, S. H.
Right arrow Articles by Li, X. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 777-782  


Aggregation of N-terminal huntingtin is dependent on the length of its glutamine repeats
Introduction
Results
Discussion
Materials And Methods
   Expression constructs and transfection
   Antibodies and western blot analysis
   Immunofluorescence labeling
Acknowledgements
References


Aggregation of N-terminal huntingtin is dependent on the length of its glutamine repeats

Aggregation of N-terminal huntingtin is dependent on the length of its glutamine repeats

Shi-Hua Li, Xiao-Jiang Li*

Department of Genetics, Emory University School of Medicine, Atlanta, GA 30322, USA

Received December 17, 1997; Revised and Accepted February 15, 1998

Huntington's disease (HD) is caused by expansion of a glutamine repeat in huntingtin. Mutant huntingtin contains 36-55 repeats in adult HD patients and >60 repeats in juvenile HD patients. An N-terminal fragment of mutant huntingtin forms aggregates in neuronal nuclei in the brains of transgenic mice and HD patients. Aggregation of expanded polyglutamine is thought to be a common pathological mechanism in HD and other glutamine repeat diseases. It is not clear how the length of the repeats is correlated with formation of protein aggregates. By expressing a series of huntingtin constructs encoding various glutamine repeats (23-150 units) in cultured cells we observed N-terminal fragments of huntingtin (amino acids 1-67 and 1-212), but not full-length huntingtins, with glutamine repeats [ge]66 units formed protein aggregates. Huntingtin aggregation was not induced when the repeat was [le]49 units and was markedly promoted by very long repeats [ge]120 units. This study suggests that variousN-terminal fragments of mutant huntingtin can form aggregates and that aggregation is prompted by lengthening the glutamine repeat.

INTRODUCTION

Expansion of a CAG/glutamine repeat has been found to cause eight inherited neurodegenerative diseases, including Huntington's disease (HD) (1-9). The number of glutamine repeats in huntingtin is 10-34 in normal individuals and [ge]36 in HD patients (1). Most HD cases are adult patients with repeat lengths of 36-55 units and those patients usually have choreic movements, dementia and other psychiatric problems. Some rare cases are the juvenile form of the disease that progresses more rapidly and has a different phenotype characterized by rigidity of movement. Juvenile patients often carry expanded repeats with >60 units (10). There is a good inverse correlation between CAG repeat length and age at onset of neurological symptoms in juvenile patients (11-13). Therefore, large polyglutamine expansions may confer new properties on huntingtin and these properties may contribute to the neuropathology of HD.

Huntingtin mutation is thought to act by a gain of function mechanism. One of the hypotheses is that polyglutamine may cause huntingtin to aggregate by forming pleated sheets of [beta]-strands (14). Consistent with this idea, expanded glutamine repeats (>60 units) have been found to induce intranuclear aggregation of the N-terminus of huntingtin in the brains of transgenic mice (15) and in HD patients (16). Aggregation of the N-terminus of huntingtin is well correlated with the progress of neurological dysfunction occurring in transgenic mice (15), suggesting that huntingtin aggregation is involved in the pathology of HD. Since most HD patients have repeats <60 units and since a recent study shows that knock-in mice carrying a 50 glutamine repeat did not develop any abnormalities (17), it will be interesting to investigate the relationship between length of the glutamine repeat and huntingtin aggregation. Because polyglutamine protein aggregation in vivo is mirrored by its aggregation in vitro (18-20), we examined the effect of length of the glutamine repeat on aggregation of huntingtin in cultured cells. The present study demonstrates that the N-terminal domain of huntingtin forms aggregates when the repeat is >66 units. Repeats of <49 units do not induce protein aggregation. N-terminal fragments of huntingtin produced by proteolysis have been observed in vivo (16,21). Our study suggests that aggregation of mutant huntingtin can occur with its different N-terminal fragments and that aggregation is significantly prompted by large repeats (>66 units).

RESULTS

To determine the relationship between huntingtin aggregation and length of the glutamine repeat we transfected HEK 293 cells with hemagglutinin (HA) tagged proteins containing the first 212 amino acids of human huntingtin with various sizes of glutamine repeat (23Q-, 44Q-, 49Q-, 66Q-, 73Q-, 120Q- and 150Q-HA) (Fig. 1a). On the corresponding western blot probed with anti-huntingtin antibody each sample shows a huntingtin-immunoreactive band of the expected monomeric size (Fig. 1b). Additional high molecular weight bands at the top of the gel are seen in samples containing 73Q-HA, 120Q-HA and 150Q-HA. These bands are absent in those samples with repeat lengths of 23, 44 or 49 units (Fig. 1b) and in the sample with a repeat length of 66 units (data not shown). The protein product of the first exon of the HD gene encoding 150 glutamine repeats and 67 amino acids of human huntingtin (150Q-Exon1) also produced these high molecular weight bands (Fig. 1b). Scherzinger et al. showed that these high molecular weight bands are insoluble protein aggregates formed by proteolytic products of exon 1 containing expanded polyglutamines (18). Because we also observe these aggregates on a western blot probed with anti-HA antibody (12CA5) that detected the HA epitope in the C-terminus of the transfected proteins, we know that the entire first 212 amino acids of huntingtin were included in the aggregates (Fig. 1b). 150Q-Exon1 that lacks the HA epitope was not labeled by 12CA5. Quantitative assessment of the amounts of these aggregates revealed that 58% of 150Q-HA, 25% of 120Q-HA and 12% of 73Q-HA respectively formed aggregates (Fig. 1c). Only 22% of 150Q-Exon1 formed aggregates. These results suggest that the length of the repeat and its flanking sequences within the first 212 amino acids can promote formation of protein aggregates.


Figure 1. Western blot analysis of huntingtin aggregates. (a) Schematic structures of the expressed proteins containing 23-150 glutamines (Q) and 212 amino acids of N-terminal human huntingtin. The HA epitope was tagged to the C-terminus of the expressed huntingtin. 150Q-Exon1 contains 150 glutamine repeats and the 67 amino acids encoded by the first exon of the human HD gene. The numbers above each box represent the position of the amino acids. The striated areas represent polyglutamines. (b) Western blot analysis of expressed huntingtins (23Q-, 44Q-, 49Q-, 73Q-, 120Q-, 150Q-HA or 150Q-Exon1) in HEK 293 cells with anti-huntingtin and anti-HA (12CA5) antibodies. An arrow indicates high molecular weight insoluble aggregates at the origin of electrophoresis. The expressed 66Q-HA did not produce significant aggregates (data not shown). (c) Quantitative assessment by densitometry of aggregates formed by the expressed huntingtins. Data were obtained from three experiments and are given as percent of amounts of respective non-aggregated huntingtins. The control is non-transfected cells.

Protein aggregation occurred only with N-terminal huntingtin. Expanded full-length huntingtin with either 44 or 150 glutamine repeats did not show any aggregates on a western blot (Fig. 2a). Furthermore, autoradiography did not reveal any protein aggregates formed by in vitro translated N-terminal huntingtin containing 120 or 150 glutamine repeats (Fig. 2b). Formation of N-terminal huntingtin aggregates may require intracellular modification or the presence of other protein(s). As the concentration of in vitro translated proteins might be lower than that of transfected proteins in cultured cells, the concentration of synthesized huntingtin could also affect the formation of huntingtin aggregates in vitro.


Figure 2. (a) Western blot analysis of transfected huntingtin in HEK 293 cells by 5% SDS-PAGE. 44Q-full and 150Q-full are full-length huntingtins carrying 44 and 150 glutamine repeats respectively. These expressed proteins migrated more slowly than endogenous huntingtin. Unlike 150Q-HA, full-length huntingtin did not form aggregates. (b) Autoradiograph of in vitro synthesized proteins showing that N-terminal huntingtin did not form aggregates. Arrows indicate the origin of electrophoresis. The control is non-transfected cells. Scale bars 10 µm.

The aggregates of another glutamine repeat protein, ataxin-3, were found to form spherical structures in the intranuclear and perinuclear region in HEK 293 cells (20). Similarly, we observed that cells expressing N-terminal huntingtin containing >66 glutamine repeats displayed ovoid or spherical structures. These structures were 0.5-2 µm in diameter, occurred at a rate of 1-2 per cell and were intensely labeled by anti-huntingtin antibody (Fig. 3a). Full-length huntingtin with expanded repeats (44 or 150) or N-terminal huntingtin with 49 repeats or less did not produce these spherical structures. The surface of these structures were more intensely labeled by the anti-huntingtin antibody than the internal region, perhaps because the antibody had difficulty penetrating the structures. We also expressed huntingtin in PC12 cells, a rat neuroendocrine cell line. 73Q-HA or 150Q-HA (data not shown), but not 49Q-HA, formed huntingtin aggregates in PC12 cells as well (Fig. 3b).


Figure 3. Subcellular localization of huntingtin aggregates in transfected cells. (a) Immunofluorescent staining of HEK 293 cells transfected with full-length huntingtin (23Q-, 44Q- or 150Q-full), HA tagged N-terminal huntingtin (23Q-, 49Q-, 66Q-, 73Q- or 150Q-HA) or 150Q-Exon1. Huntingtin with repeat lengths [ge]66 produced huntingtin-immunoreactive spherical structures in the cytoplasmic and perinuclear regions (arrows). Intranuclear huntingtin aggregates (arrowhead) were also seen in some cells. (b) Transfected PC12 cells containing 73Q-HA, but not 49Q-HA, also produced huntingtin aggregates. (c) Quantitative measurement of transfected HEK 293 cells that had perinuclear/cytoplasmic or intranuclear aggregates. Data are presented as percent of transfected cells (80-150 cells for each sample). Scale bars 10 µm.

Most spherical aggregates were located in the perinuclear or cytoplasmic regions of transfected cells and a few aggregates of smaller size were located in the nucleus. In addition, some cells with spherical aggregates also had distinct punctate structures in the cytoplasm. Quantitative assessment showed that 61% of cells transfected with 150Q-HA displayed spherical aggregates in the perinuclear region, while 46, 15, 4and 38% of cells transfected with 120Q-HA, 73Q-HA, 66Q-HA and 150Q-Exon1 respectively had these aggregates (Fig. 3c). Although we did not observe aggregates in the 66Q-HA sample on the western blot, we found that ~4% of cells transfected with 66Q-HA had spherical structures. Therefore, the likelihood that a cell will form intracellular huntingtin aggregates is proportional to the length of the glutamine repeat.

In addition to the aggregates seen in the perinuclear region, some transfected cells had aggregates in the nucleus itself. Cells having these intranuclear aggregates were <7% of transfected cells, but cells expressing 150Q-HA produced more such aggregates than those expressing 120Q-HA or 150Q-Exon1 (Fig. 3c). Other studies have found that intranuclear huntingtin aggregates in the brain were ubiquitinated (15,16). We found that anti-ubiquitin antibody did not label huntingtin aggregates in transfected cells (data not shown). Differences between protein modification in transfected cells and in the brain may account for this difference.

We wanted to verify that the entire first 212 amino acids of huntingtin were present in the spherical structures. Consistent with the western blot results, the spherical structures in the cells were labeled identically by both the anti-HA and anti-huntingtin antibodies (Fig. 4). Also, despite the fact that 150Q-Exon1 lacks the HA epitope and 145 amino acids found in 150Q-HA, both mutated proteins induced nearly identical aggregates in the cells.


Figure 4. Double labeling of HEK 293 cells transfected with (a-c) 150Q-HA or (d-f) 150Q-Exon1. The 212 amino acids of 150Q-HA and the glutamine repeat were included in spherical structures (arrows) which were labeled by both (a) anti-huntingtin and (b) anti-HA antibodies. 150Q-Exon1 does not contain the HA-epitope and was only labeled by (d) anti-huntingtin, but not (e) anti-HA antibody. (c and f) Hoechst dye (Molecular Probes) staining of the nuclei of transfected cells indicates that aggregates were located in both the cytoplasm and the nucleus. Scale bars 10 µm.

DISCUSSION

These results support the hypothesis that expanded glutamine repeats may homodimerize (14) or heterodimerize (22) to produce poorly soluble protein aggregates. Since full-length huntingtin with the expanded repeat did not induce aggregates, our results substantiate the finding that short proteolytic products containing an expanded glutamine repeat can form aggregates (18). However, we observed that huntingtin which contains the first 212 amino acids of the N-terminus can also form protein aggregates. Goldberg et al. found that an N-terminal 80 kDa huntingtin fragment is cleaved from full-length huntingtin by apopain, a cysteine protease (21). Thus it is possible that natural proteolysis in the cells of HD patients may allow mutated huntingtin to form in vivo the aggregates which we and others have documented in vitro. Since longer huntingtin fragments interact with other cellular proteins or molecules (23-28), it will be interesting to determine how many more amino acids of huntingtin can be included in the protein aggregates and to see whether aggregates interact with other proteins or cellular components.

Transient expression of mutated N-terminal huntingtin produced numerous cytoplasmic protein aggregates and some intranuclear aggregates. This observation favors the idea that the intranuclear aggregates or inclusions seen in transgenic mice and HD patients represent a process and/or final consequence induced by the mutation in huntingtin. The most interesting finding in the present study is that formation of the protein aggregates is induced by glutamine repeats [ge]66 units but not by repeats [le]49 units in transient transfected cells. Huntingtin aggregate formation induced by intermediate repeats between 43 and 49 glutamines may be time dependent or involve other cellular factors. This is because intranuclear huntingtin aggregates were often seen in juvenile patients with 65 glutamine repeats whereas extracellular huntingtin aggregates were mainly found in adult patients with 42 glutamine repeats (16). Nevertheless, our study shows that aggregation of N-terminal huntingtin is significantly correlated with repeat length >66 units. Since different N-terminal huntingtin fragments (amino acids 1-67 and 1-212) form intracellular aggregates when the glutamine repeat is expanded, our study also suggests that various N-terminal fragments of mutant huntingtin may be involved in huntingtin aggregates in brain.

MATERIALS AND METHODS

Expression constructs and transfection

The expression vector pCIS containing either full-length or the N-terminus of huntingtin was used for transfection of human embryonic (HEK) 293 cells or PC12 cells. The human huntingtin cDNA containing 150 CAG repeats was isolated from a [lambda] phage DNA which contains the first exon of an expanded huntingtin and was provided by Dr Gillian Bates (29). This cDNA fragment was digested with NcoI and Sau961 and the released fragment encoding the glutamine repeat was used to substitute for the normal repeat region in pCIS-huntingtin constructs (23). An HA epitope was tagged to the C-terminus of the expressed protein. The plasmid construct was then propagated in bacteria XL-1 blue MRF[prime]. Due to instability of the CAG repeat in bacteria we were able to produce constructs containing 49, 66, 73, 120 and 150 CAG/glutamine repeats. CAG repeats <90 in these constructs were determined by DNA sequencing using antisense primer GHD3[prime]-1 (aaactcacggtcggtgcagcggctcctcag). The size of the CAG repeat in [lambda] phage DNA was determined previously (29). The size of the CAG repeats within the plasmid clones (HD-120Q and HD-150Q) was determined by double digestion with NcoI and DdeI and [32P]dCTP end-labeling of one strand at the NcoI site. Labeled fragments were separated on a 6% denaturing polyacrylamide gel and sized against an M13 sequencing ladder and the HD-73Q fragment. The N-terminal region of huntingtin containing 150 glutamine repeats was also used to replace the corresponding repeat region in full-length human huntingtin using BamHI and XhoI sites. Huntingtin constructs containing 23 or 44 glutamine repeats were obtained previously (23). Subconfluent 293 or PC12 cells grown in 2-well chamber slides (Nalge Nunc) were transfected with huntingtin cDNAs using LipofectAMINE (Gibco BRL). Twenty-four hours after transfection the cells were used for western blot and immunofluorescence analysis.

Antibodies and western blot analysis

A truncated human huntingtin cDNA that encodes the first 256 amino acids with two glutamines in the repeat was obtained by RT-PCR. This cDNA was inserted into the pGEX vector to generate a GST fusion protein. The GST fusion protein purified from bacteria BL21 was used as the immunogen for Covance Inc. to produce rabbit antiserum. The antiserum (EM48) was affinity purified by incubating with a nitrocellulose strip containing transferred GST-huntingtin. Antibodies bound to the strip were then eluted with 0.2 mM Tris-glycine, pH 2.8, and neutralized with 1 M Tris-HCl, pH 8. Transfected cells were solubilized in SDS sample buffer. Equal amounts of lysate proteins (70 µg) were resolved by 8 or 5% SDS-PAGE. Blots were incubated with rabbit antibodies to huntingtin (1:500) or mouse monoclonal antibody 12CA5 (1:400 dilution; Boehringer Mannheim) to the HA epitope. Immunoreactive bands were visualized by chemiluminescence (Amersham). Pre-absorption of the antibody with immunogen was able to eliminate immunoreactivity.

Immunofluorescence labeling

Transfected cells were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS), permeabilized with 0.4% Triton X-100, blocked with 5% normal goat serum in PBS and then incubated with primary antibodies and secondary antibodies conjugated with either FITC or rhodamine (Jackson Immunoresearch Laboratories). Huntingtin aggregates were readily recognized as large spherical structures (0.5-2 µm) intensely labeled by anti-huntingtin antibodies. Double labeling was performed with mouse antibody 12CA5 to HA-tagged proteins and the respective rabbit antibodies to huntingtin or ubiquitin (Dako). On average 80-150 cells transfected with huntingtin were randomly selected per experimental sample to count the spherical aggregates in the cells. A fluorescence microscope (Zeiss) and video system (Optronics DEI-470) were used to capture images. The captured images were stored and processed using Adobe Photoshop v.2.51 software. Color images were converted into black and white versions that were then printed on a Codonics color printer.

ACKNOWLEDGEMENTS

We are grateful to Dr Gillian Bates for providing [lambda] phage DNAs containing exon 1 of the HD gene with 20 or 150 CAG repeats. This work was supported by the Hereditary Disease Foundation, the Wills Foundation and National Institutes of Health grant NS36232.

REFERENCES

1. HD Collaborative Research Group (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell, 72, 971-983.

2. Imbert, G., Saudou, F., Yvert, G., Devys, D., Trottier, Y., Garnier, J.M., Weber, C., Mandel, J.L., Cancel, G., Abbas, N., Durr, A., Didierjean, O., Stevanin, G., Agid, Y. and Brice, A. (1996) Cloning of the gene for spinocerebellar ataxia 2 reveals a locus with high sensitivity to expanded CAG/glutamine repeats. Nature Genet., 14, 285-291. MEDLINE Abstract

3. Koide, R. et al). (1994) Unstable expansion of CAG repeat in hereditary dentatorubral-pallidoluysian atrophy (DRPLA). Nature Genet., 6, 9-13. MEDLINE Abstract

4. La Spada, A.R., Wilson, E.M., Lubahn, D.B., Harding, A.E. and Fischbeck, K.H. (1991) Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature, 352, 77-79. MEDLINE Abstract

5. Nagafuchi, S. et al). (1994) Dentatorubral and pallidoluysian atrophy expansion of an unstable CAG trinucleotide on chromosome 12p. Nature Genet., 6, 14-18. MEDLINE Abstract

6. Orr, H.T., Chung, M.Y., Banfi, S., Kwiatkowski, T.J. Jr, Servadio, A., Beaudet, A.L., McCall, A.E., Duvick, L.A., Ranum, L.P. and Zoghbi, H.Y. (1993) Expansion of an unstable trinucleotide CAG repeat in spinocerebellar ataxia type 1. Nature Genet., 4, 221-226. MEDLINE Abstract

7. Pulst, S.M., Nechiporuk, A., Nechiporuk, T., Gispert, S., Chen, X.N., Lopes-Cendes, I., Pearlman, S., Starkman, S., Orozco-Diaz, G., Lunkes, A., DeJong, P., Rouleau, G.A., Auburger, G., Korenberg, J.R., Figueroa, C. and Sahba, S. (1996) Moderate expansion of a normally biallelic trinucleotide repeat in spinocerebellar ataxia type 2. Nature Genet., 14, 269-276. MEDLINE Abstract

8. Sanpei, K., Takano, H., Igarashi, S., Sato, T., Oyake, M., Sasaki, H., Wakisaka, A., Tashiro, K., Ishida, Y., Ikeuchi, T., Koide, R., Saito, M., Sato, A., Tanaka, T., Hanyu, S., Takiyama, Y., Nishizawa, M., Shimizu, N., Nomura, Y., Segawa, M., Iwabuchi, K., Eguchi, I., Tanaka, H., Takahashi, H. and Tsuji, S. (1996) Identification of the spinocerebellar ataxia type 2 gene using a direct identification of repeat expansion and cloning technique, DIRECT. Nature Genet., 14, 277-284. MEDLINE Abstract

9. Davies, S.W., Turmaine, M., Cozens, B.A., DiFiglia, M., Sharp, A.H., Ross, C.A., Scherzinger, E., Wanker, E.E., Mangiarini, L. and Bates, G.P. (1997) Formation of neuronal intranuclear inclusions underlies the neurological dysfunction in mice transgenic for the HD mutation. Cell, 90, 537-548. MEDLINE Abstract

10. MacDonald, M.E. and Gusella, J.F. (1996) Huntington's disease: translating a CAG repeat into a pathogenic mechanism. Curr. Opin. Neurobiol., 6, 638-643. MEDLINE Abstract

11. Andrew, S.E. et al). (1993) The relationship between trinucleotide (CAG) repeat length and clinical features of Huntington's disease. Nature Genet., 4, 398-403. MEDLINE Abstract

12. Duyao, M. et al). (1993) Trinucleotide repeat length instability and age of onset in Huntington's disease. Nature Genet., 4, 387-392. MEDLINE Abstract

13. Stine, O.C., Pleasant, N., Franz, M.L., Abbott, M.H., Folstein, S.E. and Ross, C.A. (1993) Correlation between the onset age of Huntington's disease and length of the trinucleotide repeat in IT-15. Hum. Mol. Genet., 2, 1547-1549. MEDLINE Abstract

14. Perutz, M.F., Johnson, T., Suzuki, M. and Finch, J.T. (1994) Glutamine repeats as polar zippers: their possible role in inherited neurodegenerative diseases. Proc. Natl Acad. Sci. USA, 91, 5355-5358. MEDLINE Abstract

15. Davies, S.W., Turmaine, M., Cozens, B.A., DiFiglia, M., Sharp, A.H., Ross, C.A., Scherzinger, E., Wanker, E.E., Mangiarini, L. and Bates, G.P. (1997) Formation of neuronal intranuclear inclusions underlies the neurological dysfunction in mice transgenic for the HD mutation. Cell, 90, 537-548. MEDLINE Abstract

16. DiFiglia, M., Sapp, E., Chase, K.O., Davies, S.W., Bates, G.P., Vonsattel, J.P. and Aronin, N. (1997) Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic neurites in brain. Science, 277, 1990-1993. MEDLINE Abstract

17. White, J.K., Auerbach, W., Duyao, M.P., Vonsattel, J.P., Gusella, J.F., Joyner, A.L. and MacDonald, M.E. (1997) Huntingtin is required for neurogenesis and is not impaired by the Huntington's disease CAG expansion. Nature Genet., 17, 404-410. MEDLINE Abstract

18. Scherzinger, E., Lurz, R., Turmaine, M., Mangiarini, L., Hollenbach, B., Hasenbank, R., Bates, G.P., Davies, S.W., Lehrach, H. and Wanker, E.E. (1997) Huntingtin-encoded polyglutamine expansions form amyloid-like protein aggregates in vitro and in vivo. Cell, 90, 549-558. MEDLINE Abstract

19. Ikeda, H., Yamaguchi, M., Sugai, S., Aze, Y., Narumiya, S. and Kakizuka, A. (1996) Expanded polyglutamine in the Machado-Joseph disease protein induces cell death in vitro and in vivo. Nature Genet., 13, 196-202. MEDLINE Abstract

20. Paulson, H.L., Perez, M.K., Trottier, Y., Trojanowski, J.Q., Subramony, S.H., Das, S.S., Vig, P., Mandel, J.L., Fischbeck, K.H. and Pittman, R.N. (1997) Intranuclear inclusions of expanded polyglutamine protein in spinocerebellar ataxia type 3. Neuron, 19, 333-344. MEDLINE Abstract

21. Goldberg, Y.P., Nicholson, D.W., Rasper, D.M., Kalchman, M.A., Koide, H.B., Graham, R.K., Bromm, M., Kazemi-Esfarjani, P., Thornberry, N.A., Vaillancourt, J.P. and Hayden, M.R. (1996) Cleavage of huntingtin by apopain, a proapoptotic cysteine protease, is modulated by the polyglutamine tract. Nature Genet., 13, 442-449. MEDLINE Abstract

22. Kahlem, P., Terre, C., Green, H. and Djian, P. (1996) Peptides containing glutamine repeats as substrates for transglutaminase-catalyzed cross-linking: relevance to diseases of the nervous system. Proc. Natl Acad. Sci. USA, 93, 14580-14585. MEDLINE Abstract

23. Li, X.J., Li, S.H., Sharp, A.H., Nucifora, F.C. Jr, Schilling, G., Lanahan, A., Worley, P., Snyder, S.H. and Ross, C.A. (1995) A huntingtin-associated protein enriched in brain with implications for pathology. Nature, 378, 398-402. MEDLINE Abstract

24. Burke, J.R., Enghild, J.J., Martin, M.E., Jou, Y.S., Myers, R.M., Roses, A.D., Vance, J.M. and Strittmatter, W.J. (1996) Huntingtin and DRPLA proteins selectively interact with the enzyme GAPDH [see comments]. Nature Med., 2, 347-350.

25. Kalchman, M.A., Graham, R.K., Xia, G., Koide, H.B., Hodgson, J.G., Graham, K.C., Goldberg, Y.P., Gietz, R.D., Pickart, C.M. and Hayden, M.R. (1996) Huntingtin is ubiquitinated and interacts with a specific ubiquitin-conjugating enzyme. J. Biol. Chem., 271, 19385-19394. MEDLINE Abstract

26. Kalchman, M.A., Koide, H.B., McCutcheon, K., Graham, R.K., Nichol, K., Nishiyama, K., Kazemi-Esfarjani, P., Lynn, F.C., Wellington, C., Metzler, M., Goldberg, Y.P., Kanazawa, I., Gietz, R.D. and Hayden, M.R. (1997) HIP1, a human homologue of S. cerevisiae Sla2p, interacts with membrane-associated huntingtin in the brain. Nature Genet., 16, 44-53. MEDLINE Abstract

27. Wanker, E.E., Rovira, C., Scherzinger, E., Hasenbank, R., Walter, S., Tait, D., Colicelli, J. and Lehrach, H. (1997) HIP-I: a huntingtin interacting protein isolated by the yeast two-hybrid system. Hum. Mol. Genet., 6, 487-495. MEDLINE Abstract

28. Li, S.-H., Gutekunst, C.A., Hersch, S.M. and Li, X.-J. (1998) Interaction of huntingtin associated protein with dynactin p150Glued. J. Neurosci., 18, 1261-1269. MEDLINE Abstract

29. Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., Hetherington, C., Lawton, M., Trottier, Y., Lehrach, H., Davies, S.W. and Bates, G.P. (1996) Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell, 87, 493-506. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: + 1 404 727 3290; Fax: +1 404 727 3949; Email: xiaoli@genetics.emory.edu


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 4 Apr 1998
Copyright© Oxford University Press, 1998.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. L. Orr, S. Huang, M. A. Roberts, J. C. Reed, S. Li, and X.-J. Li
Sex-dependent Effect of BAG1 in Ameliorating Motor Deficits of Huntington Disease Transgenic Mice
J. Biol. Chem., June 6, 2008; 283(23): 16027 - 16036.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. A. McLear, D. Lebrecht, A. Messer, and W. J. Wolfgang
Combinational approach of intrabody with enhanced Hsp70 expression addresses multiple pathologies in a fly model of Huntington's disease
FASEB J, June 1, 2008; 22(6): 2003 - 2011.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. L. Orr, S. Li, C.-E. Wang, H. Li, J. Wang, J. Rong, X. Xu, P. G. Mastroberardino, J. T. Greenamyre, and X.-J. Li
N-Terminal Mutant Huntingtin Associates with Mitochondria and Impairs Mitochondrial Trafficking
J. Neurosci., March 12, 2008; 28(11): 2783 - 2792.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Fukui and C. T. Moraes
Extended polyglutamine repeats trigger a feedback loop involving the mitochondrial complex III, the proteasome and huntingtin aggregates
Hum. Mol. Genet., April 1, 2007; 16(7): 783 - 797.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. P. Nguyen, P. Kobbe, H. Rahne, T. Worpel, B. Jager, M. Stephan, R. Pabst, C. Holzmann, O. Riess, H. Korr, et al.
Behavioral abnormalities precede neuropathological markers in rats transgenic for Huntington's disease
Hum. Mol. Genet., November 1, 2006; 15(21): 3177 - 3194.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
T. W. Sedlak and S. H. Snyder
Messenger Molecules and Cell Death: Therapeutic Implications
JAMA, January 4, 2006; 295(1): 81 - 89.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Mukai, T. Isagawa, E. Goyama, S. Tanaka, N. F. Bence, A. Tamura, Y. Ono, and R. R. Kopito
Formation of morphologically similar globular aggregates from diverse aggregation-prone proteins in mammalian cells
PNAS, August 2, 2005; 102(31): 10887 - 10892.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
C. M. Everett and N. W. Wood
Trinucleotide repeats and neurodegenerative disease
Brain, November 1, 2004; 127(11): 2385 - 2405.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
D. G. Hay, K. Sathasivam, S. Tobaben, B. Stahl, M. Marber, R. Mestril, A. Mahal, D. L. Smith, B. Woodman, and G. P. Bates
Progressive decrease in chaperone protein levels in a mouse model of Huntington's disease and induction of stress proteins as a therapeutic approach
Hum. Mol. Genet., July 1, 2004; 13(13): 1389 - 1405.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
T. Okuda, H. Hattori, S. Takeuchi, J. Shimizu, H. Ueda, J. J. Palvimo, I. Kanazawa, H. Kawano, M. Nakagawa, and H. Okazawa
PQBP-1 transgenic mice show a late-onset motor neuron disease-like phenotype
Hum. Mol. Genet., April 1, 2003; 12(7): 711 - 725.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. Dedeoglu, J. K. Kubilus, T. M. Jeitner, S. A. Matson, M. Bogdanov, N. W. Kowall, W. R. Matson, A. J. L. Cooper, R. R. Ratan, M. F. Beal, et al.
Therapeutic Effects of Cystamine in a Murine Model of Huntington's Disease
J. Neurosci., October 15, 2002; 22(20): 8942 - 8950.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
A. W. Dunah, H. Jeong, A. Griffin, Y.-M. Kim, D. G. Standaert, S. M. Hersch, M. M. Mouradian, A. B. Young, N. Tanese, and D. Krainc
Sp1 and TAFII130 Transcriptional Activity Disrupted in Early Huntington's Disease
Science, June 21, 2002; 296(5576): 2238 - 2243.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. Gafni and L. M. Ellerby
Calpain Activation in Huntington's Disease
J. Neurosci., June 15, 2002; 22(12): 4842 - 4849.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-Z. Chuang, H. Zhou, M. Zhu, S.-H. Li, X.-J. Li, and C.-H. Sung
Characterization of a Brain-enriched Chaperone, MRJ, That Inhibits Huntingtin Aggregation and Toxicity Independently
J. Biol. Chem., May 24, 2002; 277(22): 19831 - 19838.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Khoshnan, J. Ko, and P. H. Patterson
Effects of intracellular expression of anti-huntingtin antibodies of various specificities on mutant huntingtin aggregation and toxicity
PNAS, January 22, 2002; 99(2): 1002 - 1007.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. Sathasivam, B. Woodman, A. Mahal, F. Bertaux, E. E. Wanker, D. T. Shima, and G. P. Bates
Centrosome disorganization in fibroblast cultures derived from R6/2 Huntington's disease (HD) transgenic mice and HD patients
Hum. Mol. Genet., October 1, 2001; 10(21): 2425 - 2435.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Petersen, K. E. Larsen, G. G. Behr, N. Romero, S. Przedborski, P. Brundin, and D. Sulzer
Expanded CAG repeats in exon 1 of the Huntington's disease gene stimulate dopamine-mediated striatal neuron autophagy and degeneration
Hum. Mol. Genet., June 1, 2001; 10(12): 1243 - 1254.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. B. Freeman, F. Cicchetti, R. A. Hauser, T. W. Deacon, X.-J. Li, S. M. Hersch, G. M. Nauert, P. R. Sanberg, J. H. Kordower, S. Saporta, et al.
Transplanted fetal striatum in Huntington's disease: Phenotypic development and lack of pathology
PNAS, December 5, 2000; 97(25): 13877 - 13882.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
G. Cancel, C. Duyckaerts, M. Holmberg, C. Zander, G. Yvert, A.-S. Lebre, M. Ruberg, B. Faucheux, Y. Agid, E. Hirsch, et al.
Distribution of ataxin-7 in normal human brain and retina
Brain, December 1, 2000; 123(12): 2519 - 2530.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. Restituito, R. M. Thompson, J. Eliet, R. S. Raike, M. Riedl, P. Charnet, and C. M. Gomez
The Polyglutamine Expansion in Spinocerebellar Ataxia Type 6 Causes a beta Subunit-Specific Enhanced Activation of P/Q-Type Calcium Channels in Xenopus Oocytes
J. Neurosci., September 1, 2000; 20(17): 6394 - 6403.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Shibata, D. P. Huynh, and S.-M. Pulst
A novel protein with RNA-binding motifs interacts with ataxin-2
Hum. Mol. Genet., May 22, 2000; 9(9): 1303 - 1313.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Kazantsev, E. Preisinger, A. Dranovsky, D. Goldgaber, and D. Housman
Insoluble detergent-resistant aggregates form between pathological and nonpathological lengths of polyglutamine in mammalian cells
PNAS, September 28, 1999; 96(20): 11404 - 11409.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Li, S.-H. Li, A. L. Cheng, L. Mangiarini, G. P. Bates, and X.-J. Li
Ultrastructural localization and progressive formation of neuropil aggregates in Huntington's disease transgenic mice
Hum. Mol. Genet., July 1, 1999; 8(7): 1227 - 1236.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S.-H. Li, A. L. Cheng, H. Li, and X.-J. Li
Cellular Defects and Altered Gene Expression in PC12 Cells Stably Expressing Mutant Huntingtin
J. Neurosci., July 1, 1999; 19(13): 5159 - 5172.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
C.-A. Gutekunst, S.-H. Li, H. Yi, J. S. Mulroy, S. Kuemmerle, R. Jones, D. Rye, R. J. Ferrante, S. M. Hersch, and X.-J. Li
Nuclear and Neuropil Aggregates in Huntington's Disease: Relationship to Neuropathology
J. Neurosci., April 1, 1999; 19(7): 2522 - 2534.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. W. Faber, J. R. Alter, M. E. MacDonald, and A. C. Hart
Polyglutamine-mediated dysfunction and apoptotic death of a Caenorhabditis elegans sensory neuron
PNAS, January 5, 1999; 96(1): 179 - 184.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
C.-A. Gutekunst, S.-H. Li, H. Yi, R. J. Ferrante, X.-J. Li, and S. M. Hersch
The Cellular and Subcellular Localization of Huntingtin-Associated Protein 1 (HAP1): Comparison with Huntingtin in Rat and Human
J. Neurosci., October 1, 1998; 18(19): 7674 - 7686.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. S. Hackam, A. S. Yassa, R. Singaraja, M. Metzler, C.-A. Gutekunst, L. Gan, S. Warby, C. L. Wellington, J. Vaillancourt, N. Chen, et al.
Huntingtin Interacting Protein 1 Induces Apoptosis via a Novel Caspase-dependent Death Effector Domain
J. Biol. Chem., December 22, 2000; 275(52): 41299 - 41308.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Khoshnan, J. Ko, and P. H. Patterson
Effects of intracellular expression of anti-huntingtin antibodies of various specificities on mutant huntingtin aggregation and toxicity
PNAS, January 22, 2002; 99(2): 1002 - 1007.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (85)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Li, S. H.
Right arrow Articles by Li, X. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, S. H.
Right arrow Articles by Li, X. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?