| Human Molecular Genetics | Pages |
Mutations of the flavin-containing monooxygenase gene (FMO3) cause trimethylaminuria, a defect in detoxication
Introduction
Results
Clinical characterization of patient cohort
Genomic organization of FMO3
Missense and nonsense mutations in FMO3
Haplotype analysis
Subcloning and cDNA expression of human FMO3 and variant fusion proteins
Physiological and clinical aspects
Discussion
Materials And Methods
Subjects
TMA and TMANO analysis
SSCP analysis, DNA sequencing and confirmation of mutations
Site-directed mutagenesis and expression of the substitutions as fusions with MBP
Electrophoresis and immunoblotting
Enzyme assays
Acknowledgements
Abbreviations
References
Mutations of the flavin-containing monooxygenase gene (FMO3) cause trimethylaminuria, a defect in detoxication
Individuals with the recessive condition trimethylaminuria exhibit variation in metabolic detoxication of xenobiotics by hepatic flavin-containing monooxygenases. We show here that mutations in the human flavin-containing monooxygenase isoform 3 gene (FMO3) impair N-oxygenation of xenobiotics and are responsible for the trimethylaminuria phenotype. Three disease-causing mutations in nine Australian-born probands have been identified which share a particular polymorphic haplotype. Nonsense and missense mutations are associated with a severe phenotype and are also implicated in impaired metabolism of other nitrogen- and sulfur-containing substrates including biogenic amines, both clinically and when mutated proteins expressed from cDNA are studied in vitro. These findings illustrate the critical role played by human FMO3 in the metabolism of xenobiotic substrates and endogenous amines.
INTRODUCTION
Humans are increasingly exposed to various foreign chemicals (xenobiotics) in the environment, including drugs, food additives and pollutants. Detoxication of xenobiotics is mediated by phase I (oxidation) reactions, catalyzed by monooxygenases and phase II (conjugation) reactions to increase the water solubility of the compounds facilitating excretion. It was believed previously that NADPH-dependent oxidation of many nitrogen-, sulfur- and phosphorus-containing foreign compounds was mediated by the microsomal cytochrome P450 (CYP) family of monooxygenases. It is now recognized that flavin-containing monooxygenases (FMOs) catalyze oxygenation of many of these nucleophilic chemicals including endogenous amines. Known substrates for FMO include trimethylamine (TMA), the tertiary amine (S)-nicotine and commonly used drugs such as the tricyclic antipsychotics, cimetidine, ranitidine and verapamil (1,2).
Individuals with trimethylaminuria (TMAuria) have diminished capacity to oxidize the dietary-derived amine TMA to its odorless metabolite TMA N-oxide (TMANO) and thus excrete relatively large amounts of TMA in their urine, sweat and breath. Humans generally convert TMA to TMANO with a ratio of TMANO to TMA >95:5 (3) or excrete <18 µmol of total TMA/µmol of creatinine under normal dietary conditions (4). Individuals with this affliction have been described as having `fish odor syndrome' as a consequence of the fish-like odor of the amine, TMA. Patients affected with TMAuria are reported to have psychosocial consequences related to this disorder. Anxiety, low self-esteem, clinical depression and addiction to drugs are also reported (5). First described in 1970 (6), TMAuria is proposed to be an autosomal recessive inborn error of metabolism (3,7,8). The condition is thought to be uncommon, although it is distributed non-randomly in specific populations. It is well documented for example in the UK (8). It may be more prevalent than suspected, as 35% of a sample of patients referred for malodor in a North American clinic had TMAuria (9).
A family of FMO monooxygenases has now been described with differing tissue expression and regulation. The flavin-containing monooxygenases (EC.1.14.13) appear to have arisen from one ancestral gene family with at least five different mammalian types (FMO 1-5) sharing a minimum of 52% amino acid sequence identity (10,11). Human FMOs have been identified of 532-558 amino acids in length. Specific amino acid residues are conserved in all species (in particular, residues 4-32 and 186-213) containing highly conserved FAD- and NADPH-binding domains, respectively. In humans, FMO3 is the major catalytic isoform expressed in liver (12-14) although it is present in kidney and, presumably, other tissues. In general, FMO is a membrane-associated enzyme that has been detected in all secretory cell types that have been examined.
We reasoned that the human FMO3 gene was the gene mutated in the inborn error of metabolism, TMAuria. In this report, we describe causative mutations in Australian individuals with TMAuria, including nonsense and missense mutations. We have also evaluated mutations with cDNA expression analyses of the wild-type and variant enzyme. We describe possible origins of the disorder based on defined DNA haplotypes and report on several coding sequence variations with potential metabolic/pharmacogenetic significance. In addition to TMAuria, we suggest that mutation of FMO3 is implicated in abnormal metabolism of many medications of biomedical significance, and endogenous dietary amines.
RESULTS
Clinical characterization of patient cohort
We studied the clinical and biochemical characteristics of nine individuals with TMAuria (Table 1), some of whom have been described previously (4,15). In addition to the fish-like odor characteristic of this disorder, a number of the patients presented with additional symptoms including hypertension, adverse tyramine reactions and depression (possibly reactive to the symptomatology). In addition, one patient manifestated a schizoaffective state. All were born in Australia and are non-consanguineous; the origins of the majority of the grandparents of these probands were the British Isles. Biochemical characterization of these individuals was based on either the TMANO to TMA ratio (normal values >97:3) or the absolute concentration of excreted TMA, (n < 18 µmol/mmol creatinine) (4).
Genomic organization of FMO3
In order to determine the intron-exon boundaries of FMO3, we relied on the published gene structure of rabbit FMO2, where nine exons and eight introns were defined (16). Human FMO3 cDNA primers were selected to amplify introns on the assumption that the junctional sites were conserved across the gene family and across species. After a PCR fragment was obtained, sequencing was performed either directly or from subcloned material to determine the exon-intron boundaries. This strategy enabled the amplification of introns 1 and 4-8, allowing intronic primer sequences to be selected flanking each exon to facilitate mutation analysis. Introns 2 and 3 proved difficult to amplify using this approach. The requisite sequences to facilitate design of intronic primers for these last two regions subsequently were derived from Dolphin et al. (GenBank accession nos U39961 and U39962). Our sequence analysis indicated that FMO3 has nine exons ranging in size from 80 to 705 bp (Fig. 1).
Figure 1. Partial FMO3 gene structure. During the course of this study, PCR fragments bridging introns were generated by placing a 5[prime] primer in one exon, with the 3[prime] primer located in the downstream exon. Exon sizes (bp) are noted above the diagram; approximate intron sizes (kb) are noted below the diagram. To screen probands for mutations at the FMO3 locus, we chose to scan individual exons, together with their flanking junctions using single-stranded conformation polymorphism (SSCP). This permitted detection of coding sequence variations as well as splice junction mutations. Table 2 lists the primers employed for amplification of exons. Variants identified by SSCP were sequenced directly and confirmed where practical, using PCR-based restriction analysis [including artificial creation of restriction site (ACRS)] (17). Figure 2. demonstrates sequencing analysis of the two commonest novel mutations we have detected, E305X and P153L. Figure 3. shows restriction analyses of the V257M and E305X substitutions. Table 1
Missense and nonsense mutations in FMO3
Family
Ancestry
Age at DX (years)
TMAa
TMANO/TMAb
Other symptoms
Genotype
1
English-Irish
15
60.4 ± 11.7
21.9/78.1
P153L\E305X
2
English-Irish
14
19.7 ± 2.8
11.8/88.2
severe hypertensionc, labile hypertension, tyramine reactions
E305X\E305X
3
English
10
149.1 ± 19.2
10.6/89.4
P153L\P153L
4
English-Scottish
20
97.5 ± 10.3
10.4/89.6
urticaria, intolerance of sulfur-containing medication
P153L\P153L
5
English-IrishGerman-Spanish
58
501.2 ± 280.3
NT
moderate hypertensiond,adverse tyramine reactions
P153L\E305X
6
English-Irish
4
40.2 ± 7.8
NT
epsychiatric dysfunction, adverse tyramine reactions
P153L\E305X
7
English-Scottish
18
48.1 ± 7.5
NT
labile hypertension
P153L\E305X
8
English
24
117.3
NT
P153L\P153L
9
Irish
24
48.2 ± 10.5
NT
M661\ ?
Table 2
| Primer name | Exon | Forward primer | Reverse primer | Size (bp) |
| A1 2034 |
1 | AACTTGCCCAGACGGTTGGAC | TTGGTTTCCACCATGTTGGTCAG | 150 |
| 2036 2037 |
2 | GCCAAAGAGCGAAATCAAAATAA | TACACTTCCCAACCTATTTTCCT | 277 |
| 2038 2039 |
3 | GACCTGATCAGTATACTCATTTA | CAGTAGTAGACATAGACTTCTTC | 309 |
| 2027 2031 |
4 | TGCTAGCATAGAAAAGAGGATTC | TCAGTTATGTTCGCTAGCAGCTT | 240 |
| 2017 2013 |
5 | TAGCACATTATTGTGACTGCATC | CCACATTTCATATCACACCTTTC | 328 |
| 2014 2018 |
6 | GGTAATAGATCCATTCCTCAAGA | TTGGTGATTGCTAATACCTTTGA | 402 |
| 2019 2016 |
7 | CCTTATCAATTTATATATGGACC | GGACCTTGTAACTAGGATTATTG | 529 |
| 2029 2040 |
8 | GAATTTGGTGTCTGTCTGAAAAT | CATAAATTCTCACTTTTCTATGG | 260 |
| 2035 X2 |
9 | ATGTTAATTCTCACTGATATAAA | CTGAATAGAAAAGCAGGTGG | 539 |
Table 3
| Location | Substitution |
| Exon 3 | M66I (ATG/ATT) |
| Exon 4 | P153L (CCC/CTC) |
| Exon 4 | E158K (G/A) |
| Intron 4 | IVS4-55 (G/A) |
| Intron 4 | IVS4-22 (G/A) |
| Exon 5 | N245N (AAC/AAT) |
| Exon 5 | V257M (GTG/ATG) |
| Exon 7 | E305X (GAA/TAA) |
| Exon 7 | E308G (GAG/GGG) |
| Exon 7 | S310S (TCG/TCA) |
All substitutions detected in the FMO3 gene in our patients are summarized in Table 3.
| Figure 2. Identification of missense and nonsense mutations. Direct sequence analysis of normal and mutant DNAs. The regions bounding codons 153, 257 and 305 are shown in representative experiments. At codon 153, CCC (proline) is substituted by CTC (lysine); the valine codon at position 257 (GTG) is replaced by methionine (ATG; here the antisense strand is shown). The substitution of a nonsense mutation (TAA) for the glycine (GAA) at position 305 is apparent. The above substitutions occur in homozygous form, while the E308G polymorphism (GGG to GAG) is shown here in heterozygous form. |
|
Figure 3. Restriction analysis of V257M and E305X substitutions. (A) Analysis of the FMO3 exon 6 polymorphism V257M on an 8% polyacrylamide gel. A sense oligo internal to exon 6 was used. The substitution generates an additional NlaIII restriction site. Lanes 1 and 2 show uncut 218 bp PCR product generated from a control and an individual homozygous for V257M, respectively. Lanes 3 and 4 show the NlaIII restriction pattern generated in the same PCR products; the control generates 132 and 86 bp fragments (lane 3) while the V257M individual has an additional cutting site, generating 132, 58 and 28 bp fragments (the latter not seen on this gel). (B) Analysis of the FMO3 exon 7 mutation E305X on 1% agarose gel. The experiment shows the ablation of the sole EcoRI site in the PCR product by the E305X mutation. Lanes 1-3 show the 529 bp uncut PCR products in a control, an E305X heterozygote and an E305X homozygote, respectively. Lanes 4-6 show the EcoRI digestion pattern generated in the same PCR products; the control (lane 4) has 365 and 164 bp fragments, while the E305X heterozygote shows half of the original fragment uncut; the E305X homozygote product shows no cutting by the enzyme (lane 6). Although a number of substitutions were identified in this gene (Table 3), three of these alleles, P153L, E305X and M66I, have been shown to co-segregate with the disease (Table 1). The substitutions E305X and M66I were not observed on testing 40 control chromosomes. P153L was observed on one control chromosome. This proline residue in codon 153 is normally conserved in all mammalian FMO isoforms. Direct sequencing of all exons in subject 3 (homozygous for P153L) and subject 9 (heterozygote for M66I) did not detect any other potentially causative mutations. Thus, the latter may represent a heterozygote who manifests with variable choline intake. Proposita in four kindreds were homozygous for E305X (one individual) or P153L (three individuals). Four individuals were heteroallelic for P153L and E305X. The alleles E305X and P153L thus accounted for 16 of 18 mutant chromosomes. The substitution V257M was observed in five of 40 normal control Australian chromosomes, suggesting that this substitution may represent a prevalent polymorphism. E308G was also observed on three normal chromosomes, indicating that this also probably represents a polymorphism.
Haplotype analysis
We have identified seven polymorphisms, five involving the coding sequence and two intronic (Table 3): E158K; N245N, V257M, E308G and S310S in the coding sequence; and IVS4-55 G->A and IVS4-22G->A in intron 4. We previously have described the distribution of the E158K polymorphism in control Australian and French-Canadian populations, where the two variants are in equilibrium (18).
Using five of these diallelic polymorphisms (Table 4), we now have observed six different haplotypes of a possible 32 haplotypes using the restriction enzyme testing as listed. All probands are homozygous for haplotype 6. This haplotype was not observed in a sample of 20 control Australian chromosomes. In this control group, five haplotypes segregate, haplotypes 1-3 being the most frequent (Table 4). This suggests an original founder chromosome which accumulated the mutations, and `identity by state' for the chromosomes carrying these mutations.
Subcloning and cDNA expression of human FMO3 and variant fusion proteins
To evaluate the effect of the amino acid substitutions, M66I, P153L and V257M, and the protein truncation mutation, E305X, on the function of FMO3, each mutation was introduced into a wild-type FMO3 cDNA fused with the maltose-binding protein (MBP) cDNA in the vector pMAL-2c. These constructs, along with a wild-type MBP-FMO3 construct as control, were overexpressed in Escherichia coli as described previously (19,20). The ability of each purified expressed fusion construct to catalyze, in vitro, the N-oxygenation of three FMO substrates, i.e. the phenothiazine analog 10-[(N,N-dimethylaminopentyl)]- 2-(trifluoromethylphenothiazine) (5-DPT), tyramine and TMA, was assayed. The results (Table 5) show that N-oxygenated products for the substitutions M66I, P153L and E305X were not detectable, confirming that these are disease-causing mutations. The protein truncation-MBP construct E305X showed lack of activity consistent with a deletion of the final 198 amino acid residues of the protein abrogating activity. Deletion of 30 or more residues at the C-terminus has been shown to inactivate the protein (1). Our preliminary data (not shown) indicate that the V257M-substituted FMO3-MBP fusion construct demonstrated wild-type activity for the substrate, TMA.
Both forms of the common amino acid polymorphism at codon 158 were also assayed in the overexpression system; the E158 and K158 human forms demonstrated differences in substrate activities, with the E158 variant demonstrating greater activity toward a number of functional marker substrates, relative to the K158 allele (19,20). Examination of the biochemical and clinical aspects of patients with loss-of-function mutations in vitro revealed that all had markedly diminished TMA N-oxidation capability in vivo (<20% of normal) (Table 1). However, the correlation between absolute TMA oxidation observed in these individuals and genotype may also be influenced by minor alternate routes of TMA oxidation by other FMO isoforms. A number of individuals also manifested hypertension and adverse reactions to tyramine, other amines and specific medications. As is evident from Table 1, the individual homozygous for E305X was most severely affected. Individuals compound heterozygous for E305X and a second mutation also have other manifestations suggestive of disordered biogenic amine metabolism. There may be measurable effects of these mutations in heterozygote carriers; this will require further investigation. Table 4. Table 5Physiological and clinical aspects
Haplotype designation
Polymorphism
g/a158K (HinfI)
g/aIVS4-55(ClaI)
g/aIVS4-22(NlaIII)
c/tN245N(NlaIII)
a/g308G(ApaI)
1
+
-
+
-
-
2
-
-
-
-
-
3
+
-
+
+
-
4
-
+
-
-
-
5
+
-
-
+
-
*6
+
+
-
-
-
cDNA construct
Product formation [nmol/(min/mg of protein)]
5-DPT N-oxide
Trans 4-hydroxy phenethyl oxime
TMANO
E158(g) (wild-type allele)
8.8 ± 0.14
2.7 ± 0.38
4.1 ± 0.02a
K158(a) (variant allele)
4.2 ± 0.23
1.0 ± 0.24
2.6 ± 0.29a
M66I
0
0
0
P153L
0
0
0
E305X
0
0
0
DISCUSSION
The identification and expression of independent mutations that segregate with and are specific for the disorder demonstrates the role of mutations of FMO3 in the pathogenesis of TMAuria and support the previous contention that TMAuria is an autosomal recessive disorder (3).
The mutations described do not affect the FAD- or NADPH-binding domains. It is possible that the proline to leucine substitution in codon 153 causes protein tertiary structural changes that result in abnormal protein folding and an inactive human FMO3 N-oxygenase. For the methionine to isoleucine substitution, codon 66 may constitute a secondary starting point for translation mechanisms, or alteration of the amino acid may cause abnormal protein folding, or subtle interference with the cofactors and produce an inactive human FMO3.
A genotype-phenotype correlation is emerging. Individuals homozygous or compound heterozygotes for the allele E305X appear to manifest a severe phenotype and disorders of biogenic amine metabolism. Lin et al. have shown that FMO3 metabolizes biogenic (primary amines) with oxime formation (21,22). Quantitation of the disposal of catecholamines by this route has not been elaborated. However, we describe patients with severe mutations who also have disorders consistent with abnormal biogenic amine metabolism. This may contribute to the neurochemical effects observed in individuals with TMAuria, including depression and psychoses as well as abnormalities in blood pressure homeostasis and adverse tyramine responses. We cannot, however, discount that the distress that these individuals experience secondary to malodor may play a major role in the development of depressive symptomatology.
In addition to severe mutations causative of TMAuria, we provide evidence that variation of FMO3 may represent pharmacogenetic polymorphisms. Altered substrate activities for the two codon 158 polymorphic alleles have been demonstrated previously. Although the E158 allele is more active for the substrates 5-DPT and TMA, it is slightly less efficient for the metabolism of a sulfide substrate (19). FMO3 may thus be another of the emerging `environmental genes' believed to render certain individuals more susceptible to the effects of pollutants and other environmental chemicals predisposing to carcinogenesis and birth defects (23). It is notable that alleles associated with a number of pharmacogenetic disorders including the CYP-mediated debrisoquine polymorphism can occur in the human population at frequencies approaching 50% (24). Thus, for human FMO3, the prevalence of the codon 158 polymorphic variants may represent another example of `animal plant warfare', a protective mechanism whereby evolutionarily conserved advantageous polymorphisms are prevalent in geographical regions of differing plant toxin exposures (25). Further investigations will be required to address these possibilities.
TMAuria is cited to be common in the British Isles (8). The unrelated patients described herein are generally Australian of British origin. All three TMAuria mutations, M66I, E305X and P153L, appear on a characteristic infrequent haplotype demonstrating `identity by state.' The mutations at codons 66, 153 and 305 do not involve a CpG dinucleotide or CpNpG trinucleotide hypermutable sequences (26). Recurrent mutation is thus unlikely. On the basis of these results, a common origin for the chromosomes carrying these alleles and, by association, a common ancestry for these alleles is suggested as observed at other loci (27). The population and historical migration and founding of Australia is consistent with a British founder effect as previously demonstrated at the phenylalanine hydroxylase locus (28). To support this observation, the mutation P153L has also been observed recently in a British population (29) (the haplotype data are not available). We conclude that: variation of the FMO3 gene not only causes TMAuria in its severe form but possibly other disorders of amine metabolism, `an extreme example of variations of chemical behaviour which are probably everywhere present in minor degrees' (30). Variation of the human FMO3 gene is consequently another manifestation of chemical individuality.
MATERIALS AND METHODS
Subjects
Probands were recruited by ascertainment of affected index cases. Genomic DNA was prepared from Epstein-Barr virus-transformed lymphoblast lines by standard procedures.
TMA and TMANO analysis
For TMA analysis of subjects 1-4, each patient's urine (10.0 ml, previously acidified by acetic acid to pH 3) was placed in a round bottom flask, cooled to 0°C and 0.5 ml of 6.0 M HCl was added at 0°C to stabilize the existing TMA. Triethylamine (TEA) (50.0 µl, 359.4 nmol) was added at 0°C to the sample as an internal standard. The sample was concentrated to dryness in vacuo at a temperature <30°C. The residue was dissolved in 0.5 ml portions of HCl and the solutions were combined. The combined HCl solutions were transferred to a 5.0 ml reactivial, and additional HCl (2.5 M) was added to make a final volume of 2.0 ml. The vials were then capped with a tufbound Teflon silicon septa until the samples were analyzed by gas chromatography (GC). The analysis of TMA for subjects 5-9 was as described (4).
For TMANO, the urine of patients 1-4 (1.0 ml) was placed in a round bottom flask and the sample was concentrated in vacuo at a temperature <30°C. The residue was dissolved in 200 µl of MeOH and thoroughly mixed. Each sample was washed twice.
Samples were alkalinized with 0.8 ml of a solution of 14 M NaOH at -70°C to bring the pH value to ~12. The vials were tightly capped with a tufbound Teflon silicon septa, mixed and heated in a sand-bath at 100-110°C for 1 h. A 3.0-10.0 µl sample of the head space gas was taken using a 10 µl gas-tight syringe and injected onto the GC column. Five injections were made for each determination of TMA. The TMA peak was confirmed by comparison of the retention time and co-elution with that of an authentic TMA sample. The amount of TMA in urine was calculated by measuring the ratio of its peak area to the peak area of the internal TEA based upon the standard curve. The limit of detection was 1.0 nmol/ml of urine. Chromatography of TMA was similar to that described before (31).
The HPLC analysis system for determination of TMANO levels in the urine of patients 1-4 was the same as described below. The external standard curve was constructed using TMANO versus the areas of integration by HPLC integrator (the limit of detection was 2.0 nmol). The samples were injected onto the HPLC column with evaporative light-scattering detection with 5.0-10.0 µl of sample based on the amount of TMANO present. The amount of TMANO was calculated from the standard curve.
SSCP analysis, DNA sequencing and confirmation of mutations
Molecular variants in the gene were identified by SSCP as previously described (17). All primer pairs used for single exons generated products ranging in size from 150 to 705 bp. Fragments >300 bp were cut with restriction enzymes to increase the likelihood of detecting conformational polymorphisms. Native and denatured samples were analyzed using two gel systems [6% acrylamide/10% glycerol/1× TBE, and a polyvinyl matrix, MDE gel (AT Biochem)] according to the manufacturer's instructions at room temperature. PCR fragments with detected mobility changes were sequenced directly (Sequenase kit).
The allele E305X ablated an EcoRI site while P153L was confirmed using an ACRS.
Site-directed mutagenesis and expression of the substitutions as fusions with MBP
Each mutation was cloned individually, confirmed by sequencing and expressed as a fusion protein downstream of MBP. This was accomplished by PCR-based mutagenesis using the vector pMAL-2c and various pGEM intermediates (19). The creation of the M66I and P153L expression plasmids have been documented previously (19,20).
The E305X mutation was created by PCR. The template was pMAL-2c/hFMO3-Glu158 which is the expression plasmid. This FMO3-Glu158 gene was inserted into the pMAL-2c vector (New England Biolabs) as a BamHI-HindIII fragment and was completely sequenced. The forward PCR primer (hFMO3-1) was 5[prime]-ATCATGGATCCATGGGGAAGAAAGTGGCC-3[prime]. This primer contains a BamHI site followed by the ATG. The reverse PCR primer (E305X) was 5[prime]-ACCTAAGCTTACTTCACGTTAGGCTTTACGG-3[prime]. This primer changed the codon following K304 to UAA, an ochre stop codon, which is also part of a HindIII site. The truncated hFMO3-Glu-E305X gene was synthesized using Taq polymerase with standard conditions. The PCR fragment was gel purified, digested with BamHI and HindIII and inserted with DNA ligase into the pMAL-2c vector cut with the same restriction enzymes. The product was transformed into competent JM109 E.coli and plated onto LB-Amp plates. DNA was isolated from colonies and shown by sequencing to contain the E305X sequence. Rather than sequence the entire FMO3-Glu158 gene for the truncation mutant, the mutated portion of the genes was moved into the pMAL-2c/hFMO3-Glu158 vector as a Bsu36I-HindIII fragment and only the new portion of the gene was sequenced.
The full-length wild-type and variant FMO3-MBP expression plasmids were introduced into bacterial strain JM109 and purified by affinity chromatography as described (19,20).
Electrophoresis and immunoblotting
Overproduction of the affinity-purified FMO3-MBP fusion proteins was assessed by fractionation electrophoresis on 12% SDS-PAGE; western blots were probed with a rabbit polyclonal antiserum directed against the wild-type fusion protein. 125I-Conjugated protein A was used as secondary ligand.
Enzyme assays
The relative activity of the variant FMO3-MBP fusion proteins to N-oxygenate the human FMO3 functional substrates 5-DPT (a phenothiazine analog), tyramine and TMA were assayed in vitro, as described (19,20). The activity of variant or truncated human FMO3-MBP was also evaluated by the methods described above. The products were quantified by HPLC as previously described (19,20). The concentration of protein was determined by the Pierce BCA method (Rockford, IL). Generally, Coomassie-stained gels indicated that 80-90% of the protein was the desired fusion protein.
ACKNOWLEDGEMENTS
Drs J.M. McGill and Maureen Cleary are gratefully acknowledged for their help with this study and patient care. Dr Charles Scriver is thanked for stimulating discussions and encouragement and for reading the manuscript. Professor R. Williamson is also thanked for reading the manuscript and Professor R.G. Cotton for his initial interest in this study. The study was supported by Samuel R. McLaughlin Canadian Travelling Fellowship to E.P.T., the McGill Research and Development fund and le Fonds de la Recherche en Santé du Québec (E.P.T.). This work was supported in part by a National Institutes of Health grant (GM36426) (J.R.C.). Research at the Murdoch Institute was supported by an Institute Block Grant from the National Health and Medical Research Council of Australia. Lynne Prevost and Huguette Rizziero are thanked for their secretarial skills.
ABBREVIATIONS
ACRS, artificial creation of restriction site; CYP, cytochrome P450; FMO, flavin-containing monooxygenase; SSCP, single-stranded conformational polymorphism; TMA, trimethylamine; TMANO, trimethylamine N-oxide; TMAuria, trimethylaminuria.
REFERENCES
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 4 Apr 1998
Copyright© Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  T. Celius, S. Roblin, P. A. Harper, J. Matthews, P. C. Boutros, R. Pohjanvirta, and A. B. Okey Aryl Hydrocarbon Receptor-Dependent Induction of Flavin-Containing Monooxygenase mRNAs in Mouse Liver Drug Metab. Dispos., December 1, 2008; 36(12): 2499 - 2505. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Borbas, J. Zhang, M. A. Cerny, I. Liko, and J. R. Cashman Investigation of Structure and Function of a Catalytically Efficient Variant of the Human Flavin-Containing Monooxygenase Form 3 Drug Metab. Dispos., December 1, 2006; 34(12): 1995 - 2002. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Eswaramoorthy, J. B. Bonanno, S. K. Burley, and S. Swaminathan Mechanism of action of a flavin-containing monooxygenase PNAS, June 27, 2006; 103(26): 9832 - 9837. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. B. Koukouritaki, M. T. Poch, E. T. Cabacungan, D. G. McCarver, and R. N. Hines Discovery of Novel Flavin-Containing Monooxygenase 3 (FMO3) Single Nucleotide Polymorphisms and Functional Analysis of Upstream Haplotype Variants Mol. Pharmacol., August 1, 2005; 68(2): 383 - 392. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Furnes and D. Schlenk Evaluation of Xenobiotic N- and S-Oxidation by Variant Flavin-Containing Monooxygenase 1 (FMO1) Enzymes Toxicol. Sci., April 1, 2004; 78(2): 196 - 203. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Cashman, V. Lattard, and J. Lin EFFECT OF TOTAL PARENTERAL NUTRITION AND CHOLINE ON HEPATIC FLAVIN-CONTAINING AND CYTOCHROME P-450 MONOOXYGENASE ACTIVITY IN RATS Drug Metab. Dispos., February 1, 2004; 32(2): 222 - 229. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Lattard, J. Zhang, Q. Tran, B. Furnes, D. Schlenk, and J. R. Cashman TWO NEW POLYMORPHISMS OF THE FMO3 GENE IN CAUCASIAN AND AFRICAN-AMERICAN POPULATIONS: COMPARATIVE GENETIC AND FUNCTIONAL STUDIES Drug Metab. Dispos., July 1, 2003; 31(7): 854 - 860. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Furnes, J. Feng, S. S. Sommer, and D. Schlenk Identification of Novel Variants of the Flavin-Containing Monooxygenase Gene Family in African Americans Drug Metab. Dispos., February 1, 2003; 31(2): 187 - 193. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Krause, L. H. Lash, and A. A. Elfarra Human Kidney Flavin-Containing Monooxygenases and Their Potential Roles in Cysteine S-Conjugate Metabolism and Nephrotoxicity J. Pharmacol. Exp. Ther., January 1, 2003; 304(1): 185 - 191. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Lunden, S. Marklund, V. Gustafsson, and L. Andersson A Nonsense Mutation in the FMO3 Gene Underlies Fishy Off-Flavor in Cow's Milk Genome Res., December 1, 2002; 12(12): 1885 - 1888. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Cashman and J. Zhang Interindividual Differences of Human Flavin-Containing Monooxygenase 3: Genetic Polymorphisms and Functional Variation Drug Metab. Dispos., October 1, 2002; 30(10): 1043 - 1052. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. A. Seibel and P. J. Walsh Trimethylamine oxide accumulation in marine animals: relationship to acylglycerol storage J. Exp. Biol., February 1, 2002; 205(3): 297 - 306. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Cashman, J. Zhang, J. Leushner, and A. Braun Population Distribution of Human Flavin-Containing Monooxygenase Form 3: Gene Polymorphisms Drug Metab. Dispos., December 1, 2001; 29(12): 1629 - 1637. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. N. Hines, Z. Luo, T. Cresteil, X. Ding, R. A. Prough, J. L. Fitzpatrick, S. L. Ripp, K. C. Falkner, N.-L. Ge, A. Levine, et al. Molecular Regulation of Genes Encoding Xenobiotic-Metabolizing Enzymes: Mechanisms Involving Endogenous Factors Drug Metab. Dispos., April 13, 2001; 29(5): 623 - 633. [Abstract] [Full Text]
|
|
|
|
|
|
S. C. Mitchell and R. L. Smith Trimethylaminuria: The Fish Malodor Syndrome Drug Metab. Dispos., April 1, 2001; 29(4): 517 - 521. [Abstract] [Full Text]
|
|
|
|
 |
|
 A S KASHYAP and S. KASHYAP Fish odour syndrome Postgrad. Med. J., May 1, 2000; 76(895): 318a - 318. [Full Text]
|
|
|
|
|
|
J. R. Cashman, B. R. Akerman, S. M. Forrest, and E. P. Treacy Population-Specific Polymorphisms of the Human FMO3 Gene: Significance for Detoxication Drug Metab. Dispos., February 1, 2000; 28(2): 169 - 173. [Abstract] [Full Text]
|
|
|
|
|
|
D. Vollrath and V. L. Jaramillo-Babb A Sequence-Ready BAC Clone Contig of a 2.2-Mb Segment of Human Chromosome 1q24 Genome Res., February 1, 1999; 9(2): 150 - 157. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||