| Human Molecular Genetics | Pages |
Caveolin-3 in muscular dystrophy
Introduction
Results
Caveolin-3 is a dystrophin-associated protein
Characterization of the human gene encoding caveolin-3
Human caveolin-3 is located at 3p25 and is mutated in patients with muscular dystrophy
Discussion
Materials And Methods
Purification of the DGC
Isolation of human caveolin-3 cDNA clones
Isolation and characterization of human caveolin-3 genomic clones
Northern analysis
Fluorescence in situ hybridization (FISH) with genomic sequences encoding caveolin-3
Mutation analysis
Immunocytochemistry
Acknowledgements
References
Caveolin-3 in muscular dystrophy
The dystrophin-glycoprotein complex (DGC) serves as a link between cytoplasmic actin, the membrane and the extracellular matrix of striated muscle. Genetic defects in genes encoding a subset of DGC proteins result in muscular dystrophy and a secondary decrease in other DGC proteins. Caveolae are dynamic structures that have been implicated in a number of functions including endocytosis, potocytosis and signal transduction. Caveolin (VIP-21) is thought to play a structural role in the formation of non-clathrin-coated vesicles in a number of different cell types. Caveolin-3, or M-caveolin, was identified as a muscle-specific form of the caveolin family. We show that caveolin-3 co-purifies with dystrophin, and that a fraction of caveolin-3 is a dystrophin-associated protein. We isolated the gene for human caveolin-3 and mapped it to chromosome 3p25. We determined the genomic organization of human caveolin-3 and devised a screening strategy to look for mutations in caveolin-3 in patients with muscular dystrophy. Of 82 patients screened, two nucleotide changes were found that resulted in amino acid substitutions (G55S and C71W); these changes were not seen in a control population. The amino acid changes map to a functionally important domain in caveolin-3, suggesting that these are not benign polymorphisms and instead are disease-causing mutations.
INTRODUCTION
Dystrophin is a membrane-associated protein in muscle and brain, and mutations in the gene encoding dystrophin yield a clinical spectrum that includes muscular dystrophy, cardiomyopathy and mental retardation. The C-terminus of dystrophin associates with a complex of transmembrane and membrane-associated proteins (1-3). This complex, known as the dystrophin-glycoprotein complex or DGC, has been characterized biochemically and can be divided into a number of subcomplexes that include dystroglycan, sarcoglycan, syntrophin, dystrobrevin and the recently identified, sarcospan (4, for reviews see refs 5,6). Dystroglycan is a heavily glycosylated, peripheral membrane protein that directly binds the extracellular matrix (ECM) protein, laminin (for review, see 7). Mice homozygously lacking dystroglycan have an embryonic lethality thought to arise from defects in extra-embryonic structures and their association with the ECM (8). Sarcoglycan, a second component of the DGC, is composed of at least four subunits, [alpha], [beta], [gamma] and [delta] (for review see ref. 9). Mutations in each of the sarcoglycan genes cause autosomal recessive muscular dystrophy phenotypically similar to Duchenne muscular dystrophy (DMD). Syntrophin, a 59 kDa cytoplasmic protein, directly binds residues within the C-terminus of dystrophin and has also been shown to associate with neuronal nitric oxide synthase (nNOS) (7,10-12). NOS is part of the DGC, and its association with the muscle membrane is altered in DMD (13,14).
Caveolae are small membrane invaginations on the surface of cells that participate in membrane trafficking, sorting, transport and signal transduction (for reviews see refs 15,16). Caveolin is a small molecular weight protein that has been shown to be associated in many instances with the caveolar structure. A muscle-specific form of caveolin, caveolin-3, was identified (17,18). The number and size of caveolae are specifically abnormal in DMD, and studies of smooth muscle, where dystrophin has a more restricted pattern at the sarcolemma, show specific co-localization with caveolae and caveolin (19,20). Immunoprecipitation of crude membrane preparations shows an association of caveolin and dystrophin (21). Recently, it was shown that caveolin-3 and NOS directly interact and that this binding results in the loss of NOS activity (22), suggesting that the caveolin-3-nNOS interaction may be one mechanism by which caveolin-3 participates in the DGC.
To understand the relationship between caveolin and dystrophin better, we purified the DGC from skeletal muscle membranes using wheat germ agglutinin (WGA) and ion exchange chromatography, and found that caveolin-3 co-purifies with dystrophin. The human gene encoding caveolin was cloned and its chromosomal map position was determined by fluorescence in situ hybridization (FISH) as chromosome 3p25. Expression of caveolin-3 was studied and the organization of the caveolin-3 gene was determined. Primers were designed to amplify caveolin-3 sequences for single strand conformation polymorphism (SSCP) analysis and mutation detection. We analyzed patients with muscular dystrophy of an unknown genetic etiology and identified a single patient with a homozygous missense change (G55S) in caveolin-3 and a second patient with a single altered allele (C71W). These changes were not seen in a control population. Expression of dystrophin and the sarcoglycans is grossly normal in a skeletal muscle biopsy from the patient with a homozygous G55S change. G55 and C71 both fall within a cytoplasmic region of caveolin-3 that was implicated directly in inhibiting NOS activity. Given this, it is likely that these changes are disease-causing mutations and not neutral polymorphisms.
Figure 1. Caveolin-3 is a dystrophin-associated protein. The DGC was purified from rat skeletal muscle membranes using affinity and anion exchange chromatography (1-3). Fractions from the crude membrane preparation, the eluate from the WGA-Sepharose column and the low and high salt elutions from Q-Sepharose chromatography were separated by electrophoresis and immunoblotted with antibodies against dystrophin and caveolin-3. The upper panel represents those fractions separated on a 3-15% SDS-PAGE, while the lower panel represents those fractions separated by electrophoresis on a 15% SDS-PAGE. Lane 1, crude membranes; lane 2, WGA eluate; lane 3, low salt wash from the Q-Sepharose column; lanes 4-7, fractions 1-4, high salt wash from the Q-Sepharose column. The antibody against caveolin-3 is isoform-specific and has been characterized previously (21). The staining pattern of caveolin-3 in the identical fractions parallels that seen for dystrophin, suggesting that these proteins are both part of the DGC.
Figure 2. (A) The cDNA sequence of human caveolin-3 is shown on the lowest line (hcav3) and is compared with the sequences of mouse caveolin-3 (mcav3) and rat caveolin-3 (rcav3). The sequences are highly related. The two missense changes identified in patients with muscular dystrophy are shown in boxes, and the new amino acid is shown below. The solid line indicates one of the peptides recently shown by Venema et al. (22) to inhibit NOS activity. The dashed line indicates the transmembrane domain. It is thought that the N- and C-terminal domains of caveolin-3 are intracellular. The arrow indicates the placement of the single intron in the coding region of caveolin-3. The complete nucleotide sequence of the coding region of caveolin-3, exon 1 and exon 2 with the intronic flanking region has been deposited to GenBank under the accession nos AF036365-AF036367. (B) The expression pattern of caveolin-3 mRNA is shown in mRNA from multiple human tissues. A portion of the caveolin-3-coding region was labeled and hybridized to a blot containing 2 µg of poly(A)+ mRNA from multiple human tissues. The caveolin-3 mRNA is 1.5 kb in size and is only present in striated muscle including cardiac and skeletal muscle.
RESULTS
Caveolin-3 is a dystrophin-associated protein
The relationship between the DGC and caveolin-3 was investigated by purifying dystrophin from rat skeletal muscle membranes. WGA affinity chromatography and anion exchange chromatography were used to fractionate skeletal muscle microsomes because it was these fractionation steps that were used originally in describing the DGC (1-3). The fractions from these chromatography steps were analyzed by immunoblotting using antibodies specific for dystrophin and caveolin-3, the muscle-specific form of caveolin, to demonstrate that both dystrophin and caveolin-3 were present in the DGC preparation (Fig. 1, lane 5). The degradation of dystrophin that produces the doublet pattern on immunoblotting did not interfere with its normal elution profiles. Furthermore, the dystrophin-containing WGA fraction was purified further with anion exchange chromatography, demonstrating that some caveolin-3 in muscle is dystrophin associated. It should be noted that a significant fraction of the total caveolin present in the skeletal muscle membrane sample did not co-purify with dystrophin (Fig. 1, lane 3), suggesting that caveolin is not associated exclusively with the DGC in muscle.
Table 1
| Size of PCR product (bp) |
Forward 5[prime] to 3[prime] | Reverse 5[prime] to 3[prime] | |
| Genomic DNA primers | |||
| HC3-7F/HC3-E1-3 | 176 bp | agctcggatctcctcctgtgg | ccgaggcaggcctgcagagcc |
| exon 1 | (1-20) | (156-176) | |
| HC3-E2-5/HC3-2 | 186 bp | gagttgaggcttccccttgcc | cgaacaggaagccccagagca |
| exon 2 | (1-21) | (174-194) | |
| HC3-1/HC3-3UTR | 267 bp | ctaccgtctgttgtccacgct | tgccaccgctgttgccccacc |
| exon 2 | (133-153) | (379-399) | |
| cDNA primers | |||
| HC3-7F/ HC3-8R | 222 bp | agctcggatctcctcctgtgg | ggtggtgtagctcaccttcca |
| (10-30) | (219-239) | ||
| HC3-3/HC3-2 | 193 bp | ccgagaccccaagaacattaac | cgaacaggaagccccagagca |
| (125-146) | (304-324) | ||
| HC3-1/HC3-3UTR | 267 bp | ctaccgtctgttgtccacgct | tgccaccgctgttgccccacc |
| (263-283) | (509-529) | ||
Characterization of the human gene encoding caveolin-3
cDNA and genomic phage encoding human caveolin-3 were isolated from a [lambda]gt10 human cardiac library and an EMBL-3 human genomic library, respectively. The cDNA sequence was determined and has been deposited in GenBank with the accession no. AF036365. The caveolin-3 cDNA encodes an open reading frame of 150 amino acids that is highly homologous to the rat and mouse caveolin-3 sequences (96% similarity to both) but less homologous to human caveolin-1 and caveolin-2 (82 and 58% similarity, respectively) (Fig. 2A). Genomic phage encoding caveolin-3 were partially characterized by restriction digest. Intron-exon border sequences were determined by direct sequencing using primers directed against the exonic sequences. Caveolin-3 is encoded by two exons separated by a single intron. The expression pattern of human caveolin-3 mRNA was studied using RNA from multiple human tissues and a radiolabeled fragment of the human caveolin-3 sequence. The caveolin-3 mRNA was found to be expressed exclusively in cardiac and skeletal muscle (Fig. 2B). Primers were designed to amplify both the complete caveolin-3-coding region and portions of the flanking introns from genomic DNA. The primers for this assay are shown in Table 1. The sequences of the caveolin exons and flanking intronic region contained within the PCR products were deposited in GenBank under the accession nos AF036366 (exon 1) and AF036367 (exon 2).
Human caveolin-3 is located at 3p25 and is mutated in patients with muscular dystrophy
Genomic phage encoding caveolin-3 were labeled with digoxigenin and hybridized to human chromosomes. Twenty different metaphase chromosome spreads were analyzed, and the caveolin signal was present just below the telomere of the short arm of chromosome 3 at 3p25 (Fig. 3). Since none of the known muscular dystrophy loci are in this region, we chose a sample ofmuscular dystrophy patients (n = 82) of unknown genetic etiology to screen for mutations in the caveolin-3 gene using PCR to amplify the caveolin-3 sequences and SSCP. Dystrophin abnormalities were excluded as the cause of muscular dystrophy in these patients by a normal dystrophin immunostaining pattern on muscle biopsy and/or a normal dystrophin locus by multiplex PCR analysis of the dystrophin gene. The selection of muscular dystrophy patients studied included 65 that had a normal [alpha]-sarcoglycan immunostaining pattern and 17 that had abnormal staining. Mutations in [alpha]-, [beta]-, [gamma]- and [delta]-sarcoglycan were excluded as the abnormality in the 17 patients with abnormal [alpha]-sarcoglycan immunostaining.
Figure 3. Fluorescence in situ hybridization (FISH) with genomic phage encoding caveolin-3. Genomic phage encoding caveolin-3 were labeled with digoxigenin and hybridized to human metaphase chromosomes. The map location of human caveolin-3 is 3p25. One female patient was found to have a homozygous missense change G55S (Fig. 4A). This patient was the only affected member of her family, and developed proximal muscle weakness in the first decade. Dystrophin mutations were excluded by immunostaining, western blotting showing normal size and content of dystrophin and multiplex PCR. A second muscular dystrophy patient was identified with a heterozygous change on one allele (C71W) (Fig. 4B). This patient also had symptoms of progressive proximal weakness that began in the first decade, but she remained ambulatory in the mid-second decade. A second abnormality was not identified in this patient's DNA and may reflect a limited sensitivity of our screening assay. Her mother and two siblings had the identical missense change but did not have symptoms of muscular dystrophy, arguing that a single abnormal allele is not sufficient to cause the phenotype and that the likely inheritance is autosomal recessive. The father's DNA was not available and we were unable to determine the nature of the second allele in the proband. The entire coding region and 20-30 bp of intronic flanking region were screened for mutations, but it is possible the mutation lies outside the region being screened either more distantly in the introns or in the 3[prime]-untranslated region (3[prime]UTR). Since both G55S and C71W were easily seen on SSCP, a control population of normal individuals of varied ethnicity was screened using SSCP. We chose this control population as representing the varied ethnicity of the patients identified with the mutation screen. Neither of these missense changes (G55S and C71W) was seen in 200 normal chromosomes screened by SSCP. The C71W missense change created a KpnI site, and 50 normal chromosomes were also screened by restriction digest as well as SSCP and no new KpnI sites were found. In a separate line of experiments, we tested patients with known mutations in the sarcoglycan genes (n = 50) and found no SSCP variants in caveolin-3 (data not shown). The patients identified with alterations in their caveolin genes (G55S and C71W) exhibited classical symptoms of progressive proximal muscular dystrophy characteristically seen in Duchenne/Becker muscular dystrophy or in the limb-girdle muscular dystrophies. Figure 5. Immunostaining of the muscle biopsy of the patient with the G55S substitution. Sections of the patient's muscle biopsy were made and stained with antibodies to dystrophin and the components of sarcoglycan. The dystrophin and sarcoglycan patterns appeared slightly patchy but intact, and this pattern may have been due to freeze artifact. The sarcoglycan staining, as well as staining with a caveolin-3-specific antibody showed that these proteins were associated with the muscle membrane. The muscle biopsy from the patient with the homozygous G55S mutation was stained with antibodies directed at dystrophin, components of the sarcoglycan complex and caveolin-3. The staining pattern for dystrophin and the sarcoglycans appeared slightly patchy (Fig. 5), and this may be due to freeze artifact present in the muscle since it was not present in all muscle sections. The staining for caveolin-3 also appeared largely normal. The G55S amino acid substitution may not alter the intracellular location of caveolin yet may interfere with the normal function of caveolin in the membrane.
Figure 4. Mutation analysis of human caveolin-3 in patients with muscular dystrophy. DNA from patients with muscular dystrophy who had no identifiable mutation in dystrophin, [alpha]-, [beta]- or [gamma]-sarcoglycan was studied for mutations in caveolin-3. Primers were used to amplify cDNA prepared from a muscle biopsy (A) or genomic DNA (B). (A) The SSCP variant and sequence associated with the G55S substitution. (B) The SSCP variant associated with the C71W missense change. The lower band was excised from the SSCP gel, reamplified and directly sequenced to show the sequence associated with that SSCP variant. This C71W change also creates a KpnI site that was used to test the members of the proband's family for the same mutation. Two unaffected siblings and her mother were found to carry a single copy of C71W, suggesting that a single abnormal allele is not sufficient to cause muscular dystrophy and the autosomal recessive inheritance. However, a second abnormal allele could not be detected in this patient, and the father's DNA was not available for study. Neither missense substitution was detected in 200 chromosomes from normal, unrelated controls nor in an additional 100 chromosomes from patients with muscular dystrophy of known genetic etiology.
DISCUSSION
A number of lines of evidence point to the association of caveolae and the DGC. Early ultrastructural characterization of muscle from patients with DMD showed abnormal size and numbers of caveolae (19). Co-localization of caveolin and dystrophin was seen in immunohistochemical staining of smooth muscle (20). Smooth muscle differs from striated muscle in that the dystrophin staining pattern is discontinuous at the membrane, and therefore it is ideal for demonstrating co-localization of dystrophin and caveolin. In the present work, we isolated dystrophin from skeletal muscle membranes and, using an antibody specific to caveolin-3, determined that caveolin-3 co-purifies with dystrophin in a manner similar to other components of the DGC.
While caveolin co-purifies with dystrophin, only a fraction of the intracellular caveolin is associated with dystrophin, consistent with the other cellular functions attributed to caveolin and caveolae. Future experiments aimed at addressing the ratio of dystrophin to caveolin and the proportion of intracellular caveolin that is associated with the DGC are needed to assess better the nature of this interaction. For example, whether a direct interaction between caveolin and dystrophin exists is unknown. However, recent data suggest that the caveolin-nNOS association is one mechanism by which caveolin-3 binds the DGC (22). It was shown previously that nNOS binds syntrophin, a 59 kDa component of the DGC (13). Caveolin-3 recently was shown to bind nNOS and result in the inhibition of NOS activity (22). Several peptides representing caveolin-3 sequences were shown to inhibit NOS activity in vitro (22). One of these, a peptide of 20 amino acids, including the G55 and C71 amino acids, was shown to inhibit NOS activity in vitro (22). This suggests that the interaction between caveolin-3 and dystrophin may be indirect and mediated through nNOS. These data further support that G55S and C71W are pathogenic mutations and not neutral polymorphisms. Moreover, these missense changes were not seen in a control population of 200 chromosomes from normal individuals and 100 chromosomes from muscular dystrophy patients with known mutations.
Interestingly, immunostaining of the muscle from the patient with the G55S change shows a nearly normal pattern for dystrophin and selected components of the DGC. This pattern stands in contrast to that seen in primary dystrophin mutations or in the primary sarcoglycan mutations where components of the sarcoglycan complex may be virtually absent from the muscle membrane. This suggests that caveolin normally is placed within the muscle membrane but is functioning abnormally, perhaps disrupting the normal activity of NOS. An improved understanding of the interaction of caveolin and caveolae in dystrophic muscle may shed light on the inherent membrane instability present in these disorders. The availability of caveolin-3 gene sequence, organization and a screening strategy to detect mutations should facilitate the study of additional muscular dystrophy patients and better assess the role of this protein in the dystrophic process.
MATERIALS AND METHODS
Purification of the DGC
Microsomal membranes were prepared from rat skeletal muscle by the pyrophosphate variant (1-3) with the addition of E64 at a final concentration of 2 µg/ml, 1 mM benzamidine, 77 nM aprotinin, 2 µg/ml leupeptin, 1 mM iodoacetamide and 0.2 mM phenylmethylsulfonyl fluoride (PMSF). The microsomes were washed twice with 0.6 M KCl and solubilized in 1.0% digitonin, and the DGC purified by WGA affinity chromatography as described (3). The dystrophin-containing fractions eluted from WGA-Sepharose were then separated further using Q-Sepharose fast flow chromatography; the column was washed extensively with 0.27 M NaCl, and the DGC was eluted with 0.35 M NaCl. The Q-Sepharose column fractions were analyzed for the presence of dystrophin and caveolin-3 using SDS-PAGE and immunoblotting. A monoclonal antibody specific for caveolin-3 was described previously (21). A polyclonal antibody directed at the rod of dystrophin, anti-6-10, was described previously (23). Secondary antibodies conjugated to horseradish peroxidase were from Jackson Immunochemicals and were imaged using ECL (Amersham).
Isolation of human caveolin-3 cDNA clones
Primers were designed based on the rat and mouse caveolin-3 sequences (GenBank accession nos U31968 and U36579, respectively), and used to amplify cDNA reverse transcribed from human skeletal and cardiac muscle. The primers used for the initial amplification were RC-F1 5[prime]ATCATCAAGGACATTCACTGCAAGGAGATAGA3[prime] and RC-R2 5[prime]CGGGTTGCAGAAGGTGCGGATACA3[prime]. These primers produced a 420 bp product from human cardiac and skeletal muscle cDNA that was directly sequenced and found to contain human caveolin-3 sequences. The PCR product was reamplified in the presence of 32P to generate radiolabeled fragments for screening a human cardiac cDNA library. [lambda]gt10 cDNA clones were isolated and subcloned into Bluescript (Stratagene). All sequencing was performed with Taq cycle sequencing on an ABI 373 sequencer, and all analyses were performed with Sequcencher (Gene Codes), MacVector and the GCG sequence analysis package.
Isolation and characterization of human caveolin-3 genomic clones
The same 420 bp fragment representing human caveolin-3 was used to screen an EMBL-3 human genomic library (Clontech, catalog no. HL1006d). Six positively hybridizing clones were isolated and characterized by restriction digest and direct sequencing. The intron-exon structure of human caveolin-3 was determined by direct sequencing using the primers listed in Table 1. Phage DNA was prepared by cesium gradient centrifugation followed by Qiagen lambda prep. and directly sequenced using Taq cycle sequencing and an ABI 373 sequencer.
Northern analysis
The same 420 bp PCR product was generated in the presence of 32P and used as a probe against a multiple tissue northern blot (Clontech) that contained 2 µg of poly(A)+ mRNA from each tissue listed. Conditions for hybridization were those previously described (24).
Fluorescence in situ hybridization (FISH) with genomic sequences encoding caveolin-3
Two overlapping genomic phage encoding human caveolin-3, HC3-G1 and HC3-G6 were nick translated and labeled with digoxigenin as described (25). Human cells arrested at metaphase were prepared from primary lymphoblastoid cells using standard cytogenetic techniques. Nuclei were visualized by fluorescence microscopy using a Zeiss Axiophot microscope equipped with a triple band pass filter set [fluorescein/Texas red/DAPI (4[prime],6-diamidino-2-phenylindole); Omega Optical] and recorded as described (25).
Mutation analysis
Total RNA was prepared from muscle biopsies, and cDNA was synthesized with reverse transcriptase primed with oligo(dT) as described (24). The primers that generate overlapping products were used to amplify the coding region of human caveolin-3 and are listed in Table 1. The PCR products were separated by electrophoresis under non-denaturing conditions using SSCP. Gels were run at 600 V under constant voltage at room temperature for 8-10 h or until the fragments of interest had migrated to the center of a 40 cm gel. Gels were run under two conditions that included 0.5× MDE (FMC Bioproducts, Rockland, ME) without glycerol and 0.5× MDE with 4% glycerol. Additionally, 0.5× MDE with 10% glycerol was used on the PCR product amplified by the first pair of caveolin-3 cDNA primers since this condition was found to be more favorable for detecting SSCP variants. Gels were dried and autoradiographed for 4-24 h at -80oC. SSCP variants were excised from the gels and eluted in 100 µl of dH2O. Five µl of the eluted fragment was used for reamplification under the conditions described above except that 32P was omitted and the reaction volume was 50 µl. The reamplified PCR products were purified using Wizard PCR Clean up (Promega, Madison, WI), and 2 µl was used for sequencing. Taq cycle sequencing was performed with an ABI 373 sequencer.
Immunocytochemistry
Muscle biopsies sections of 7 µm of were cut at -20°C using a cryostat and briefly fixed in acetone. Slides were blocked with 5% fetal calf serum in 1× phosphate-buffered saline (PBS). The antibodies used for immunocytochemistry include the monoclonal antibodies, NCL-DYS2 and NCL-50DAG directed against dystrophin and [alpha]-sarcoglycan, respectively (Novocastra, Newcastle upon Tyne, UK) and rabbit polyclonal antibodies anti-[beta]-sarcoglycan and anti-[gamma]-sarcoglycan. The secondary antibodies, anti-rabbit and anti-mouse IgG were coupled to Cy3 (Jackson Immunochemicals). The results were visualized on a Leitz microscope equipped with epifluorescence and filters.
ACKNOWLEDGEMENTS
We thank Flavia Dantas Albuquerque for help with mutation screening. E.M.M is supported by NIH HL30041. L.M.K. is an investigator of the Howard Hughes Medical Institutes. E.S.M., M.V., M.R.P.-B. and M.Z. are supported by FAPESP, CNPq, PRONEX and IAEA.
REFERENCES
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 4 Apr 1998
Copyright© Oxford University Press, 1998.
This article has been cited by other articles:
![]() |
C. Cai, N. Weisleder, J.-K. Ko, S. Komazaki, Y. Sunada, M. Nishi, H. Takeshima, and J. Ma Membrane Repair Defects in Muscular Dystrophy Are Linked to Altered Interaction between MG53, Caveolin-3, and Dysferlin J. Biol. Chem., June 5, 2009; 284(23): 15894 - 15902. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Feron, L. Guevel, K. Rouger, L. Dubreil, M.-C. Arnaud, M. Ledevin, L. A. Megeney, Y. Cherel, and V. Sakanyan PTEN Contributes to Profound PI3K/Akt Signaling Pathway Deregulation in Dystrophin-Deficient Dog Muscle Am. J. Pathol., April 1, 2009; 174(4): 1459 - 1470. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. N. Bernatchez, A. Sharma, P. Kodaman, and W. C. Sessa Myoferlin is critical for endocytosis in endothelial cells Am J Physiol Cell Physiol, January 1, 2009; 297(3): C484 - C492. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kirkham, S. J. Nixon, M. T. Howes, L. Abi-Rached, D. E. Wakeham, M. Hanzal-Bayer, C. Ferguson, M. M. Hill, M. Fernandez-Rojo, D. A. Brown, et al. Evolutionary analysis and molecular dissection of caveola biogenesis J. Cell Sci., June 15, 2008; 121(12): 2075 - 2086. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Hernandez-Deviez, M. T. Howes, S. H. Laval, K. Bushby, J. F. Hancock, and R. G. Parton Caveolin Regulates Endocytosis of the Muscle Repair Protein, Dysferlin J. Biol. Chem., March 7, 2008; 283(10): 6476 - 6488. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. McEwen, Q. Li, S. Jackson, P. M. Jenkins, and J. R. Martens Caveolin Regulates Kv1.5 Trafficking to Cholesterol-Rich Membrane Microdomains Mol. Pharmacol., March 1, 2008; 73(3): 678 - 685. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Patel, S. Zhang, F. Murray, R. Y. S. Suda, B. P. Head, U. Yokoyama, J. S. Swaney, I. R. Niesman, R. T. Schermuly, S. S. Pullamsetti, et al. Increased smooth muscle cell expression of caveolin-1 and caveolae contribute to the pathophysiology of idiopathic pulmonary arterial hypertension FASEB J, September 1, 2007; 21(11): 2970 - 2979. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D Vandre, W. E Ackerman IV, D. A Kniss, A. K Tewari, M. Mori, T. Takizawa, and J. M Robinson Dysferlin Is Expressed in Human Placenta But Does Not Associate with Caveolin Biol Reprod, September 1, 2007; 77(3): 533 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Klinge, S. Laval, S. Keers, F. Haldane, V. Straub, R. Barresi, and K. Bushby From T-tubule to sarcolemma: damage-induced dysferlin translocation in early myogenesis FASEB J, June 1, 2007; 21(8): 1768 - 1776. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vatta, M. J. Ackerman, B. Ye, J. C. Makielski, E. E. Ughanze, E. W. Taylor, D. J. Tester, R. C. Balijepalli, J. D. Foell, Z. Li, et al. Mutant Caveolin-3 Induces Persistent Late Sodium Current and Is Associated With Long-QT Syndrome Circulation, November 14, 2006; 114(20): 2104 - 2112. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. Parton, M. Hanzal-Bayer, and J. F. Hancock Biogenesis of caveolae: a structural model for caveolin-induced domain formation. J. Cell Sci., March 1, 2006; 119(Pt 5): 787 - 796. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Hernandez-Deviez, S. Martin, S. H. Laval, H. P. Lo, S. T. Cooper, K. N. North, K. Bushby, and R. G. Parton Aberrant dysferlin trafficking in cells lacking caveolin or expressing dystrophy mutants of caveolin-3 Hum. Mol. Genet., January 1, 2006; 15(1): 129 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E Woods, D. Novo, M. DiFranco, J. Capote, and J. L Vergara Propagation in the transverse tubular system and voltage dependence of calcium release in normal and mdx mouse muscle fibres J. Physiol., November 1, 2005; 568(3): 867 - 880. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Nixon, J. Wegner, C. Ferguson, P.-F. Mery, J. F. Hancock, P. D. Currie, B. Key, M. Westerfield, and R. G. Parton Zebrafish as a model for caveolin-associated muscle disease; caveolin-3 is required for myofibril organization and muscle cell patterning Hum. Mol. Genet., July 1, 2005; 14(13): 1727 - 1743. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Cohen, R. Hnasko, W. Schubert, and M. P. Lisanti Role of Caveolae and Caveolins in Health and Disease Physiol Rev, October 1, 2004; 84(4): 1341 - 1379. [Abstract] [Full Text] [PDF] |
||||
![]() |
P Y K Van den Bergh, J M Gerard, J A Elosegi, M U Manto, C Kubisch, and B G H Schoser Novel missense mutation in the caveolin-3 gene in a Belgian family with rippling muscle disease J. Neurol. Neurosurg. Psychiatry, September 1, 2004; 75(9): 1349 - 1351. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Folco, G.-X. Liu, and G. Koren Caveolin-3 and SAP97 form a scaffolding protein complex that regulates the voltage-gated potassium channel Kv1.5 Am J Physiol Heart Circ Physiol, August 1, 2004; 287(2): H681 - H690. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Cagliani, N. Bresolin, A. Prelle, A. Gallanti, F. Fortunato, M. Sironi, P. Ciscato, G. Fagiolari, S. Bonato, S. Galbiati, et al. A CAV3 microdeletion differentially affects skeletal muscle and myocardium Neurology, December 9, 2003; 61(11): 1513 - 1519. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hnasko and M. P. Lisanti The Biology of Caveolae: Lessons from Caveolin Knockout Mice and Implications for Human Disease Mol. Interv., December 1, 2003; 3(8): 445 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Thorn, K. G. Stenkula, M. Karlsson, U. Ortegren, F. H. Nystrom, J. Gustavsson, and P. Stralfors Cell Surface Orifices of Caveolae and Localization of Caveolin to the Necks of Caveolae in Adipocytes Mol. Biol. Cell, October 1, 2003; 14(10): 3967 - 3976. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Ebert, M. Zelenka, I. Gath, U. Godtel-Armbrust, and U. Forstermann Colocalization but differential regulation of neuronal NO synthase and nicotinic acetylcholine receptor in C2C12 myotubes Am J Physiol Cell Physiol, April 1, 2003; 284(4): C1065 - C1072. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lee, M. Marcucci, L. Daniell, M. Pypaert, O. A. Weisz, G.-C. Ochoa, K. Farsad, M. R. Wenk, and P. De Camilli Amphiphysin 2 (Bin1) and T-Tubule Biogenesis in Muscle Science, August 16, 2002; 297(5584): 1193 - 1196. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Merlini, I Carbone, C Capanni, P Sabatelli, S Tortorelli, F Sotgia, M P Lisanti, C Bruno, and C Minetti Familial isolated hyperCKaemia associated with a new mutation in the caveolin-3 (CAV-3) gene J. Neurol. Neurosurg. Psychiatry, July 1, 2002; 73(1): 65 - 67. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Schara, M. Vorgerd, N. Popovic, B. G.H. Schoser, K. Ricker, and W. Mortier Rippling Muscle Disease in Childhood J Child Neurol, July 1, 2002; 17(7): 483 - 490. [Abstract] [PDF] |
||||
![]() |
A. J. Carozzi, S. Roy, I. C. Morrow, A. Pol, B. Wyse, J. Clyde-Smith, I. A. Prior, S. J. Nixon, J. F. Hancock, and R. G. Parton Inhibition of Lipid Raft-dependent Signaling by a Dystrophy-associated Mutant of Caveolin-3 J. Biol. Chem., May 10, 2002; 277(20): 17944 - 17949. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. D. Cote, H. Moukhles, and S. Carbonetto Dystroglycan Is Not Required for Localization of Dystrophin, Syntrophin, and Neuronal Nitric-oxide Synthase at the Sarcolemma but Regulates Integrin alpha 7B Expression and Caveolin-3 Distribution J. Biol. Chem., February 8, 2002; 277(7): 4672 - 4679. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vorgerd, K. Ricker, F. Ziemssen, W. Kress, H. H. Goebel, W. A. Nix, C. Kubisch, B. G.H. Schoser, and W. Mortier A sporadic case of rippling muscle disease caused by a de novo caveolin-3 mutation Neurology, December 26, 2001; 57(12): 2273 - 2277. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Macke, D. J. Ecker, R. R. Gutell, D. Gautheret, D. A. Case, and R. Sampath RNAMotif, an RNA secondary structure definition and search algorithm Nucleic Acids Res., November 15, 2001; 29(22): 4724 - 4735. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hayashi, S. Matsuda, K. Machida, T. Yamamoto, Y. Fukuda, Y. Nimura, T. Hayakawa, and M. Hamaguchi Invasion Activating Caveolin-1 Mutation in Human Scirrhous Breast Cancers Cancer Res., March 1, 2001; 61(6): 2361 - 2364. [Abstract] [Full Text] |
||||
![]() |
J. Gamez, C. Navarro, A.L. Andreu, J.M. Fernandez, L. Palenzuela, S. Tejeira, R. Fernandez-Hojas, S. Schwartz, C. Karadimas, S. DiMauro, et al. Autosomal dominant limb-girdle muscular dystrophy: A large kindred with evidence for anticipation Neurology, February 27, 2001; 56(4): 450 - 454. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hagiwara, T. Sasaoka, K. Araishi, M. Imamura, H. Yorifuji, I. Nonaka, E. Ozawa, and T. Kikuchi Caveolin-3 deficiency causes muscle degeneration in mice Hum. Mol. Genet., December 1, 2000; 9(20): 3047 - 3054. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Doyle, G. Goings, J. Upshaw-Earley, S. K. Ambler, A. Mondul, H. C. Palfrey, and E. Page Dystrophin Associates With Caveolae of Rat Cardiac Myocytes : Relationship to Dystroglycan Circ. Res., September 15, 2000; 87(6): 480 - 488. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Hauser, S. K. Horrigan, P. Salmikangas, U. M. Torian, K. D. Viles, R. Dancel, R. W. Tim, A. Taivainen, L. Bartoloni, J. M. Gilchrist, et al. Myotilin is mutated in limb girdle muscular dystrophy 1A Hum. Mol. Genet., September 1, 2000; 9(14): 2141 - 2147. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Herrmann, V. Straub, M. Blank, C. Kutzick, N. Franke, E. N. Jacob, H.-G. Lenard, S. Kroger, and T. Voit Dissociation of the dystroglycan complex in caveolin-3-deficient limb girdle muscular dystrophy Hum. Mol. Genet., September 1, 2000; 9(15): 2335 - 2340. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Galbiati, D. Volonté, J. B. Chu, M. Li, S. W. Fine, M. Fu, J. Bermudez, M. Pedemonte, K. M. Weidenheim, R. G. Pestell, et al. Transgenic overexpression of caveolin-3 in skeletal muscle fibers induces a Duchenne-like muscular dystrophy phenotype PNAS, August 7, 2000; (2000) 160249097. [Abstract] [Full Text] |
||||
![]() |
M. W. Berchtold, H. Brinkmeier, and M. Muntener Calcium Ion in Skeletal Muscle: Its Crucial Role for Muscle Function, Plasticity, and Disease Physiol Rev, July 1, 2000; 80(3): 1215 - 1265. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Hare, R. A. Lofthouse, G. J. Juang, L. Colman, K. M. Ricker, B. Kim, H. Senzaki, S. Cao, R. S. Tunin, and D. A. Kass Contribution of Caveolin Protein Abundance to Augmented Nitric Oxide Signaling in Conscious Dogs With Pacing-Induced Heart Failure Circ. Res., May 26, 2000; 86(10): 1085 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yoshida, H. Hama, M. Ishikawa-Sakurai, M. Imamura, Y. Mizuno, K. Araishi, E. Wakabayashi-Takai, S. Noguchi, T. Sasaoka, and E. Ozawa Biochemical evidence for association of dystrobrevin with the sarcoglycan-sarcospan complex as a basis for understanding sarcoglycanopathy Hum. Mol. Genet., April 12, 2000; 9(7): 1033 - 1040. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Carbone, C. Bruno, F. Sotgia, M. Bado, P. Broda, E. Masetti, A. Panella, F. Zara, F. D. Bricarelli, G. Cordone, et al. Mutation in the CAV3 gene causes partial caveolin-3 deficiency and persistent elevated levels of serum creatine kinase Neurology, March 28, 2000; 54(6): 1373 - 1376. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Razani, A Schlegel, and M. Lisanti Caveolin proteins in signaling, oncogenic transformation and muscular dystrophy J. Cell Sci., January 6, 2000; 113(12): 2103 - 2109. [Abstract] [PDF] |
||||
![]() |
E. J. Smart, G. A. Graf, M. A. McNiven, W. C. Sessa, J. A. Engelman, P. E. Scherer, T. Okamoto, and M. P. Lisanti Caveolins, Liquid-Ordered Domains, and Signal Transduction Mol. Cell. Biol., November 1, 1999; 19(11): 7289 - 7304. [Full Text] [PDF] |
||||
![]() |
F. Galbiati, D. Volonte, C. Minetti, J. B. Chu, and M. P. Lisanti Phenotypic Behavior of Caveolin-3 Mutations That Cause Autosomal Dominant Limb Girdle Muscular Dystrophy (LGMD-1C). RETENTION OF LGMD-1C CAVEOLIN-3 MUTANTS WITHIN THE GOLGI COMPLEX J. Biol. Chem., September 3, 1999; 274(36): 25632 - 25641. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. D. Bushby The limb-girdle muscular dystrophies--multiple genes,multiple mechanisms Hum. Mol. Genet., September 1, 1999; 8(10): 1875 - 1882. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. D. Bushby Making sense of the limb-girdle muscular dystrophies Brain, August 1, 1999; 122(8): 1403 - 1420. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Ostrom and P. A. Insel Caveolar Microdomains of the Sarcolemma : Compartmentation of Signaling Molecules Comes of Age Circ. Res., May 14, 1999; 84(9): 1110 - 1112. [Full Text] [PDF] |
||||
![]() |
G. Piluso, M. Mirabella, E. Ricci, A. Belsito, C. Abbondanza, S. Servidei, A. A. Puca, P. Tonali, G. A. Puca, and V. Nigro gamma 1- and gamma 2-Syntrophins, Two Novel Dystrophin-binding Proteins Localized in Neuronal Cells J. Biol. Chem., May 19, 2000; 275(21): 15851 - 15860. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Galbiati, J. A. Engelman, D. Volonte, X. L. Zhang, C. Minetti, M. Li, H. Hou Jr., B. Kneitz, W. Edelmann, and M. P. Lisanti Caveolin-3 Null Mice Show a Loss of Caveolae, Changes in the Microdomain Distribution of the Dystrophin-Glycoprotein Complex, and T-tubule Abnormalities J. Biol. Chem., June 8, 2001; 276(24): 21425 - 21433. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Galbiati, D. Volonte, J. B. Chu, M. Li, S. W. Fine, M. Fu, J. Bermudez, M. Pedemonte, K. M. Weidenheim, R. G. Pestell, et al. Transgenic overexpression of caveolin-3 in skeletal muscle fibers induces a Duchenne-like muscular dystrophy phenotype PNAS, August 15, 2000; 97(17): 9689 - 9694. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

























