Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (51)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Johnson, K. R.
Right arrow Articles by Davisson, M. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnson, K. R.
Right arrow Articles by Davisson, M. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1033-1038  


A new spontaneous mouse mutation of Hoxd13 with a polyalanine expansion and phenotype similar to human synpolydactyly
Introduction
Results
   Phenotype and inheritance of the mutation
   Mapping the mutation
   Molecular basis of the mutation
   Abnormal autopod development in spdh/spdh mice
   Abnormal urogenital development in spdh/spdh mice
Discussion
Materials And Methods
   Mice and genetic mapping
   PCR and DNA sequencing
   Staining of cartilage and bone
Acknowledgements
References


A new spontaneous mouse mutation of Hoxd13 with a polyalanine expansion and phenotype similar to human synpolydactyly

A new spontaneous mouse mutation of Hoxd13 with a polyalanine expansion and phenotype similar to human synpolydactyly

Kenneth R. Johnson*, Hope O. Sweet, Leah Rae Donahue, Pat Ward-Bailey, Roderick T. Bronson, Muriel T. Davisson

The Jackson Laboratory, Bar Harbor, ME 04609, USA

Received January 30, 1998; Revised and Accepted March 10, 1998

Human synpolydactyly (SPD) is an inherited congenital limb malformation caused by mutations in the HOXD13 gene. Heterozygotes are typically characterized by 3/4 finger and 4/5 toe syndactyly with associated duplicated digits; hands and feet of homozygotes are very small because of a shortening of the phalanges, metacarpal and metatarsal bones. Here we describe the phenotype and molecular basis of a spontaneous mutation of Hoxd13 in mice that provides a phenotypically and molecularly accurate model for human SPD. The new mutation, named synpolydactyly homolog (spdh), is a 21 bp in-frame duplication within a polyalanine-encoding region at the 5[prime]-end of the Hoxd13 coding sequence. The duplication expands the stretch of alanines from 15 to 22; the same type of expansion occurs in human SPD mutations. spdh/spdh homozygotes exhibit severe malformations of all four feet, including polydactyly, syndactyly and brachydactylia. The phenotype of spdh is much more severe than that exhibited by mice with a genetically engineered, presumably null, disruption of Hoxd13. Thus spdh probably acts in a dominant-negative manner and will be valuable for examining interactions with other Hox genes and their protein products during limb development. Homozygous mice of both sexes also lack preputial glands and males do not breed; therefore, spdh/spdh mice may also be valuable in studies of reproductive physiology and behavior.

INTRODUCTION

The evolutionarily highly conserved homeobox (Hox) genes encode transcription factors that play key roles in embryonic development, including growth and patterning of the vertebrate limb. Mammalian Hox genes are arranged in four clusters on separate chromosomes; genes within each cluster are organized in a linear fashion and display restricted expression domains corresponding to their location. Gene activation proceeds sequentially in a 3[prime]->5[prime] direction. Thus 5[prime] genes are activated later and expressed more distally (posteriorly) along a developmental axis than are 3[prime] genes. The 5[prime] (AbdB-like) members of the Hoxa and Hoxd gene clusters are coordinately expressed in the developing limb (1). The paralogous most 5[prime] members of these clusters, Hoxa13 and Hoxd13, appear to have a dominant effect on autopod (hand and foot) specification, consistent with their expression in the most distal segment of the limb (2,3).

Mutations of Hox genes that affect limb development have been reported in both mouse and man. In the mouse a naturally occurring semi-dominant mutation of Hoxa13 causes hypodactyly, Hd (4). Heterozygous Hd/+ mice show variable shortening of the first digit of the hindlimb; homozygotes often die in utero and develop only a single malformed digit on each limb (5,6). The X-ray-induced semi-dominant mouse mutation Ulnaless (Ul) is tightly linked to the Hoxd complex and deregulates expression of the 5[prime] Hoxd genes (7,8). The Ul mutation severely disrupts development of forearms and forelegs, but has lesser effects on the distal limb. In humans semi-dominant mutations of HOXD13 have been shown to cause synpolydactyly (SPD) (9-11). Most human SPD heterozygotes show a characteristic digit duplication and fusion; homozygotes have very small hands and feet due to shortening of the phalanges, metacarpal and metatarsal bones; they also exhibit syndactyly and polydactyly (9,12).

Targeted mutations of either Hoxa13 or Hoxd13 in the mouse produce milder autopod phenotypes than do the above described mutations, with only slight reductions in size or changes in shape of skeletal elements (2,13,14). The mild phenotypes of the targeted, presumably null, mutations may be the consequence of partial functional redundancies with other AbdB/Hox genes; the phenotypes of compound mutations are more severe than the sum of single mutation phenotypes (2,14-16). The naturally occuring Hox mutations may be more severe than the targeted mutations because they may act in an epistatic dominant-negative fashion, disrupting the compensatory functions of other related Hox genes (2,11,14-16).

There is accumulating evidence that both Hoxa13 and Hoxd13 function in the morphogenesis of the genitorurinary tract as well as in limb development. 5[prime] members of the Hoxd gene cluster are expressed in a temporal and spatial pattern along the developing urogenital system (17). Hoxd13 is expressed postnatally in the urethral epithelium and prostatic ducts of mice (18). Male sterility, presumably due to abnormal penian bone morphology (13), and morphological abnormalities in male accessory sex organs (19) have been reported in mice homozygous for a targeted disruption of Hoxd13. Both male and female mice homozygous for the Hd mutation of Hoxa13 are infertile, although few survive to breeding age (4). A mutation of HOXA13 was recently discovered in a human family with hand-foot-genital syndrome (20). Uterine and urinary tract anomalies are common in females with this syndrome; affected males may have hypospadias. Two human males with SPD caused by mutations of HOXD13 have also been reported with hypospadias (11).

Here we describe the phenotype and molecular basis of a new spontaneous mouse mutation of Hoxd13 that we have named synpolydactyly homolog, spdh (gene symbol Hoxd13spdh). We show that the new mutation is a 21 bp in-frame duplication within the polyalanine-encoding region at the N-terminus of the Hoxd13 coding sequence. The same type of polyalanine expansion in HOXD13 has been shown to be the cause of human SPD (9-11). Homozygosity for the mouse spdh mutation causes a severe foot malformation, similar to the hand and foot abnormalities associated with human SPD. Homozygous spdh/spdh mice of both sexes also lack preputial glands, consistent with the known expression of Hoxd13 during genitourinary tract development.

RESULTS

Phenotype and inheritance of the mutation

Mice with malformed feet were discovered in the B6C3Fe a/a-Cfsmop colony of mice at the Jackson Laboratory. The foot malformation was shown to be inherited as an autosomal recessive trait. Affected female mice mated with B6C3Fe male mice from another colony produced only unaffected progeny (36 normal, 0 affected), as expected for a recessive trait. When backcrossed to the affected parent the presumed heterozygotes produced 27 normal and 28 affected progeny, consistent with the expected 1:1 ratio. When intercrossed the presumed heterozygotes produced 99 normal and 35 affected progeny, consistent with the expected 3:1 ratio. Affected homozygous mice exhibited duplications, fusions and shortening of digits and a reduction in size and number of metacarpal, carpal, metatarsal and tarsal bones in all four feet, but the long bones of the limb appeared normal. These anomalies could be seen easily in adults (Fig. 1) and mice older than 2 days; however, newborn mutant mice were sometimes difficult to identify by gross morphology. Even on close examination no abnormalities were seen in heterozygotes at any age.


Figure 1. Foot malformation in adult mice homozygous for the spdh mutation. Mutant limbs (left) compared with control limbs (right). (a and b) forelimb; (c and d) hindlimb. (b) and (d) are alizarin red stained skeletons.


Mapping the mutation

To map the new mutation genetically an intercross was made between F1 hybrids produced from matings between homozygous mutant mice and mice from the wild-derived inbred strain CAST/Ei. Affected intercross progeny were typed for polymorphic markers dispersed throughout the genome. Linkage was found with markers on chromosome 2. Haplotype analysis of 50 affected intercross progeny (100 tested meioses) gave the following gene order and interlocus recombination distances in centimorgans: D2Mit124-2.0-D2Mit245-3.0-[D2Mit37, mutation]-2.0-D2Mit126-2.0-D2Mit300-5.0-D2Mit17.

To determine which chromosome of the the ancestral B6C3Fe a/a-Cfsmop hybrid parent was the site of the original mutation, we typed affected mice for the diagnostic lociD2Mit37, D2Mit128 and D2Mit17, whose allelic products differ in size between C57BL/6J and C3HeB/FeJLe. All three of these linked markers exhibited only C3H-specific allele sizes in DNA from these affected mice; thus, the mutation arose on the C3HeB/FeJLe-derived chromosome.

No genetic recombination was observed between D2Mit37 and the new mutation. D2Mit37 is located within the Hoxd gene cluster (Genetic and Physical Maps of the Mouse Database, 1997 release, Center for Genome Research, Whitehead Institute/MIT). Because of the coincident map positions of the new mutation and the Hoxd gene cluster and because of the mutation's phenotypic similarity to human synpolydactyly (a mutation of HOXD13), we considered Hoxd13 to be a likely candidate gene for the new mouse mutation.

Molecular basis of the mutation

According to the sequence data submitted to GenBank by Herault et al. (accession no. X99291) the mouse Hoxd13 gene is composed of two exons encoding a protein of 339 amino acids. The first exon, nt 1-768, encodes 256 amino acids, including a stretch of 15 alanines, nt 157-201. The second exon, nt 769-1020, encodes 83 amino acids, including 60 amino acids comprising the homeodomain. The human HOXD13 gene has a very similar structure (10).

We designed and synthesized PCR primers to amplify overlapping sequences that entirely cover both exons of the mouse Hoxd13 gene. Genomic DNA from homozygous mutant mice and +/+ controls (C57BL/6J × C3H/HeJ F1 hybrids) were used as PCR amplification templates for sequence comparisons. The Hoxd13 DNA sequence of mutant mice was identical to the control DNA sequence except for a 21 bp duplication within the polyalanine encoding region of the first exon (Fig. 2).


Figure 2. Molecular basis of the spontaneous mutation. A 21 bp duplication within the polyalanine-encoding region of the Hoxd13 gene is present in mutant but not control DNA. Nucleotide position numbers correspond to GenBank accession no. X99291. Although a duplication of nt 168-188 is shown, the 21 bp insert could also have been derived from duplications of either nt 157-177, 158-178, 159-179, 160-180, 161-181, 162-182, 163-183, 164-184, 165-185, 166-186 or 167-187.

After the mutation was thus characterized we developed a set of PCR primers to amplify the Hoxd13 sequence immediately surrounding the site of the 21 bp duplication, so that differently sized allelic products could be easily distinguished by agarose gel separation (Fig. 3). With these primers the expected PCR product size is 162 bp for the wild-type (+) allele and 183 bp for the mutant (spdh) allele. This PCR assay was then used to distinguish between +/+, +/spdh and spdh/spdh genotypes of mice at different stages of development.


Figure 3. PCR assay to distinguish mutant (spdh) from wild-type (+) Hoxd13 alleles. PCR products were separated on an agarose gel, stained with ethidium bromide and photographed under UV light. The wild-type allele product is 162 bp; the mutant allele is 183 bp. A 100 bp ladder is shown on the left. Lanes 1-8, progeny from intercross of spdh/+ heterozygotes; lanes 9-11, controls spdh/spdh, spdh/+ and+/+ respectively.


Abnormal autopod development in spdh/spdh mice

We compared cartilage and bone development between mutant and control forefeet and hindfeet at 15.5 days post-coitum (d.p.c.), 17.5 d.p.c., 0.5 days post-partum (d.p.p.) and 6 d.p.p. (Fig. 4). At 15.5 d.p.c. (Fig. 4a and e) no ossification was seen in either mutant or control feet. Cartilage condensations in mutant feet were similar in size to normal feet but abnormally patterned, with digital branching forming extra digits on both forefeet and hindfeet. At 17.5 d.p.c. (Fig. 4b and f) ossification of metacarpals and metatarsals was apparent in controls but no ossification was seen in mutant feet. At 0.5 d.p.p. (Fig. 4c and g) ossification of metacarpals, metatarsals and some phalanges was clearly visible in controls but not in mutant feet, except for a slight ossification of two tarsals (Fig. 4g). At 6 d.p.p. (Fig. 4d and h) some ossification had occurred in mutant feet, but ossification centers were unpatterned, with no elongation of phalangeal, metacarpal or metatarsal bones.


Figure 4. Development of autopods in normal and spdh/spdh mutant mice. In each panel a normal foot is shown on the left for comparison with the mutant foot on the right. Forefeet are shown in (a-d) and hindfeet in (e-h). (a and e) Alcian blue stained cartilage of 15.5 d.p.c. fetuses, magnification 12×; (b and f) alizarin red stained bones of 17.5 d.p.c. fetuses, magnification 10×; (c and g) 0.5 d.p.p. newborns, magnification 10×; (d and h) 6 d.p.p. mice, magnification 6×.


Abnormal urogenital development in spdh/spdh mice

Gross examination of the urogenital systems of adult spdh/spdh homozygotes revealed that the preputial glands were completely absent from all five males examined (Fig. 5) and the homologous clitoral glands were absent from all three females examined (not shown). In addition, the seminal vesicles in male homozygotes exhibited decreased folding (not shown), similar to that reported for transgenic Hoxd13-deficient mice (19). Grossly and histologically all other accessory sex organs in mutant mice were normal.


Figure 5. Absence of preputial glands in spdh/spdh male. Dissected genital tract of a homozygous mutant male (a) compared with a normal male (b). Arrows indicate the pair of preputial glands in a normal male.

Homozygous spdh/spdh males failed to breed with female mice of any strain. Neither mounting behavior nor vaginal plugs were ever observed; females never became pregnant. Testes and epididymus of spdh/spdh males looked grossly normal and histological examination revealed normal spermatogenesis and sperm number. Homozygous females bred with heterozygous or +/+ males and exhibited normal fertility; however, there was an ~3 month delay in attaining pregnancy after introduction of males.

DISCUSSION

We have discovered a new spontaneous mouse mutation of Hoxd13 and named it `synpolydactyly homolog' (spdh) to signify its phenotypic similarity to and homology with human synpolydactyly (SPD; OMIM 186000). The 21 bp duplication of the mouse spdh allele was probably the result of unequal crossing-over in a region of imperfect trinucleotide repeats, as has also been reported for the human HOXD13 mutations responsible for SPD(9-11). The naturally occurring mouse Hd mutation of Hoxa13 is also thought to be a product of misalignment and unequal exchange in a region of imperfect triplet repeats (4), attesting to the prevalence and importance of such mutations in nature.

The phenotype of spdh/spdh mice is much more severe than that exhibited by mice with a targeted disruption of Hoxd13 (13). Two possible molecular mechanisms of pathogenesis have been proposed that could underly this discrepancy in phenotype, one invoking homeodomain differences and the other polyalanine tract differences between the targeted and spontaneous mutations. The DNA binding homeodomain of the HOXD13 protein is not altered by the spdh mutation, as it is in the targeted mutation; therefore, defective spdh-encoded proteins could potentially compete for DNA binding sites with wild-type proteins and with other HOX proteins, thereby suppressing their functions. This dominant-negative effect has been previously suggested for human SPD mutations on the basis of the phenotypic similarity between SPD and mice with genetically engineered compound deficiencies in three Hoxd genes (15).

Alternatively, the polyalanine expansion encoded by the spdh mutation may confer a gain-of-function, such as an ability to bind another protein that might interfere with activity of the wild-type protein or with that of other HOX proteins. Human HOXD13 mutations have been reported that expand the normal stretch of 15 alanines to 22-29, and the severity of the phenotype appears to correlate with the size of these expansions, which might relate to increased binding affinities (11). The 22 alanines encoded by the mutant Hoxd13 gene in the mouse is at the low end of this observed expansion range and may help explain why heterozygous mice showed no affects. Lack of phenotypic expression in heterozygotes has also been documented for some cases of human SPD (10). There may be a threshold level of HOXD13 activity below which other HOX proteins can no longer functionally compensate.

The Hoxd13 gene is expressed in the most posterior-distal regions of the limbs when the autopod prechondrogenic pattern is being established (13). In 15 d.p.c. spdh/spdh mice (Fig. 4a and e), the cartilage pattern is disorganized, with digital branching and polydactyly. In contrast, the basic condensation pattern is not changed by the targeted Hoxd13 mutation (13). Both spdh/spdh mice (Fig. 4) and mice with targeted Hoxd13 disruptions (13) exhibit delays in ossification; however, in spdh/spdh mice there is no regular pattern of ossification centers and metacarpal, metatarsal and phalangeal bones do not exhibit normal growth along their proximal-distal axes (Fig. 4d and h). These gross developmental abnormalities result in the severe malformations seen in adult spdh/spdh feet (Fig. 1) and are similar to the severe alterations caused by a genetically engineered combined inactivation of Hoxd11, Hoxd12 and Hoxd13 (15). This similarity supports a pathological mechanism whereby the altered spdh-encoded HOXD13 protein somehow interferes with the activity of other AbdB-related HOX proteins, as previously discussed.

In addition to the distal limb, Hoxd13 is also highly expressed during fetal development in the most posterior part of the body axis, including the genital tubercle that gives rise to the external genitalia (17). During late gestation and early postnatal periods Hoxd13 is also highly expressed in the genitourinary tract (18,19). We examined the genital systems of spdh/spdh mice and discovered that the preputial glands are absent in both males and females. The preputial glands are paired, highly developed sebaceous glands found in both male and female mice; the female preputial gland is also known as the clitoral gland. These glands are located in the most posterior region of the genital tract. Genetically engineered Hoxd13-deficient mice also exhibit genitourinary abnormalities, including bulbourethral gland agenesis and abnormal seminal vesicle and prostate morphogenesis; however, preputial gland agenesis has not been reported in these mice (19).

The lack of preputial glands in spdh/spdh males could be responsible for their failure to breed. Preputial glands in male mice have pheromonal functions. Their secretions strongly attract females (21) and may accelerate estrus (22). Females that do not receive this olfactory signal may not exhibit solicitation behavior or other cues needed to elicit a male sexual response. In contrast, preputial (clitoral) glands in female rodents are a minor source of olfactory stimuli contributing to sexual attractivity (23). This minimal role could explain why the absence of clitoral glands in spdh/spdh females has little affect on breeding performance, other than a delay in attaining pregnancy after male introduction. Male preputial secretions have also been implicated in intermale aggression (24). Although we have not carried out controled behavioral studies, we have never observed intermale conflicts involving spdh/spdh males.

The spdh mutation provides a phenotypically and molecularly accurate model for the homologous human condition synpolydactyly (OMIM 186000). The phenotype of the mouse spdh mutation is much more severe than that exhibited by mice with a targeted, presumably null, disruption of Hoxd13. Thus the spdh mutation probably acts in a dominant-negative manner, perhaps with other AbdB-related Hox genes, and will be valuable for examining interactions with these genes and their protein products during autopod and genital tract development. Because they lack preputial glands, spdh/spdh mice may also be valuable in studies of reproductive physiology and behavior.

MATERIALS AND METHODS

Mice and genetic mapping

All mice used in this study were obtained from the Mouse Mutant Resource colony of the Jackson Laboratory (Bar Harbor, ME). PCR primer pairs (MapPairs) for microsatellite markers distributed throughout the mouse genome were purchased from Research Genetics (Huntsville, AL) and typing was performed as previously described (25), except that PCR reactions were carried out for 30 cycles and products were separated on 3% agarose gels (Metaphor) and visualized by ethidium bromide staining. Gene order, determined by minimizing the number of obligate cross-over events, and recombination frequency estimates were calculated with the aid of the Map Manager computer program (26).

PCR and DNA sequencing

Primer sequences were designed to amplify overlapping portions of the mouse Hoxd13 sequence (GenBank accession no. X99291); all are presented here in the 5[prime]->3[prime] orientation. To amplify nt 3-266 the forward primer (F1) was GAGCCGCTCGGGGACTTGGGACAT and the reverse primer (R1) GCCGAGGATGACGACGACGACGAA. To amplify nt 202-743 the forward primer (F2) was TCCACGTTCGCTTACCCAGGGACC and the reverse primer (R2) GAACCCTGTGGCTGATCCTTGGCA. To amplify nt 769-1020, which represents the second exon and includes the homeobox, we used previously described flanking primers (14): forward (F3) GCTTAGGTGTTCCAAGTATCCAG and reverse (R3) CCACATCAGGAGACAGTGTCTTT. To detect the duplication in the polyalanine-encoding region by PCR product size separation in agarose gels, nt 72-233 were amplified with the forward primer (F4) CTCCTCCTCCTCCTCCGTAG and the reverse primer (R4) CGCTCAGAGGTCCCTGGGTA.

The following reaction conditions were used for all PCR amplifications: 20-50 ng genomic DNA, 50 mM KCl, 10 mM Tris-HCl, 0.01% Triton X-100, 2.25 mM MgCl2, 100 nM each primer, 100 µM each of four deoxyribonucleoside triphosphates and 0.5 U Taq DNA polymerase. For primers with high GC content, DMSO was added to the reaction mix. A final concentration of 10% DMSO was used with primer pairs F1/R1 and F2/R2 and 14% with primer pair F4/R4.

Amplification consisted of one cycle of denaturation at 94°C for 3 min, followed by 35 cycles of denaturation at 94°C for 15 s, annealing at 60°C for 2 min (for the shorter primers F4 and R4 the annealing temperature was 51°C) and extension at 72°C for 2 min. After the 35 cycles the final product was extended for 7 min at 72°C. The gels were run on 2.5% Metaphor agarose gels, stained with ethidium bromide and visualized with UV light.

PCR-amplified DNA products were excised from gels, purified with a QIAquick Gel Extraction Kit (Qiagen, Valencia, CA) and sequenced using an Applied Biosystems 373A DNA Sequencer and an optimized dye deoxy terminator cycle sequencing method. The same primers used for PCR amplification were also used for cycle sequencing.

Staining of cartilage and bone

Adult limbs were cleared and bones stained with alizarin red S by the standard method described by Green (27). Cartilage and bone of embryos and neonates from timed matings were stained with alcian blue and alizarin red S according to McLeod (28).

ACKNOWLEDGEMENTS

We thank Sarah Riesman, a Mount Desert Island High School intern at the Jackson Laboratory, for her help with much of the initial mapping effort. We thank Amy Lambert and Doug McMinimy (the Jackson Laboratory Microchemistry Service) for rapid and high quality DNA sequencing. We also thank Drs Achim Gossler and Tim O'Brien for their careful review of this manuscript. This study was supported by National Institutes of Health (NIH) grants GM46697, RR01183 and CA34196.

REFERENCES

1. Izpisua-Belmonte, J.-C. and Duboule, D. (1992) Homeobox genes and pattern formation in the vertebrate limb. Dev. Biol., 152, 26-36. MEDLINE Abstract

2. Fromental-Ramain, C., Warot, X., Messadecq, N., LeMeur, M., Dolle, P. and Chambon, P. (1996) Hoxa-13 and Hoxd-13 play a crucial role in the patterning of the limb autopod. Development, 122, 2997-3011. MEDLINE Abstract

3. Johnson, R.L. and Tabin, C.J. (1997) Molecular models for vertebrate limb development. Cell, 90, 979-990. MEDLINE Abstract

4. Mortlock, D.P., Post, L.C. and Innis, J.W. (1996) The molecular basis of hypodactyly (Hd): a deletion in Hoxa13 leads to arrest of digital arch formation. Nature Genet., 13, 284-289. MEDLINE Abstract

5. Hummel, K.P. (1970) Hypodactyly, a semidominant lethal mutation in mice. J. Hered., 61, 219-220. MEDLINE Abstract

6. Robertson, K.E., Chapman, M.H., Adams, A., Tickle, C. and Darling, S.M. (1996) Cellular analysis of limb development in the mouse mutant hypodactyly. Dev. Genet., 19, 9-25. MEDLINE Abstract

7. Peichel, C.L., Prabhakaran, B. and Vogt, T.F. (1997) The mouse Ulnaless mutation deregulates posterior HoxD gene expression and alters appendicular patterning. Development, 124, 3481-3492. MEDLINE Abstract

8. Herault, Y., Fraudeau, N., Zakany, J. and Duboule, D. (1997) Ulnaless (Ul), a regulatory mutation inducing both loss-of-function and gain-of-function of posterior Hoxd genes. Development, 124, 3493-3500. MEDLINE Abstract

9. Muragaki, Y., Mundlos, S., Upton, J. and Olsen, B.R. (1996) Altered growth and branching patterns in synpolydactyly caused by mutations in HOXD13. Science, 272, 548-551. MEDLINE Abstract

10. Akarsu, A.N., Stoilov, I., Yilmaz, E., Sayli, B.S. and Sarfarazi, M. (1996) Genomic structure of HOXD13 gene: a nine polyalanine duplication causes synpolydactyly in two unrelated families. Hum. Mol. Genet., 5, 945-952. MEDLINE Abstract

11. Goodman, F.R., Mundlos, S., Muragaki, Y., Donnai, D., Giovannucci-Uzielli, M.L., Lapi, E., Majewski, F., McGaughran, J., McKeown, C., Reardon, W., Upton, J., Winter, R.M., Olsen, B.R. and Scambler, P.J. (1997) Synpolydactyly phenotypes correlate with size of expansions in HOXD13 polyalanine tract. Proc. Natl Acad. Sci. USA, 94, 7458-7463. MEDLINE Abstract

12. Akarsu, A.N., Akhan, O., Sayli, B.S., Sayli, U., Baskaya, G. and Sarfarazi, M. (1995) A large Turkish kindred with syndactyly type II (synpolydactyly): 2 homozygous phenotypes. J. Med. Genet., 32, 435-441. MEDLINE Abstract

13. Dolle, P., Dierich, A., LeMeur, M., Schimmang, T., Schuhbaur, B., Chambon, P. and Duboule, D. (1993) Disruption of the Hoxd-13 gene induces localized heterochrony leading to mice with neotenic limbs. Cell, 75, 431-441. MEDLINE Abstract

14. Davis, A.P. and Capecchi, M.R. (1996) A mutational analysis of the 5[prime] HoxD genes: dissection of genetic interactions during limb development in the mouse. Development, 122, 1175-1185. MEDLINE Abstract

15. Zakany, J. and Duboule, D. (1996) Synpolydactyly in mice with a targeted deficiency in the HoxD complex. Nature, 384, 69-71. MEDLINE Abstract

16. Rijli, F.M. and Chambon, P. (1997) Genetic interactions of Hox genes in limb development: learning from compound mutants. Curr. Opin. Genet. Dev., 7, 481-487. MEDLINE Abstract

17. Dolle, P., Izpisua-Belmonte, J.-C., Brown, J.M., Tickle, C. and Duboule, D. (1991) Hox-4 genes and the morphogenesis of mammalian genitalia. Genes Dev., 5, 1767-1776. MEDLINE Abstract

18. Oefelein, M., Chin-Chance, C. and Bushman, W. (1996) Expression of the homeotic gene Hoxd-13 in the developing and adult mouse prostate. J. Urol., 155, 342-346. MEDLINE Abstract

19. Podlasek, C.A., Duboule, D. and Bushman, W. (1997) Male accessory sex organ morphogenesis is altered by loss of function of Hoxd-13. Dev. Dynam., 208, 454-465.

20. Mortlock, D.P. and Innis, J.W. (1997) Mutation of HOXA13 in hand-foot-genital syndrome. Nature Genet., 15, 179-180. MEDLINE Abstract

21. Bronson, F.H., and Caroom, D. (1971) Preputial gland of the male mouse; attractant function. J. Reprod. Fertil., 25, 279-282. MEDLINE Abstract

22. Chipman, R.K. and Albrecht, E.D. (1974) The relationship of the male preputial gland to the acceleration of oestrus in the laboratory mouse. J. Reprod. Fertil., 38, 91-96. MEDLINE Abstract

23. Merkx, J., Slob, A.K. and van der Werff ten Bosch, J.J. (1988) The role of the preputial glands in sexual attractivity of the female rat. Physiol. Behav., 42, 59-64. MEDLINE Abstract

24. Mugford, R.A. and Nowell, N.W. (1971) The preputial gland as a source of aggression-promoting odors in mice. Physiol. Behav., 6, 247-249. MEDLINE Abstract

25. Dietrich, W., Katz, H., Lincoln, S.E., Shin, H.-S., Friedman, J., Dracopoli, N.C. and Lander, E.S. (1992) A genetic map of the mouse suitable for typing intraspecific crosses. Genetics, 131, 423-447. MEDLINE Abstract

26. Manly, K.F. (1993) A Macintosh program for storage and analysis of experimental genetic mapping data. Mamm. Genome, 4, 303-313. MEDLINE Abstract

27. Green, M. (1952) A rapid method for clearing and staining specimens for the demonstration of bone. Ohio J. Sci., 52, 31-33.

28. McLeod, M.J. (1980) Differential staining of cartilage and bone in whole mouse fetuses by alcian blue and alizarin red S. Teratology, 22, 299-301. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +1 207 288 6228; Fax: +1 207 288 6149; Email: krj@jax.org


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 12 May 1998
Copyright©Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GeneticsHome page
O. Cocquempot, V. Brault, C. Babinet, and Y. Herault
Fork Stalling and Template Switching As a Mechanism for Polyalanine Tract Expansion Affecting the DYC Mutant of HOXD13, a New Murine Model of Synpolydactyly
Genetics, September 1, 2009; 183(1): 23 - 30.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
Z. Wang, L. Yuan, S. J. Rossiter, X. Zuo, B. Ru, H. Zhong, N. Han, G. Jones, P. D. Jepson, and S. Zhang
Adaptive Evolution of 5'HoxD Genes in the Origin and Diversification of the Cetacean Flipper
Mol. Biol. Evol., March 1, 2009; 26(3): 613 - 622.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
K. Anan, N. Yoshida, Y. Kataoka, M. Sato, H. Ichise, M. Nasu, and S. Ueda
Morphological Change Caused by Loss of the Taxon-Specific Polyalanine Tract in Hoxd-13
Mol. Biol. Evol., January 1, 2007; 24(1): 281 - 287.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
B Dlugaszewska, A Silahtaroglu, C Menzel, S Kubart, M Cohen, S Mundlos, Z Tumer, K Kjaer, U Friedrich, H-H Ropers, et al.
Breakpoints around the HOXD cluster result in various limb malformations
J. Med. Genet., February 1, 2006; 43(2): 111 - 118.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. W. Fondon III and H. R. Garner
Molecular origins of rapid and continuous morphological evolution
PNAS, December 28, 2004; 101(52): 18058 - 18063.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. N. Albrecht, U. Kornak, A. Boddrich, K. Suring, P. N. Robinson, A. C. Stiege, R. Lurz, S. Stricker, E. E. Wanker, and S. Mundlos
A molecular pathogenesis for transcription factor associated poly-alanine tract expansions
Hum. Mol. Genet., October 1, 2004; 13(20): 2351 - 2359.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Amiel, D. Trochet, M. Clement-Ziza, A. Munnich, and S. Lyonnet
Polyalanine expansions in human
Hum. Mol. Genet., October 1, 2004; 13(suppl_2): R235 - R243.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Lavoie, F. Debeane, Q.-D. Trinh, J.-F. Turcotte, L.-P. Corbeil-Girard, M.-J. Dicaire, A. Saint-Denis, M. Page, G. A. Rouleau, and B. Brais
Polymorphism, shared functions and convergent evolution of genes with sequences coding for polyalanine domains
Hum. Mol. Genet., November 15, 2003; 12(22): 2967 - 2979.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
D. C. Rubinsztein
How Does the Huntington's Disease Mutation Damage Cells?
Sci. Aging Knowl. Environ., September 17, 2003; 2003(37): pe26 - 26.
[Abstract] [Full Text]


Home page
DevelopmentHome page
R. Yamada, Y. Mizutani-Koseki, T. Hasegawa, N. Osumi, H. Koseki, and N. Takahashi
Cell-autonomous involvement of Mab21l1 is essential for lens placode development
Development, May 1, 2003; 130(9): 1759 - 1770.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
L Frisen, K Lagerstedt, M Tapper-Persson, I Kockum, and A Nordenskjold
A novel duplication in the HOXA13 gene in a family with atypical hand-foot-genital syndrome
J. Med. Genet., April 1, 2003; 40(4): e49 - 49.
[Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. C. Dorsman, B. Pepers, D. Langenberg, H. Kerkdijk, M. Ijszenga, J. T. den Dunnen, R.A.C. Roos, and G.-J. B. van Ommen
Strong aggregation and increased toxicity of polyleucine over polyglutamine stretches in mammalian cells
Hum. Mol. Genet., June 15, 2002; 11(13): 1487 - 1496.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. P. Bao, L. J. Cook, D. O'Donovan, E. Uyama, and D. C. Rubinsztein
Mammalian, Yeast, Bacterial, and Chemical Chaperones Reduce Aggregate Formation and Death in a Cell Model of Oculopharyngeal Muscular Dystrophy
J. Biol. Chem., March 29, 2002; 277(14): 12263 - 12269.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Y. Hagiwara, T. Sasaoka, K. Araishi, M. Imamura, H. Yorifuji, I. Nonaka, E. Ozawa, and T. Kikuchi
Caveolin-3 deficiency causes muscle degeneration in mice
Hum. Mol. Genet., December 1, 2000; 9(20): 3047 - 3054.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Vaxillaire, A. Abderrahmani, P. Boutin, B. Bailleul, P. Froguel, M. Yaniv, and M. Pontoglio
Anatomy of a Homeoprotein Revealed by the Analysis of Human MODY3 Mutations
J. Biol. Chem., December 10, 1999; 274(50): 35639 - 35646.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
R. Smits, M. F. Kielman, C. Breukel, C. Zurcher, K. Neufeld, S. Jagmohan-Changur, N. Hofland, J. van Dijk, R. White, W. Edelmann, et al.
Apc1638T: a mouse model delineating critical domains of the adenomatous polyposis coli protein involved in tumorigenesis and development
Genes & Dev., May 15, 1999; 13(10): 1309 - 1321.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (51)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Johnson, K. R.
Right arrow Articles by Davisson, M. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnson, K. R.
Right arrow Articles by Davisson, M. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?