| Human Molecular Genetics | Pages |
No association between the K variant of the butyrylcholinesterase gene and pathologically confirmed Alzheimer's disease
Introduction
Results
Discussion
Materials And Methods
Acknowledgement
References
No association between the K variant of the butyrylcholinesterase gene and pathologically confirmed Alzheimer's disease
The polymorphic K variant of the butyrylcholinesterase (BCHE-K) gene recently has been demonstrated to have an elevated frequency in Alzheimer's disease (AD) patients carrying the [epsis]4 allele of the apolipoprotein (APO E) gene when compared with a control population. We therefore genotyped a large series of pathologically confirmed AD patients and controls to confirm this association. We found no change in the frequency of this genetic variant, either in the AD group as a whole or in early- or late-onset patients when compared with age-matched controls. Stratification of these groups with reference to the APO E [epsis]4 allele also showed no difference between AD and control groups. To determine if a biological effect were present, we also looked at senile plaque and neurofibrillary tangle densities in the frontal, temporal, parietal and occipital cortices in AD patients either carrying or not carrying a copy of the K variant. We found no difference in plaque or tangle load between these two groups in either the total, late-onset or early-onset AD subjects. Stratification of the total AD group in terms of APO E [epsis]4 allele possession, and further comparison of plaque and tangle load between carriers and non-carriers of BCHE-K still failed to disclose a relationship between BCHE-K and AD. We conclude that in the population studied here there is no association between BCHE-K and AD, or that if such a relationship exists it is precluded by another, as yet unknown factor.
INTRODUCTION
Alzheimer's disease (AD) is an insidiously progressive dementia, primarily affecting the elderly. The disease is characterized clinically by gradual memory impairment and loss of pre-symptomatic persona leading ultimately to death. The neuropathological hallmarks of the disease are primarily senile plaques (SPs) and neurofibrillary tangles (NFTs). AD is a genetically heterogeneous disorder with at least four genetic loci known at present (1-4). Recently late-onset AD has also been suggested to be associated with a fifth locus, the K variant of the butyrylcholinesterase (BChE, plasma cholinesterase, acylcholine-acylhydrolase, EC 3.1.1.8) gene (5) situated on chromosome 3 (6). Lehmann and colleagues have shown the K variant of BChE to be in excess in AD sufferers who carry the [epsis]4 allele of the apolipoprotein E gene (APO E) when compared with controls. The function of BChE is, as yet, unknown; its activity, however, is known to increase with age and has been shown to be higher in AD cases (7,8). There are at least seven genetic variants of the BChE gene (9-11), BCHE-K arising when there is a point mutation at nucleotide 1615. Phenotypically, the K variant has been shown to cause a 30% reduction in BChE activity (12). Because of this putative association with AD, we have genotyped a large series of AD cases for the BCHE-K variant. Additionally, we have attempted to define a biological effect of the BCHE-K variant by correlating BCHE-K genotypes with AD pathology.
RESULTS
The results of the BChE genotyping are shown in Table 1. The population studied was found to be near or at Hardy-Weinberg equilibrium. We found no significant difference in the frequency of the K variant between the three AD groups tested and age-matched control groups (total AD P = 0.43, early-onset AD P = 1, late-onset AD P = 0.53). These groups were then stratified according to APO E [epsis]4 allele frequency (Table 2) and compared with age-matched APO E [epsis]4 load-matched controls. No significant difference was found between any of these APO E [epsis]4 stratified AD groups and their respective control groups (Table 2). There was no difference in plaque or tangle density values in the frontal, temporal, parietal and occipital cortices between AD groups carrying and not carrying the BCHE-K genotype (total AD, plaque load DF3,341 F = 0.12, P = 0.95, tangle load DF3,337 F = 0.36, P = 0.78; late-onset AD, plaque load DF3,247 F = 0.41, P = 0.75, tangle load DF3,242 F = 0.74, P = 0.53; early-onset AD, plaque load DF3,80 F = 0.13, P = 0.95, tangle load DF3,79 F = 0.18, P = 0.91). There was no significant difference in plaque or tangle load in the four cortical regions when comparing BCHE-K carriers with non-carriers in the total AD group stratified in terms of APO E [epsis]4 possession (APO E [epsis]4-negative cases, plaque load DF3,131 F = 0.37, P = 0.78, tangle load DF3,115 F = 0.29, P = 0.83; APO E [epsis]4-positive cases, plaque load DF3,205 F = 0.28, P = 0.84, tangle load DF3,214 F = 0.13, P = 0.94).
DISCUSSION
One of the central findings in AD research is the reduction of the neurotransmitter acetylcholine and the dysfunction and loss of central cholinergic neurones from the basal forebrain (13). This loss of cholinergic transmission is thought to underlie some of the cognitive deficits observed in AD. The findings of Lehman and colleagues (5) which describe a genetic link between the cholinergic system and predisposition to AD therefore appeared promising. It is difficult, however, to envisage a role for BCHE-K in the aetiology of AD. The BChE K variant has 30% less catalytic activity than normal butyrylcholinesterase (12) and would therefore be expected to lead to elevated levels of acetylcholine in the brains of AD patients. Furthermore, there is an elevation of BChE activity in the AD brain which appears to be localized to SP, NFT and congophilic angiopathy (14,15). This would suggest that the BChE K variant would be less prevalent in AD, and not increased as Lehmann and colleagues suggest, or that there is a marked up-regulation of this variant in certain AD cases.
Table 1
| Genotype | Allele | ||||
| G/G | G/A | A/A | G | A | |
| Total AD n = 119, mean age = 78.3 ± 9.4 SD |
82 (69) | 34 (29) | 3 (2) | 198 (83) | 40 (17) |
| Total controls n = 83, mean age = 78.3 ± 7.7 SD< |
51 (62) | 31 (37) | 1 (1) | 133 (80) | 33 (20) |
| EOAD n = 27, mean age=64.8 ± 6.1 SD |
20 (74) | 7 (26) | 0 (-) | 47 (87) | 7 (13) |
| Young controls n = 50, mean age = 64.3 ± 5.8 SD |
38 (76) | 11 (22) | 1 (2) | 87 (87) | 13 (13) |
| LOAD n = 92, mean age = 82.6 ± 5.3 SD |
62 (68) | 27 (29) | 3 (3) | 151 (82) | 33 (18) |
| Aged controls n = 70, mean age = 80.1 ± 7.1 SD |
42 (60) | 27 (39) | 1 (1) | 111 (79) | 29 (21) |
Table 2
| Group | APO E | N | Genotype | Allele | P-valuea | |||
| [epsis]4 | GG | GA | AA | G | A | |||
| Total AD | 0 | 41 | 29 (71) | 11 (27) | 1 (2) | 69 (84) | 13 (16) | 0.77 |
| 1 | 56 | 37 (66) | 17 (30) | 2 (4) | 91 (81) | 21 (19) | 0.18 | |
| 2b | 22 | 16 (73) | 6 (27) | 0 (-) | 38 (86) | 6 (14) | 0.09 | |
| Controls | 0 | 66 | 43 (65) | 23 (35) | 0 (-) | 109 (83) | 23 (17) | |
| 1 | 17 | 8 (47) | 8 (47) | 1 (6) | 24 (71) | 10 (29) | ||
| EOAD | 0 | 11 | 8 (73) | 3 (27) | 0 (-) | 19 (86) | 3 (14) | 0.99 |
| 1 | 10 | 7 (70) | 3 (30) | 0 (-) | 17 (85) | 3 (15) | 0.73 | |
| 2b | 6 | 5 (83) | 1 (17) | 0 (-) | 11 (92) | 1 (8) | 0.77 | |
| Controls | 0 | 37 | 27 (73) | 10 (27) | 0 (-) | 64 (86) | 10 (14) | |
| 1 | 13 | 11 (84) | 1 (8) | 1 (8) | 23 (88) | 2 (12) | ||
| LOAD | 0 | 30 | 21 (70) | 8 (27) | 1 (3) | 50 (83) | 10 (17) | 0.80 |
| 1 | 46 | 30 (65) | 14 (31) | 2 (4) | 74 (80) | 18 (20) | 0.23 | |
| 2b | 16 | 11 (69) | 5 (31) | 0 (-) | 27 (84) | 5 (16) | 0.18 | |
| Controls | 0 | 55 | 35 (64) | 20 (36) | 0 (-) | 90 (82) | 20 (18) | |
| 1 | 15 | 7 (47) | 7 (47) | 1 (6) | 21 (70) | 9 (30) | ||
There are a number of possibilities as to why our study has failed to find an association between BCHE-K and AD. One possibility is that there is another stronger genetic influence on late-onset AD acting in concert with the APO E [epsis]4 allele which precludes the effect of BCHE-K. We have, however, previously studied the influence of presenilin-1, presenilin-2 and [alpha]-1-antichymotrypsin polymorphisms and failed to find any association with these loci (16,17); this does not, however, negate the possibility that another as yet unidentified locus is exerting an effect. The BCHE-K locus itself may be in linkage disequilibrium with an as yet unidentified gene that has an effect in AD. If this is the case, then it is conceivable that in the population which is studied here, which is relatively conserved, these two loci are not in disequilibrium and hence the BCHE-K locus would be unrelated to AD. The finding of evidence for genetic loci on chromosomes 4, 6, 12 and 20 associated with AD (18) would suggest possible confounding factors in any such studies for disease association, and any results should only be explored further if such candidate genes are taken into account in the analysis.
MATERIALS AND METHODS
All cases of AD and controls were from a large prospective clinico-pathological study in the North East of England. AD cases were clinically diagnosed as such and after death confirmed neuropathologically. Cases with any other significant neuropathology were excluded. Control cases were identified as being free of any neuropsychiatric disease and at post-mortem were found to have age-associated neuropathological abnormalities only.
Genomic DNA was isolated from 250-300 mg of brain tissue by standard proteinase K digestion and phenol-chloroform extraction. PCR amplification was performed using mismatch oligonucleotide primers previously described (6), forward 5[prime]ATATTTTACAGGAAATATTGATGTA 3[prime] (mismatch underlined), reverse 5[prime]ATTAGAGACCCACACAACTT 3[prime]. Reaction conditions were: 94°C for 1 min followed by 35 cycles of 53°C for 20 s, 72°C for 20 s and 94°C for 20 s. The resulting fragment was digested with the restriction endonuclease MaeIII and electrophoresed on a 3% agarose (2% NuSeive GTG agarose, 1% NuSeive LE agarose; Flowgen, UK) gel containing ethidium bromide and viewed via UV transillumination. The presence of a BCHE-K allele is indicated by a band at 115 bp and a non-K allele by a band at 137 bp. APO E genotyping was performed as previously described (19).
The chi-squared ([chi]2) test was used to analyse data for any significant change in the frequency of the K variant and K variant homozygosity when compared with age-matched controls. Significance was adjudged to be reached at the 1% level.
Tissue blocks from the frontal, temporal, parietal and occipital cortices were embedded in paraffin wax and 10 µm sections were stained with von Braunmuhls method and Palmgrens silver method (20) respectively for SP and NFT. Mean neocortical SP and NFT counts were determined by counting five fields defined by a strip running from the pial surface to the grey-white interface. The resultant count/mm2 was averaged for each lobe. SP and NFT densities for the four cortical areas were compared between carriers and non-carriers of BCHE-K in total, late-onset and early-onset AD groups using a general linear model. Groups were also stratified according to APO E genotype and BCHE-K variant genotype. Significance was adjudged to be at the 5% level.
ACKNOWLEDGEMENT
This work was supported, in part, by the States Education Council, Guernsey.
REFERENCES
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 4 Apr 1998
Copyright© Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  A. Valle, D. T. O'Connor, P. Taylor, G. Zhu, G. W. Montgomery, P. E. Slagboom, N. G. Martin, and J. B. Whitfield Butyrylcholinesterase: Association with the Metabolic Syndrome and Identification of 2 Gene Loci Affecting Activity Clin. Chem., June 1, 2006; 52(6): 1014 - 1020. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M Mattila, J. O Rinne, M. Röyttä, P. Laippala, T. Pietilä, H. Kalimo, T. Koivula, H. Frey, and T. Lehtimäki Dipeptidyl carboxypeptidase 1 (DCP1) and butyrylcholinesterase (BCHE) gene interactions with the apolipoprotein E epsilon 4 allele as risk factors in Alzheimer's disease and in Parkinson's disease with coexisting Alzheimer pathology J. Med. Genet., October 1, 2000; 37(10): 766 - 770. [Abstract] [Full Text]
|
|
|
|
 |
|
 N SODEYAMA, M YAMADA, H MIZUSAWA, Y ITOH, E OTOMO, N SUEMATSU, and M MATSUSHITA Association between butyrylcholinesterase K variant and the Alzheimer type neuropathological changes in apolipoprotein E epsilon 4 carriers older than 75 years J. Neurol. Neurosurg. Psychiatry, November 1, 1999; 67(5): 693 - 694. [Full Text]
|
|
|
|
|
|
Y. Yamamoto, M. Yasuda, E. Mori, and K. Maeda Failure to confirm a synergistic effect between the K-variant of the butyrylcholinesterase gene and the epsilon 4 allele of the apolipoprotein gene in Japanese patients with Alzheimer's disease J. Neurol. Neurosurg. Psychiatry, July 1, 1999; 67(1): 94 - 96. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. Yamada, N. Sodeyama, Y. Itoh, N. Suematsu, E. Otomo, M. Matsushita, and H. Mizusawa Butyrylcholinesterase K Variant and Cerebral Amyloid Angiopathy Stroke, December 1, 1998; 29(12): 2488 - 2490. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||