Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (26)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Matsumura, Y.
Right arrow Articles by Takebe, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsumura, Y.
Right arrow Articles by Takebe, H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 969-974  

Characterization of molecular defects in xeroderma pigmentosum group F in relation to its clinically mild symptoms
Introduction
Results
Discussion
Materials And Methods
   Cell lines
   RNA extraction and northern blot analysis
   cDNA synthesis and PCR-SSCP
   Sequencing
   Western blot analysis
Acknowledgements
References

Characterization of molecular defects in xeroderma pigmentosum group F in relation to its clinically mild symptoms

Characterization of molecular defects in xeroderma pigmentosum group F in relation to its clinically mild symptoms

Yasuhiro Matsumura1,2, Chikako Nishigori2, Takashi Yagi1,*, Sadao Imamura2, Hiraku Takebe1

Departments of 1Radiation Genetics and 2Dermatology, Graduate School of Medicine, Kyoto University, Yoshida-Konoe-cho, Sakyo-ku, Kyoto 606-01, Japan

Received December 1, 1997; Revised and Accepted March 20, 1998

Xeroderma pigmentosum (XP) complementation group F was first reported in Japan and most XP-F patients reported to date are Japanese. The clinical features of XP-F patients are rather mild, including late onset of skin cancer. Recently a cDNA that corrects the repair deficiency of cultured XP-F cells was isolated. The XPF protein forms a tight complex with ERCC1 and this complex functions as a structure-specific endonuclease responsible for the 5[prime] incision during DNA excision repair. Here we have identified XPF mRNA mutations and examined levels of the mRNA and protein expression in seven primary cell strains from Japanese XP-F patients. The XP-F cell strains were classified into three types in terms of the effect of the mutation on the predicted protein; (i) XPF proteins with amino acid substitutions; (ii) amino acid substituted and truncated XPF proteins; and (iii) truncated XPF protein only. A normal level of expression of XPF mRNA was observed in XP-F cells but XPF protein was extremely low. These results indicate that the detected mutations lead to unstable XPF protein, resulting in a decrease in formation of the ERCC1-XPF endonuclease complex. Slow excision repair of UV-induced DNA damage due to low residual endonuclease activity provides a plausible explanation for the typical mild phenotype of XP-F patients.

INTRODUCTION

Xeroderma pigmentosum (XP) is a rare autosomal recessive disease characterized by extremely high sun sensitivity of the skin and high incidence of skin cancers (1). XP has been classified into seven genetic complementation groups (A-G) of the nucleotide excision repair (NER)-deficient type and a NER-proficient variant type. More than 10 XP-F patients have been reported so far (2), most of them Japanese.

XP-F is characterized by mild clinical features. All XP-F patients show slightly high sun sensitivity of the skin. Onset of skin cancers in XP-F patients is later than in patients in other complementation groups. Most XP-F patients have no neurological abnormalities. The average age of the XP-F patients first visiting dermatologists is much higher than that of patients in other complementation groups. Fibroblast cells derived from the XP-F patients are not so sensitive to UV as those derived from XP-A patients and have a low and long-lasting capability of unscheduled DNA synthesis (UDS) after UV irradiation, which is thought to be a cause of the mild clinical features of the XP-F patients (3).

A cDNA that corrects the repair deficiency of XP-F cells has recently been isolated (4,5). XPF protein binds tightly to ERCC1 protein in vivo and the complex has structure-specific endonuclease activity (4). The XPF-ERCC1 complex and XPG protein incise respectively at positions 15 bases 5[prime] and 8 bases 3[prime] of the lesion on a DNA strand during the NER pathway.

In XP-F cells the levels of XPF and ERCC1 proteins are extremely low (6). Because no ERCC1 gene alteration has been found in XP-F cells (7), the repair deficiency of XP-F cells should be due to an XPF gene alteration. Here we report identification of XPF mRNA mutations and levels of XPF mRNA and XPF protein expression in seven XP-F cell strains from Japanese patients (8-12).

RESULTS

To identify mutations in XPF mRNA, 10 overlapping fragments of XPF cDNA (sections 1-10, 310-330 bp for each section) were amplified by reverse transcription-polymerase chain reaction (RT-PCR) from XP-F cells. In single strand conformation polymorphism (SSCP) analyses of those fragments, XP23OS section 5 and XP1TS section 7 showed only aberrantly migrating bands (Fig. 1a). Direct sequencing of the RT-PCR products of these sections revealed that XP23OS has a 1 bp insertion (an adenine between nt 1330 and 1331), which results in a frameshift of codon 444 and the appearance of a stop codon at codon 482 (Fig. 1a, Table 1). To confirm mutation of XP23OS, XPF cDNA section B (see Materials and Methods), supposed to contain the mutation, was amplified by RT-PCR from freshly isolated RNA from the cells and cloned into plasmid pCR2.1. Sequencing of eight independent clones revealed that all have the same 1 bp insertion. XP1TS was found to have a 21 bp deletion from nt 1779 to 1799, which results in a deletion of seven amino acids (Val594-Gly600) without frameshift. This deletion could be caused by aberrant RNA splicing due to a point mutation at the splicing site. Loss of normal bands in SSCP and the absence of overlapping base peaks in electrophoretograms of the direct sequencing analysis strongly supports the idea that a single major species of mutated XPF mRNA is transcribed in XP23OS and XP1TS cells. This is consistent with the idea that either the XPF gene is homozygously mutated or that one allele of the heterozygously mutated XPF gene is inactivated in patients.

Table 1. Clincal features of XP-F patients and detected mutations
Patient Agea, sex UDSb (D10c) Skin tumor (aged, typee) Neurological abnormality Mutation Amino acid change
XP7KA 42, F 19% (2.9) 40, BCE (-) Base substitution (1471, G->A)
Base substitution (1553, T->C)		 Glu491->Lys (GAA->AAA)
Ile518->Thr (ATT->ACT)
XP2YO 64, F 17% (2.5) 62, SCC (-) 1 bp deletion (1937, T)
Base substitution (1666, A->G)		 Glu646-Stop673
Thr556->Ala (ACA->GCA)
XP3YO 29, M 15% (3.7) 26, KA (-) Base substitution (1436, G->A)
Base substitution (1790, T->C)		 Arg479->Gln (CGG->CAG)
Leu599->Pro (CTT->CCT)
XP101OS 49, F 15% (5.0) 43, BCE (-) Base substitution (642, A->G)
Base substitution (1504, G->A)		 Ile214->Met (ATA->ATG)
Gly502->Arg (GGA->AGA)
XP24KY 48, M 7% (4.2) (-) Mental retardation
Cerebellar ataxia		 10 bp deletion (1575-1584)
Base substitution (1327, A->T)		 Val525-Stop533
Arg443->Trp (AGG->TGG)
XP23OS 45, F 10% (2.8) (-) (-) 1 bp insertion (1330-1331, A) Lys444-Stop482
XP1TS 73, F 19% (4.4) 72, BCE (-) 21 bp deletion (1779-1799) Val594-Gly600
aAge at first visit to hospital.
bUDS, unscheduled DNA synthesis after 30 J/m2 UVC irradiation, % of normal fibroblasts.
cD10, dose of UVC (J/m2) which gives 10% survival.
dAge at which skin tumor first observed.
eBCE, basal cell epithelioma; SCC, squamous cell carcinoma; KA, keratoacanthoma.


Figure 1. Mutations of XPF mRNAs in XP-F patients. (a) The RT-PCR-SSCP bands and the sequences of XP23OS section 5 and XP1TS section 7 and DNA fragments eluted from the shifted band in SSCP analysis of XP24KY section 6 determined by direct sequencing. (b) The identification of mutations of the other allele of XP24KY and in other XP-F cell lines (XP7KA, XP2YO, XP3YO and XP101OS) which exhibited no shifted band in the SSCP analyses. The cDNAs amplified by RT-PCR were cloned in plasmids and sequenced. XP23OS and XP1TS express a single species of mRNA with a mutation. Other cells express two kinds of mRNA with mutations (1) and (2) shown.


XP24KY section 6 showed a shifted band in addition to normal bands in the SSCP analysis and direct sequencing of the shifted band isolated from the gel revealed a 10 bp deletion from nt 1575 to 1584, which results in deletion of three codons plus a frameshift that produces a stop codon at codon 533. No mutation was found in the normal mobility bands of section 6 of XP24KY.

To identify mutations on the other allele of XP24KY and in other XP-F cells (XP7KA, XP2YO, XP3YO and XP101OS) which exhibited no shifted bands in the SSCP analyses, probably due to insensitivity of the method, we amplified four overlapping fragments (sections A-D, 710-740 bp for each section) of XPF cDNA from each cell and cloned the fragments into vectors, followed by sequencing of the entire XPF cDNA sequences (Fig. 1b). The other allele of XP24KY exhibited an A->T transition at nt 1327, leading to an amino acid change (R443W). In XP7KA, XP3YO and XP101OS a different base substitution was detected in each allele. All base substitutions in these cells were found at different bases in XPF cDNA (Table 1). XP2YO cells had an A->G transversion at nt 1666 (T556A) in one allele and one thymine deletion in the other allele at nt 1937, which results in a frameshift at codon 646 and the appearance of a stop codon at codon 673. XP2YO cells had another base substitution at nt 2075 (D692G), which has been reported as a sequence polymorphism (4). In summary (Fig. 2), the examined XP-F cells are classified into three types in terms of their putatively expressed proteins expected from the mutations; (i) two kinds of XPF amino acid substitutions (XP7KA, XP3YO and XP101OS); (ii) amino acid substitutions and truncations (XP2YO and XP24KY); and (iii) as far as can be detected, a truncated XPF protein only (XP23OS and XP1TS).


Figure 2. The structure of XPF protein and the sites of the mutations in XPF mRNA. Bars (*) indicate the regions which are highly conserved among Saccharomyces cerevisiae Rad1, Schizosaccharomyces pombe rad16 and Drosophila melanogaster MEI-9.

The XPF mRNA was detected slightly below the position of 28S rRNA in northern blot analysis (Fig. 3a). The size is ~3.8 kb and the level of its expression is almost the same in all XP-F cells as well as in normal fibroblasts. However, no clear band corresponding to XPF protein (~120 kDa) could be detected in any extract from XP-F cells, in contrast to normal and XP-A cells in western blot analysis (Fig. 3b).


Figure 3. (a) Expression of XPF mRNA in XP-F cells and normal fibroblasts (KOWA) examined by northern blot analysis. Expression of [beta]-actin was also examined as a control. Positions of XPF and [beta]-actin mRNAs are shown by arrows on the ethidium bromide stained gel used for the northern blots. (b) Western blot analysis of XP-F, XP6EH (XP-A) and KOWA (normal) cells using affinity-purified polyclonal anti-XPF antibody. An arrow shows the position of XPF protein of size ~120 kDa.


DISCUSSION

The XPF gene has two regions which are highly conserved throughout different species. The N-terminal region, extending from amino acid 86 to 333, contains two leucine zipper motifs and is thereby supposed to take part in protein-protein interactions. The only mutation detected within this region is one of the compound heterozygous point mutations in XP101OS and all the examined XP-F cells retain at least one normal allele for this region, which may suggest that this part is essential for basic cellular function.

The C-terminal region, extending from amino acid 559 to 823, is supposed to contain the ERCC1 binding domain, based on studies of the homologous yeast Rad1-Rad10 complex (13). Mutations in one allele of XP3YO and both alleles of XP2YO and XP1TS are observed within this domain and XP23OS cells completely lack this region. These patients did not exhibit more severe clinical symptoms in terms of sun sensitivity and tumorigenesis compared with other XP-F patients and the cells derived from these patients have a low capability to perform UDS after UV irradiation. These results indicate that mutations in this region would not lead to complete dysfunction of the NER system.

XP23OS cells are unique because they seem to express a single mutated XPF mRNA which encodes a protein completely lacking the C-terminal half. This suggests that XP23OS has a homozygously mutated XPF gene or, alternatively, that one allele is transcriptionally inactivated or repressed by deletion, methylation or imprinting of a normal allele. Analysis of the XPF gene mutation is required to settle this point. Patient XP23OS did not exhibit more severe symptoms compared with other XP-F patients (Table 1); she had been without any skin tumor to the age of 45 when she visited the hospital with mild dermatosis. Neither did she show neurological abnormalities. This result supports the idea that the N-terminal half of the XPF protein (residues 1-443) is important for the process of NER. Detection of the truncated XPF protein is difficult by immunoblotting because of the quality of the antibody (Fig. 3b). Therefore, low amounts of the truncated protein might be expressed in XP23OS cells. By analysis of XPA mutations in XP group A patients (XP-A), Satokata et al. (14) and ourselves (15) found a few examples showing that extremely low levels of truncated XPA protein caused by a single point mutation reduce the severity of the symptoms of the patient. Similarly, the low level of UV-induced UDS and intermediate UV sensitivity of all the XP-F cells may be due to the existence of a marginal amount of mutated protein.

XP24KY, who is the only patient with neurological disorders, mental retardation and cerebellar ataxia among the XP-F cases in the present study, is supposed to have a truncated protein which is deficient in the C-terminal half (residues 533-905) and a protein with a single amino acid substitution (R443W). The truncated protein is probably not responsible for the neurological disorders because XP23OS, who has a truncated protein lacking a region from amino acid residue 482 to the end, did not show any neurological disorder. The R443W mutation might be critical in connection with the neurological symptoms, however, the site of the mutation is not located within the leucine-rich region of XPF protein or the highly conserved domain of the XPF gene. A chance association of XP-F with the neurological abnormalities is also possible.

ERCC1-XPF complex has an intrinsic structure-specific endonuclease activity and XPF is supposed to be necessary for stabilizing ERCC1 protein (4,16,17). ERCC1 is supposed to be a catalytic subunit of the endonuclease, inferred from its homology to Escherichia coli uvrC and yeast Rad10 (18). Mutations of XPF mainly affecting its C-terminal region interfere with complex formation, which may result in rapid degradation of ERCC1. The degree of UV sensitivity may correlate with the amount of ERCC1 protein in cells. As complete loss of ERCC1 protein results in a severe phenotype, e.g. early death, in mice (19,20), ERCC1 is thought to be essential for post-natal life. The relatively mild clinical symptoms of XP-F patients could be explained by an incomplete loss of ERCC1 protein. We previously reported that the levels of both ERCC1 and a 120 kDa protein, presumed to be XPF, were strongly reduced but apparently still retained in the same XP-F cells used in this study (6). However, it is impossible to conclude in this study whether XPF protein, especially its N-terminal region, is indispensable or not for post-natal life, because cells completely lacking XPF expression have not yet been characterized. If XPF knockout animals can be established and show mild UV sensitivity, the low levels of free ERCC1 protein present are sufficient for post-natal life and to perform the residual NER that reduces severity of the clinical symptoms. If XPF knockout is lethal, as is ERCC1 knockout, XPF should be indispensable for post-natal life.

In the present study the level of XPF mRNA expression is almost the same in all XP-F cells as well as normal fibroblasts in northern blot analyses, implying that point mutations in the XPF gene lead to rapid degradation of XPF protein and consequently decreased ERCC1-XPF endonuclease complex formation. The residual low endonuclease activity might cause the slow NER of UV-induced DNA damage and the typical mild phenotype of XP-F patients. All XP-F patients identified so far have point mutations in the XPF gene and, therefore, they may express a marginal amount of XPF protein, even if it is not detected by western blotting. However, in XP23OS we detect only XPF RNA with an early frameshift mutation. Further research will establish whether this is the only allele expressed or whether a small amount of protein is derived from the other XPF allele.

MATERIALS AND METHODS

Cell lines

Seven diploid fibroblast cell strains derived from XP-F patients, XP7KA, XP2YO, XP3YO, XP101OS, XP24KY, XP23OS and XP1TS, were used (8-12). The cellular and clinical characteristics are summarized in Table 1. Other diploid fibroblast cell strains, KOWA (normal primary fibroblasts) and XP6EH (XP-A), were also used (21). The cells were cultured in minimum essential medium with 10% fetal calf serum.

RNA extraction and northern blot analysis

RNA was extracted from 1-2 × 107 cells using an RNAeasy kit (Qiagen). Thirty micrograms of total RNA were used in northern blot analysis. Preparation of nylon membranes (BioTrace) and hybridization were carried out as described in the protocol supplied by the manufacturer. XPF and [beta]-actin cDNAs were radiolabeled by the random priming method with a Rediprime kit (Amersham) and used as probes.

cDNA synthesis and PCR-SSCP

Synthesis of cDNA was carried out using the SuperScript Preamplification System (Life Technologies). The XPF cDNA was amplified as 10 overlapping fragments of ~320 bp (named sections 1-10) by ExTaq (exo+) DNA polymerase (Takara). The primers used for each section were as follows: L1, 5[prime]-ATAGGTACCGGCTCGACGGATTGCCAT, and R1, 5[prime]-CGCTCTAGACAAGTATCCTACTTGTCGCA; L2, 5[prime]-ATAGGTACCA- GTTTACACACAAGGTGGTG, and R2, 5[prime]-CGCTCTAGATCAGGTTTGTGCTGTTCTAA; L3, 5[prime]-ATAGGTACCAGGTTCCATGTAGCAGTA, and R3, 5[prime]-CGCTCTAGAGATACTGC- AGCAAAGTTCGT; L4, 5[prime]-ATAGGTACCTAAATCCTTAGTTCAGGAT, and R4, 5[prime]-CGCTCTAGAATACTTCAGTCAGTGCCTC; L5, 5[prime]-ATAGGTACCAGGAACTGGTCCTA- GAAAGC, and R5, 5[prime]-CGCTCTAGATGGTAGAAGCCCGTTCTTTG; L6, 5[prime]-ATAGGTACCGAGAATTAGGAAATCTCACA, and R6, 5[prime]-CGCTCTAGAGTACCCTTGTCAGAG- CATAG; L7, 5[prime]-ATAGGTACCGCTTCTGGGTTGCAGCGAC, and R7, 5[prime]-CGCTCTAGAACATCTGCAGATGCTGTGC; L8, 5[prime]-ATAGGTACCAAACTTAGACCTAGTAAGA, and R8, 5[prime]- CGCTCTAGACTCAATCAGAAGCACGGGA; L9, 5[prime]-ATAG- GTACCATGTCCCGCTACTACAAGC, and R9, 5[prime]-CGCTCT- AGAGTCTTGGGGACCAGGATTA; L10, 5[prime]-ATAGGTACCGCCATTACAGCAGATTCCGA, and R10, 5[prime]-CGCTCTAGATGTCTGGCAAGGAGCCGCT. SSCP analysis was per- formed as described previously (22).

Sequencing

As XP23OS section 5 and XP1TS section 7 were deficient in normal bands in the SSCP analyses, direct sequencing of the RT-PCR products was performed with the PRISM Dyedeoxy Terminator FS Sequencing Kit in an Applied Biosystems Model 373A automated sequencer. In the case of XP24KY section 6, with a shifted band in addition to a normal band, the DNA fragment eluted from each SSCP band was reamplified with the same primers and direct sequencing was performed as mentioned above on each PCR product. The cDNAs of XP23OS, XP24KY and other XP-F cells (XP7KA, XP2YO, XP3YO and XP101OS) were used as templates for another PCR procedure to amplify four overlapping fragments of ~710-740 bp (sections A-D). The primers used for each section were as follows: L1 and R3.5, 5[prime]-TCTTCCACTTCAAGC (section A); L3.5, 5[prime]-ATGCCATAACCCATC, and R5 (section B); L6 and R8.5, 5[prime]-TGTCAATGTCCCGAC (section C); L8.5, 5[prime]-CATCTCTGATCCATC, and R10 (section D). Each PCR product was ligated into plasmid pCR 2.1 and introduced into INV-[alpha]-F[prime] competent Escherichia coli cells (Invitrogen) according to the manufacturer's instructions, followed by PRISM Dyeprimer DNA sequencing (Applied Biosystems) with an automated sequencer. At least six independent clones were sequenced for each fragment from both directions and mutations were confirmed by obtaining the same result in more than two independent clones. In order to confirm that two different mutations detected in the same cDNA are located on different alleles, longer PCR fragments which contained both the mutation sites were amplified, ligated into plasmids and sequenced by the automated sequencer. Any base change apparently due to misincorporation by ExTaq polymerase during PCR was not detected in this study.

Western blot analysis

Western blotting was performed as described previously (6). XPF protein was detected with affinity-purified anti-XPF polyclonal antibody and with horseradish peroxidase-conjugated protein A using the Renaissance Western Blot Chemiluminescence Kit (Dupont).

ACKNOWLEDGEMENTS

We would like to especially thank Dr Richard D. Wood for giving us important comments and discussions throughout this study, Drs Mahmud S. Shivji, Nicolaas G.J. Jaspers and Anneke M. Sijbers for valuable discussions on our data and Ms Maureen Biggerstaff for her technical help. This study was supported by Grants-in-Aid from the Ministry of Education, Science, Sports and Culture, Japan, and by a grant from the Showa-Shell Environmental Research Foundation.

REFERENCES

1. Kraemer, K.H., Lee, M.M. and Scotto, J. (1987) Xeroderma pigmentosum: cutaneous, ocular and neurologic abnormalities in 830 published cases. Arch. Dermatol., 123, 241-250. MEDLINE Abstract

2. Tanaka, K. (1993) Molecular analysis of xeroderma pigmentosum group A gene. Jpn J. Hum. Genet., 38, 1-14. MEDLINE Abstract

3. Hayakawa, H., Ishizaki, K., Inoue, M., Yagi, T., Sekiguchi, M. and Takebe, H. (1981) Repair of ultraviolet radiation damage in xeroderma pigmentosum cells belonging to complementation group F. Mutat. Res., 80, 381-388. MEDLINE Abstract

4. Sijbers, A.M., Laat, W.L., Ariza, R.R., Biggerstaff, M., Wei, Y.-F., Moggs, J.G., Carter, K.C., Shell, B.K., Evans, E., Jong, M.C., Rademakers, S., Rooij, J., Jaspers, N.G.J., Hoeijmakers, J.H.J and Wood, R.D. (1996) Xeroderma pigmentosum group F caused by a defect in a structure-specific DNA repair endonuclease. Cell, 86, 811-822. MEDLINE Abstract

5. Brookman, K.W., Lamerdin, J.E., Thelen, M.P., Hwang, M., Reardon, J.T., Sancar, A., Zhou, Z.-Q., Walter, C.A., Parris, C.N. and Thompson, L.H. (1996) ERCC4 (XPF) encodes a human nucleotide excision repair protein with eukaryotic recombination homologs. Mol. Cell. Biol., 65, 6516-6523.

6. Yagi, T., Wood, R.D. and Takebe, H. (1997) A low content of ERCC1 and a 120kDa protein is a frequent feature of group F xeroderma pigmentosum fibroblast cells. Mutagenesis, 12, 41-44. MEDLINE Abstract

7. Van Duin, M., Vredeveldt, G., Mayne, L.V., Odijk, H., Vermeulen, W., Klein, B., Weeda, G., Hoeijmakers, J.H., Bootsma, D. and Westerveld, A. (1989) The cloned human DNA excision repair gene ERCC-1 fails to correct xeroderma pigmentosum complementation groups A through I. Mutat. Res., 217, 83-92 MEDLINE Abstract

8. Arase, S., Kozuka, T., Tanaka, K., Ikenaga, M. and Takebe, H. (1979) A sixth complementation group in xeroderma pigmentosum. Mutat. Res., 59, 143-146. MEDLINE Abstract

9. Nishigori, C., Ishizaki, K., Takebe, H., Imamura, S. and Hayakawa, M. (1986) A case of xeroderma pigmentosum group F with late onset of clinical symptoms. Arch. Dermatol., 122, 510-511. MEDLINE Abstract

10. Takata, M., Hirone, T. and Inoue, M. (1989) A case of xeroderma pigmentosum group F. Rinsho Dermatol. (Tokyo), 31, 79-82 (in Japanese).

11. Nishigori, C., Fujisawa, H., Uyeno, K., Kawaguchi, T. and Takebe, H. (1991) Xeroderma pigmentosum patients belonging to complementation group F and efficient liquid-holding recovery of ultraviolet damage. Photodermatol. Photoimmunol. Photomed., 8, 146-150. MEDLINE Abstract

12. Moriwaki, S., Nishigori, C., Imamura, S., Yagi, T., Takahashi, C., Fujimoto, N. and Takebe, H. (1993) A case of xeroderma pigmentosum complementation group F with neurological abnormalities. Br. J. Dermatol., 128, 91-94. MEDLINE Abstract

13. Bardwell, A.J., Bardwell, L., Johnson, D.K. and Friedberg, E.C. (1993) Yeast DNA recombination and repair protein Rad1 and Rad10 constitute a complex in vivo mediated by localized hydrophobic domains. Mol. Microbiol., 8, 1177-1188. MEDLINE Abstract

14. Satokata, I., Tanaka, K., Yuba, S. and Okada, Y. (1992) Identification of splicing mutations of the last nucleotides of exons, nonsense mutation, and a missense mutation of the XPAC gene as causes of group A xeroderma pigmentosum. Mutat. Res., 273, 203-212. MEDLINE Abstract

15. Sato, M., Nishigori, C., Yagi, T. and Takebe, H. (1996) Aberrant splicing and truncated-protein expression due to a newly identified XPA gene mutation. Mutat. Res., 362, 199-208. MEDLINE Abstract

16. Sijbers, A.M., Spek, P.J., Odijk, H., Berg, J., Duin, M., Westerveld, A., Jaspers, N.G.J., Bootsma, D. and Hoeijmakers, J.H.J. (1996) Mutational analysis of the human nucleotide excision repair gene ERCC1. Nucleic Acids Res., 24, 3370-3380. MEDLINE Abstract

17. Park, C.H., Bessho, T., Matsunaga, T. and Sancar, A. (1995) Purification and characterization of the XPF-ERCC1 complex of human DNA repair excision nuclease. J. Biol. Chem., 270, 22657-22660. MEDLINE Abstract

18. Sijbers, A.M., van der Spek, P.J., Odijik, H., van den Berg, J., van Duin, M., Westerveld, A., Jaspers, N.G., Bootsma, D. and Hoeijmakers, J.H. (1996) Mutational analysis of the human nucleotide excision repair gene ERCC1. Nucleic Acids Res., 24, 3370-3380. MEDLINE Abstract

19. McWhir, J., Selfridge, J., Harrison, D.J., Squires, S. and Melton, D.W. (1993) Mice with DNA repair gene (ERCC-1) deficiency have elevated levels of p53, liver nuclear abnormalities and die before weaning. Nature Genet., 5, 217-224. MEDLINE Abstract

20. Weeda, G., Donker, I., de Wit, J., Morreau, H., Janssens, R., Vissers, C.J., Nigg, A., van Steeg, H., Bootsma, D. and Hoeijmakers, J.H.J. (1997) Disruption of mouse ERCC1 results in a novel repair syndrome with growth failure, nuclear abnormalities and senescence. Curr. Biol., 7, 427-439. MEDLINE Abstract

21. Moriwaki, S., Nishigori, C., Teramoto, T., Tanaka, T., Kore-eda, S., Takebe., H. and Imamura, S. (1993) Absence of DNA repair deficiency in the confirmed heterozygotes of xeroderma pigmentosum group A. J. Invest. Dermatol., 101, 69-72. MEDLINE Abstract

22. Matsumura, Y., Sato, M., Nishigori, C., Zghal, M., Yagi, T., Imamura, S. and Takebe, H. (1995) High prevalence of mutations in the p53 gene in poorly differentiated squamous cell carcinomas in xeroderma pigmentosum patients. J. Invest. Dermatol., 105, 399-401. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +81 75 753 4412; Fax: +81 75 753 4419; Email: c51845@sakura.kudpc.kyoto-u.ac.jp

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 12 May 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
A. Ahmad, A. R. Robinson, A. Duensing, E. van Drunen, H. B. Beverloo, D. B. Weisberg, P. Hasty, J. H. J. Hoeijmakers, and L. J. Niedernhofer
ERCC1-XPF Endonuclease Facilitates DNA Double-Strand Break Repair
Mol. Cell. Biol., August 15, 2008; 28(16): 5082 - 5092.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
M. Tian, R. Shinkura, N. Shinkura, and F. W. Alt
Growth Retardation, Early Death, and DNA Repair Defects in Mice Deficient for the Nucleotide Excision Repair Enzyme XPF
Mol. Cell. Biol., February 1, 2004; 24(3): 1200 - 1205.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
T. R. Smith, E. A. Levine, N. D. Perrier, M. S. Miller, R. I. Freimanis, K. Lohman, L. D. Case, J. Xu, H. W. Mohrenweiser, and J. J. Hu
DNA-Repair Genetic Polymorphisms and Breast Cancer Risk
Cancer Epidemiol. Biomarkers Prev., November 1, 2003; 12(11): 1200 - 1204.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
P.-H. L. Gaillard and R. D. Wood
Activity of individual ERCC1 and XPF subunits in DNA nucleotide excision repair
Nucleic Acids Res., February 15, 2001; 29(4): 872 - 879.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
N. Zhang, X. Zhang, C. Peterson, L. Li, and R. Legerski
Differential processing of UV mimetic and interstrand crosslink damage by XPF cell extracts
Nucleic Acids Res., December 1, 2000; 28(23): 4800 - 4804.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
S. G. Khan, E.J. Metter, R. E. Tarone, V. A. Bohr, L. Grossman, M. Hedayati, S. J. Bale, S. Emmert, and K. H. Kraemer
A new xeroderma pigmentosum group C poly(AT) insertion/deletion polymorphism
Carcinogenesis, October 1, 2000; 21(10): 1821 - 1825.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (26)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Matsumura, Y.
Right arrow Articles by Takebe, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsumura, Y.
Right arrow Articles by Takebe, H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?