Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (85)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Dunckley, M. G.
Right arrow Articles by Dickson, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dunckley, M. G.
Right arrow Articles by Dickson, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1083-1091  

Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides
Introduction
Results
   Oligonucleotides are efficiently delivered to the nuclei of myoblasts and myotubes by polyethylenimine
   An antisense 2[prime]-O-methyl oligoribonucleotide complementary to the 3[prime] splice site of intron 22 induces dystrophin expression at the sarcolemma of transfected mdx myotubes
   The mutant exon 23 of mdx dystrophin is skipped following transfection with an antisense 2[prime]-O-methyl oligoribonucleotide complementary to the 3[prime] splice site of intron 22
Discussion
   Oligonucleotides can be delivered to the nuclei of primary muscle cells
   Antisense RNA oligonucleotides are versatile reagents for post-transcriptional manipulation of gene expression
   An antisense oligonucleotide to the 3[prime] splice site of dystrophin intron 22 induces exon skipping and restores the translational reading frame
   An oligonucleotide complementary to the 3[prime] splice consensus of dystrophin intron 22 is able to restore dystrophin expression in transfected mdx myotubes
Materials And Methods
   Oligonucleotides
   Cell culture and transfection of myoblasts
   Immunofluorescence and confocal microscopy
   RNA isolation and RT-PCR
   Analysis and sequencing of PCR products
Acknowledgements
References

Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides

Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides

Matthew G. Dunckley1,*, Muthiah Manoharan2, Pierre Villiet2, Ian C. Eperon3, George Dickson1

1Division of Biochemistry, Royal Holloway University of London, Egham TW20 0EX, UK, 2ISIS Pharmaceuticals, Carlsbad, CA 92008, USA and 3Department of Biochemistry, University of Leicester, Leicester LE1 7RH, UK

Received March 4, 1998; Revised and Accepted April 17, 1998

Deletions and point mutations in the gene encoding the cytoskeletal protein dystrophin and its isoforms cause either the severe progressive myopathy Duchenne muscular dystrophy (DMD) or the milder Becker muscular dystrophy (BMD), largely depending on whether the reading frame is lost or maintained respectively. Frameshift mutations tend to result in a lack of dystrophin at the sarcolemma, destabilization of the membrane and degeneration of skeletal muscle. The mdx mouse is a valuable animal model of DMD as it bears a nonsense point mutation in exon 23 of the murine DMD gene leading to an absence of dystrophin expression in the muscle sarcolemma and muscular dystrophy. This report represents a novel approach to correct dystrophin deficiency at the post-transcriptional level by transfection of muscle cells with antisense RNA. Essentially, 2[prime]-O-methyl oligoribonucleotides (2[prime]OMeRNA) were delivered to the nuclei of primary mdx myoblasts in culture. Dystrophin expression was observed in the sarcolemma of transfected mdx myotubes after transfection by an oligonucleotide complementary to the 3[prime] splice site of murine dystrophin intron 22. Direct sequencing of RT-PCR products from these cells revealed precise splicing of exon 22 to exon 30, skipping the mutant exon and creating a novel in-frame dystrophin transcript. As patients with comparable in-frame internal deletions show relatively mild myopathic symptoms, this may in the future offer a therapeutic approach for DMD, as well as for other inherited disorders.

INTRODUCTION

Duchenne muscular dystrophy (DMD) is characterized by progressive wasting of the skeletal musculature leading to severe disability and death by the early part of the third decade. It is an X-linked inherited disorder due to deletions or point mutations in a 2.5 Mb gene which lead to premature termination of translation of the 427 kDa gene product, dystrophin, a subsarcolemmal component of the muscle cytoskeleton (1). A milder allelic myopathy, Becker muscular dystrophy (BMD), results from defects in the DMD gene which maintain the translational reading frame and allow expression of an internally deleted and/or reduced abundance dystrophin protein (2,3). Indeed, some patients bearing substantial deletions in the central domain of dystrophin may exhibit a remarkably mild phenotype (4,5). In addition, a general correlation between severity of muscle disease and abundance of dystrophin has been suggested by some, indicating that even relatively small increases in dystrophin expression may protect skeletal muscle from degeneration (6). Moreover, transgenic mdx mice expressing truncated or full-length human dystrophin indicate that as low as 30% normal expression levels of severely truncated Becker-type dystrophin may be sufficient for substantial therapeutic benefit (7). Interestingly, occasional groups of dystrophin-positive myofibres are observed in the muscle of DMD patients as well as in the mdx mouse. These are thought to arise from either/both secondary somatic mutations or/and alternative splicing events, such as exon skipping, which restore the reading frame (8-10). As yet, however, the functional significance of these so-called `revertant' fibres is unclear.

Recent gene therapy approaches to DMD have focused on delivering recombinant mini-dystrophin cDNAs to skeletal muscle in vitro and in vivo using viral and non-viral vector systems (11-14). However, the large size of even the most truncated Becker-type dystrophin cDNAs, the inherent immunological hazards of using viral vectors and the inefficiency of non-viral cationic lipoplexes in vivo have so far limited their effectiveness. The situation is further complicated by transcription of the DMD gene from at least seven promoters and extensive alternative splicing which generates numerous developmentally and tissue-regulated isoforms (15). The present study describes an alternative strategy to cDNA-based gene therapy which instead relies on the delivery of small antisense RNA molecules to muscle in order to modulate splicing of endogenous pre-mRNA transcripts. In this way, frameshifting or nonsense mutations may be by-passed during RNA processing and the reading frame restored. Antisense oligonucleotides are being increasingly employed to alter gene expression in vitro and in vivo due to their ability to hybridize target DNA or RNA molecules in an exquisitely sequence-specific manner (16,17). Normally, antisense oligodeoxynucleotides are utilized to cause indirect down-regulation of gene expression via RNase H-mediated destruction of RNA-DNA duplexes (18). A key factor in this study, however, is the ability of antisense RNA oligonucleotides to inhibit RNA-RNA or RNA-protein interactions with exquisite specificity yet without transcript destabilization. In particular, it has been shown previously that 2[prime]-O-methyl (2[prime]OMe)-modified oligoribonucleotides (2[prime]OMeRNA) hybridize to complementary RNA sequences with exceptionally high affinity and do not induce endonucleases (19,20). Furthermore, antisense 2[prime]OMeRNA has been used to alter splicing patterns in cell-free systems (21,22) and, more recently, in cells (23,24). However, only illegitimate or recombinant transcription in lymphoblastoid cell lines has so far been modified by this technique.

The present report describes the delivery of antisense oligonucleotides to cultured primary muscle cells derived from the mdx mouse model of DMD. As the mdx mouse carries a nonsense CAA->TAA (Gln->STOP) point mutation in exon 23 of the murine DMD gene (25), we investigated whether binding of antisense 2[prime]OMeRNA complementary to splice site consensus sequences flanking this region (Fig. 1) could restore dystrophin expression in mdx muscle cells. These studies demonstrate that antisense RNA-mediated modulation of splicing is feasible in primary muscle cells and indicate that this approach may have therapeutic potential.


Figure 1. Diagram of binding sites for antisense 2[prime]OMe oligoribonucleotides around the mdx mutation in exon 23 of the murine dystrophin pre-mRNA. A C->T point mutation at nt 3185 in exon 23 converts a glutamine (CAA) to a STOP codon (TAA). Thus, in order to attempt skipping of the mutant exon, oligonucleotides were designed to be complementary to the intron 22 branchpoint, the 3[prime] splice site and the intron 23 5[prime] splice site. A scrambled sequence version of the 3[prime] splice site oligonucleotide was used as a control.

RESULTS

Oligonucleotides are efficiently delivered to the nuclei of myoblasts and myotubes by polyethylenimine

Primary mdx myoblasts and differentiated myotubes were transfected with 1 µM fluorescein-labelled oligonucleotide (5FLEX23A; Table 1) as a complex with the cationic polymer polyethylenimine (PEI). PEI was chosen as the vector as this had previously been shown to transfect oligonucleotides to myoblasts efficiently, is active in the presence of serum and is less toxic than cationic lipids (26-28). Confocal microscopy showed strong particulate fluorescence at the surface membrane and in abundant cytoplasmic vacuoles within 3 h of the start of transfection (Fig. 2a). By 24 h, distinct fluorescent material was clearly visible in ~70% of myoblasts in transfected cultures. Confocal microscopy showed that fluorescence was almost exclusively localized within the nucleus, characterized by a distinctive `knotted string' appearance (Fig. 2b), thread-like structures with interspersed small round bodies. In addition, myotubes were also examined 24 h post-transfection and found to contain fluorescent material, which was again localized within syncytial myonuclei (Fig. 2c). Interestingly, by 48 h bright fluorescence was entirely concentrated within a small intranuclear area of transfected myotubes, but this did not co-localize with nucleoli (Fig. 2d). No fluorescence was observed in untreated cultures or in control cultures treated with PEI alone. In addition, while cultures treated with oligonucleotide alone showed particulate fluorescent material at the cell surface, fluorescence was not observed within the cytoplasm or nucleus (data not shown).


Figure 2. Delivery of a fluorescein-labelled phosphorothioate oligonucleotide complexed with PEI to primary mdx muscle cells. Confocal microscope images of fluorescence: (a) at 3 h post-transfection, brightness was primarily at the surface of myoblasts; (b) by 24 h, discrete fluorescent patterns were observed primarily within the myoblast nucleus with some in cytoplasmic vesicles; (c) multiple fluorescent nuclei were observed in myotubes which formed immediately after transfection; (d) by 48 h, fluorescence was entirely localized to the nucleoli of myotube nuclei.

Table 1. Sequences of antisense oligonucleotides and PCR primers
Name Sequence (5[prime]->3[prime]) Comments
5FLEX23A f-gcttacctgaaa Phosphorothioate (P-S) DNA
BPS439 (A) gaaguucauuuaca 2[prime]OMe P-S RNA
3SS440 (B) gcagagccucaa 2[prime]OMe P-S RNA
5SS569 ( C) gcuuaccugaaauu 2[prime]OMe P-S RNA
SCR525 (D) ggcaaccuaacg Scrambled 2[prime]OMe P-S RNA
RDY32 ttggctggtttttggaataa Exon 32 reverse primer
FDY20 ggctagagtatcaaaccaacatcat Exon 20 forward primer
RDY30 acttttcaatttcctgggcag Exon 30 reverse primer
FDY21 agaaaagggacaggggccaa Exon 21 forward primer

An antisense 2[prime]-O-methyl oligoribonucleotide complementary to the 3[prime] splice site of intron 22 induces dystrophin expression at the sarcolemma of transfected mdx myotubes

Following immunostaining of fixed mdx muscle cultures with monoclonal antibody Dys3/6C5 against the C-terminus of dystrophin, no dystrophin immunoreactivity was detected in untreated control cultures, cultures transfected with a scrambled sequence oligonucleotide (SCR525) or antisense oligonucleotides complementary to the dystrophin intron 22 branch point (BPS439) or to the dystrophin intron 23 5[prime] splice site (5SS569). Neither was dystrophin detected in cultures in which oligonucleotides were added alone (Fig. 3a). However, strong Texas Red immunofluorescence was observed at the surface of 1-2% of mdx myotubes transfected 48 h previously with a 2[prime]OMe oligonucleotide complementary to the 3[prime] splice site of dystrophin intron 22. This was observed from four replicate cultures and corresponds to a minimum of five and a maximum of 11 dystrophin-positive myotubes per 16 mm diameter coverglass culture (mean 1.6 ± 0.38%). Confocal microscopy of these cultures showed that immunostaining was localized to the surface membrane of these myotubes in an identical pattern to normal dystrophin (Fig. 3b).


Figure 3. Dystrophin expression in mdx myotubes following transfection with an antisense oligonucleotide to the intron 22 3[prime] splice site. Transfected myotube cultures were fixed and stained using monoclonal antibody 6C5 to the C-terminus of dystrophin. (a) Most cultures had no dystrophin expression at the sarcolemma of mdx myotubes. (b) In ~1% of mdx myotubes in cultures transfected with an oligonucleotide to the 3[prime] splice site of mouse dystrophin intron 22, dystrophin expression was clearly observed at the sarcolemma.

The mutant exon 23 of mdx dystrophin is skipped following transfection with an antisense 2[prime]-O-methyl oligoribonucleotide complementary to the 3[prime] splice site of intron 22

Dystrophin cDNA was synthesized by reverse transcription of total RNA isolated from mdx muscle cultures using a transcript-specific reverse primer complementary to exon 32 (RDY32). An initial amplification was performed by PCR using primers to exon 20 (forward, FDY20) and exon 32 (reverse), followed by a further amplification using 1 µl initial reaction with nested primers to exons 21 (forward, FDY21) and 30 (reverse, RDY30). A 1.6 kb product was amplified from samples derived from all mdx muscle cultures after the nested amplification (see Fig. 4a; overexposed). In addition, a much fainter and smaller (~320 bp) product was also detected only in samples from mdx cultures transfected with a 2[prime]-O-methyl oligoribonucleotide complementary to the intron 22 3[prime] splice site (Fig. 4a, lane 5, arrowed). Sequencing of these gel-purified bands confirmed that the larger product corresponded to the mdx dystrophin mRNA (Fig. 4b, left). The smaller product, however, showed precise splicing of exon 22 to exon 30, an event which skips the mutant mdx exon 23 and generates an internally deleted mRNA with the potential to be translated as an in-frame dystrophin protein (Fig. 4b, right). A very faint band of ~220 bp was detected in samples transfected with an oligonucleotide to the 5[prime] splice site of intron 23 (Fig. 4a, lane 6), but insufficient quantities for sequencing could be obtained. As this size is incompatible with an integral number of exons in this region, it is likely that this was an artefact. Only the 1.6 kb product was observed in other transfected cultures and in controls.


Figure 4. Antisense RNA-mediated exon skipping generated a novel dystrophin transcript in transfected mdx muscle cells. Nested RT-PCR was performed using total RNA isolated from untreated and transfected cultures with primers to exon 21 (forward) and exon 30 (reverse) in the second reaction. (a) In addition to a 1.6 kb product, an additional band of ~320 bp was observed in samples transfected by an antisense oligonucleotide to the 3[prime] splice site of intron 22 (3SS440) complexed with PEI (lane 5). In cells transfected with PEI alone (lane 1), an oligonucleotide to the putative branchpoint sequence, BPS439 (lane 3), or a scrambled control oligonucleotide, SCR525 (lane 4), only full-length amplicons of exons 20-30 were observed. A very faint band of ~220 bp was observed in samples transfected with oligonucleotide 5SS569 (lane 6), but was probably an artefact. Lane 2, water control. (b) Direct sequencing of the smaller (~320 bp) product from lane 5 showed that exon 22 was precisely spliced to exon 30 in this transcript (right), whereas the larger product showed normal splicing of exon 22 to exon 23 (left).

DISCUSSION

These data have shown that it is possible to modulate splicing by oligoribonucleotides in muscle cells in order to correct a primary genetic defect, in this case a point mutation in the murine DMD gene responsible for mdx muscular dystrophy. Four lines of evidence were described.

Oligonucleotides can be delivered to the nuclei of primary muscle cells

Oligonucleotides have been delivered to cultured cells by several methods, most commonly by various cationic liposome formulations (23,29-31). Polyamines, especially PEI, are highly positively charged and so may act as a `proton sponge'. This ultimately ruptures the endosomal membrane by excessive influx of water, releasing the vesicle contents (e.g. oligonucleotides) into the cytoplasm. Indeed, the cytoplasmic vacuoles containing fluorescein-labelled oligonucleotides observed here (Fig. 2a) resembled swollen Golgi bodies or lysosomal vesicles by confocal microscopy. The `knotted string' appearance in nuclei transfected with fluorescein-labelled oligonucleotides has been observed by others and so may be a concentration-dependent, rather than a sequence-dependent phenomenon (Lorenz and Spector, personal communication). Importantly, no cytotoxicity was observed in transfected primary cultures or cell lines at the doses of PEI used, whereas it is a common feature of cationic liposome-mediated gene transfer (27,28).

Antisense RNA oligonucleotides are versatile reagents for post-transcriptional manipulation of gene expression

Numerous chemical modifications to DNA and RNA nucleotides can now be synthesized, depending on the physical and physiological properties required. Most antisense reagents are designed to destabilize the target transcript by initiating RNase H digestion of single-stranded RNA at the hybridization site. However, placement of 2[prime]OMe ribonucleotides or 2[prime]-fluoro analogues on the nucleotide greatly enhances binding to RNA of the complementary strand (20), presumably due to the adoption of an RNA-like conformation which favours binding to RNA targets (32). In addition, incorporation of the 2[prime]OMe substituent also increases the nuclease resistance of an oligonucleotide (33) and is known to reduce in vivo side-effects, such as prolongation of clotting times and immune stimulation, when compared with 2[prime]-deoxy phosphorothioates (34). Indeed, 2[prime]OMeRNA has been previously employed in studies modifying splicing in other systems (21-23). In the present work we have used 2[prime]OMe phosphorothioate oligonucleotides rather than phosphodiesters, as the latter do not have sufficient nuclease resistance for effective application in cell culture (35,36) and phosphorothioates may be actively transported into the cytoplasm via cell surface receptors (37). In future, one can also envision using other novel modifications, including 2[prime]-O-methoxyethyl phosphodiesters, reported to have superior antisense properties by combining good nuclease resistance with high RNA binding in vitro and in vivo (38-41).

An antisense oligonucleotide to the 3[prime] splice site of dystrophin intron 22 induces exon skipping and restores the translational reading frame

An alternatively spliced dystrophin mRNA was only detected in cultures transfected with an oligonucleotide complementary to the 3[prime] splice site of intron 22. Cultures transfected with a scrambled sequence version of this oligonucleotide did not generate a detectable alternatively spliced transcript. This is consistent with observations that 3[prime] splice site mutations typically result in skipping of downstream exons (42). Of additional interest is our observation that instead of exon 22 splicing to exon 24, exon 22 was precisely spliced to exon 30 (Fig. 5). This may reflect the mechanism or order of splicing events within the DMD gene, which is co-transcriptionally spliced (43), and suggests that splicing in this region does not occur in a linear manner (44). It may also be important that the nucleotide sequences at the splice acceptors of exons 23 and 30 are very similar (Fig. 3b). Naturally occurring exon skipping in dystrophic muscle has been demonstrated previously by RT-PCR, suggesting that this is at least one mechanism by which in-frame dystrophin molecules, such as those expressed in revertant fibres, are produced (8-10). However, the smaller `skipped' transcript observed in the present study is unlikely to be due to a spontaneous event, for the following reasons: (i) cultures were derived from neonatal muscle, in which revertant fibres are not usually observed (45,46); (ii) control cultures did not express this smaller transcript; (iii) while Wilton et al. (10) detected several small in-frame transcripts in adult mdx muscle using primers to exons 18 and 31, they did not detect any transcripts in which exon 22 was spliced to exon 30, as observed here; however, they frequently observed splicing at the intron 29/exon 30 boundary, supporting our suggestion that this may be a particularly favourable splice acceptor; and (iv) we did not detect any naturally occurring spliced forms of dystrophin in our mdx cultures. This either indicates that they are not generated in relatively immature cultured myotubes or that the transcript derived from forced exon skipping was more abundant and thus within the sensitivity range of our RT-PCR system. In any case, the exon skipping reported here is most likely to have occurred directly as a result of an interaction of the oligonucleotide with the target pre-mRNA. As mdx dystrophin transcripts of the expected size were detected by RT-PCR in all transfected cultures, it is unlikely that hybridization of antisense 2[prime]OMe oligonucleotides with dystrophin pre-mRNA caused transcript destabilization. Instead, while not proven by our data, an inhibition of splicing factor binding is more likely to be the mechanism of action.


Figure 5. Diagram of splicing around the mdx mutation in the murine dystrophin pre-mRNA showing binding sites of antisense oligoribonucleotides and alternative splicing observed after transfection with the oligonucleotide to the intron 22 3[prime] splice site. A C->T point mutation at nt 3185 in exon 23 converts a glutamine (CAA) to a STOP codon (TAA). Thus, skipping of the mutant exon avoids the STOP mutation and also restores the reading frame. Oligonucleotides were designed to be complementary to the intron 22 branch point (a), the 3[prime] splice site (b) and the 5[prime] splice site of intron 23 (c). A scrambled sequence version of oligonucleotide b was used as a control.

It is important to note that cultures transfected with an oligonucleotide complementary to the putative intron 22 branchpoint sequence had no detectable effect on dystrophin RNA processing, as this may be predicted to have a more profound effect on splicing. Similarly, no effect was observed in cultures transfected with an oligonucleotide complementary to the downstream 5[prime] consensus splice site. This could be due to several reasons, including: (i) incorrect identification of the branch site; (ii) inhibition of hybridization due to the tertiary structure of the pre-mRNA at the target sites; and (iii) generation of untranslated and/or unstable mRNA by exon skipping events at these sites. In addition, the effect of oligonucleotide length on the efficiency of splicing modification will be examined, as longer oligonucleotides to the 3[prime] splice site may increase the efficiency of the exon skipping events observed. However, the precise binding site is likely to have a greater influence, as in this study it was the shorter oligonucleotide (3SS440, 12mer) which was effective, while 14mers to other splice sites (BPS439 and 5SS569) did not influence splicing. In future, antisense oligonucleotides may be selected by a screening procedure such as the oligonucleotide arrays recently described (47), as these identify those sequences on the target RNA with optimal hybridization profiles.

An oligonucleotide complementary to the 3[prime] splice consensus of dystrophin intron 22 is able to restore dystrophin expression in transfected mdx myotubes

The C-terminal epitope of dystrophin was detected by immunocytochemistry only in myotubes previously transfected with an antisense oligonucleotide complementary to the 3[prime] splice site of dystrophin intron 22. It is well established that mRNA molecules which are translated are more stable than those bearing nonsense or frameshifting mutations (48,49). Thus, transcripts derived from frame-restoring exon skipping during pre-mRNA splicing are likely to be more stable than uncorrected mRNAs. As the half-life of dystrophin mRNA is ~16 h (50), stabilized in-frame transcripts should be successfully translated to dystrophin protein, as observed here in cell cultures transfected with the 3[prime] splice site antisense RNA (Fig. 3) and revertant fibres (45,46). Despite the relatively high transfection efficiency observed using a FITC-labelled oligonucleotide, only 1-2% of mdx myotubes expressed dystrophin at the time of immunostaining. This is most likely to be due to some or all of the following: (i) most myotubes were too immature at this stage to express dystrophin at the sarcolemma; (ii) the effects of the oligonucleotide on dystrophin expression were not maximal at 48 h; and (iii) the particular oligonucleotide used in this case was less efficiently transfected into myotubes than the labelled oligonucleotide. Each of these factors, in particular the longevity of antisense oligonucleotide effects in differentiated skeletal muscle, is now under investigation. Dueto such small numbers of dystrophin-positive cells, the functional consequences of dystrophin expression in these cells has yet to be evaluated. However, there is now considerable evidence for a selective advantage of dystrophin-positive fibres in vivo: in dystrophic muscle in female DMD carriers (36), in mdx muscle expressing recombinant dystrophin (12,13) and in revertant fibres (51). Indeed, dystrophin molecules deleted for >30 exons in the central domain (much larger than the region skipped here) are highly functional, presumably due to retention of the essential binding sites for actin at the N-terminus and the dystroglycan/sarcoglycan complex at the C-terminus (4,5,7). It is important to note that small in-frame deletions do not necessarily give rise to dystrophin molecules, even if they are within a region which can be grossly deleted, as they may sometimes interfere with the tertiary structure to a greater extent. Nevertheless, with this caveat, we would suggest that enhancement of naturally occurring in-frame transcripts by forced induction of exon skipping, as reported here, may represent a feasible therapeutic strategy to reduce the severity of muscle disease in DMD. Obviously, a much greater efficiency of dystrophin expression than described here will be required. On-going studies aim to fully characterize transfection parameters for PEI transfer of oligonucleotides to dystrophic muscle cells in vitro and in vivo in order to achieve transcription of exon skipped in-frame dystrophin molecules at therapeutic levels. Further work is also required to examine other variables, such as the effect of oligonucleotide length, in order to fully assess the feasibility of this strategy both in vitro and in vivo.

A similar approach is currently under investigation for the correction of other genetic defects, such as [beta]-thalassemia (23), in that case to restore a correct splicing pattern. Of particular relevance to the work described here, however, is a recent report of a milder congenital muscular dystrophy due to an in-frame internal deletion of the laminin [alpha]2 chain, a situation analagous to Becker and Duchenne muscular dystrophies (52). Hence, congenital muscular dystrophies may also be amenable to a similar oligonucleotide-mediated therapeutic strategy. In conclusion, we believe our data demonstrate that exon skipping was artificially induced during RNA processing of the dystrophin gene by the delivery of 2[prime]OMe-modified antisense oligoribonucleotides to mdx skeletal muscle cells.

MATERIALS AND METHODS

Oligonucleotides

A phosphorothioate 12mer oligodeoxynucleotide complementary to the 5[prime] splice site of mouse dystrophin intron 23 (53) was labelled at the 5[prime]-end with fluorescein isothiocyanate (FITC) (Genset, Paris), HPLC purified and used to examine oligonucleotide delivery to primary myoblasts. In addition, 2[prime]OMe-modified phosphorothioate oligoribonucleotides complementary to the intron 22 branchpoint (A, BPS439, 14mer), the intron 22 3[prime] splice site (B, 3SS440, 12mer), the intron 23 5[prime] splice site (C, 5SS569, 14mer) and a scrambled version of 3SS440 (D, SCR525, 12mer) (Fig. 1 and Table 1) were synthesized and purified by HPLC at ISIS Pharmaceuticals (Carlsbad, CA) or Genset (5SS569; Paris). Nested PCR primer pairs were designed to amplify the murine DMD gene and synthesized by Pharmacia Biotech UK (Table 1).

Cell culture and transfection of myoblasts

Primary mouse myoblasts were isolated by enzymatic dissociation as previously described (54) and seeded onto 24-well plates pre-coated with Matrigel (Collaborative Science) at a density of ~5 × 103 cells/well. Wells designated for analysis by fluorescence microscopy were previously loaded with 16 mm glass coverslips pre-coated with Matrigel. Primary myoblasts were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 2 mM glutamine, 20% fetal calf serum and 5 µg/ml gentamycin.

One hour before transfection, myoblast cultures were washed twice in serum-free DMEM and returned to the incubator in 400 µl serum-free medium per well. Aliquots of 10 µM solutions of each antisense oligonucleotide were prepared in sterile 150 mM NaCl and maintained on ice. Appropriate quantities of a linear 22 kDa isoform of PEI (stock solution 5.47 mM amine nitrogen, ExGen500; Euromedex) were then diluted such that a 1:1 (v/v) mix gave a molar ratio of phosphate:nitrogen of 9:1 as previously described (26). Diluted PEI was added to the oligonucleotide solutions, thoroughly mixed by vortexing and left to stand at room temperature for 10 min. Samples of 100 µl complex were then added to appropriate wells in order to achieve a final oligonucleotide concentration of 1 µM. Cultures were immediately centrifuged at 1500 r.p.m. for 5 min at room temperature before being replaced in the incubator. After 2 h, the medium was supplemented with an equal volume of DMEM supplemented with 10% horse serum in order to induce differentiation of myoblasts into myotubes. At 3, 24 or 48 h post-transfection, cultures were washed twice in phosphate-buffered saline and (i) fixed in -20°C methanol for 5 min for immunocytochemistry; (ii) fixed in 4% paraformaldehyde for 20 min for confocal microscopy; or (iii) harvested for isolation of total RNA (see below).

Immunofluorescence and confocal microscopy

Methanol-fixed, transfected cells were subject to immunocytochemistry using the monoclonal antibody 6C5 (Dys-3) against the final 15 C-terminal amino acids of skeletal muscle dystrophin (a gift from Dr Louise Anderson, Newcastle, UK) and biotin/streptavidin-Texas Red detection as previously described (55). Coverslips were inverted and mounted on glass slides in Vectashield (Vector Laboratories) and digital images captured using a Leica confocal microscope equipped with epifluorescence optics. Alternatively, cells transfected with a fluorescein-labelled oligonucleotide were fixed in paraformaldehyde, mounted on glass slides and confocal images captured as above.

RNA isolation and RT-PCR

Twenty four hours post-transfection, triplicate cultures were lysed in a buffer containing 4 M guanidinium isothiocyanate, pooled and homogenized by centrifugation through a QIAshredder column (Qiagen) before isolation of total RNA according to the manufacturer's instructions (RNeasy Mini Kit; Qiagen) (56). A sample of 1 µg total RNA was then reverse transcribed to cDNA in 20 µl reactions containing 400 nM reverse primer to dystrophin exon 32, 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 500 µM each dNTP, 10 mM DTT, 200 U MMLV reverse transcriptase (Superscript II; Life Technologies, Glasgow) and 5 U RNase inhibitor (RNasin; Promega), incubated at 42°C for 60 min. An aliquot of 1-5 µl of each reaction was then incorporated in an initial PCR reaction using 400 nM of the same reverse primer (ASDY32) and forward primer to exon 20 (SDY20) in a buffer containing 50 mM Tris-HCl, pH 9.0, 3 mM MgCl2, 20 mM (NH4)2SO4, 200 µM each dNTP, 2× MasterAmp Enhancer and 1.25 U Tth DNA polymerase (Epicentre Technologies, Madison, WI). A `touchdown' PCR profile was used in a Techne Progene thermal cycler: an initial 3 min incubation at 95°C; 95°C for 45 s, 62°C for 1 min (reducing by 2°C every two cycles to 54°C), 72°C for 2 min; then 95°C for 45 s, 57°C for 1 min, 72°C for 2 min for 30 cycles; a final extension step of 72°C for 10 min. An aliquot of 0.5 µl of the initial amplification was then incorporated in a nested PCR reaction identical to the first but using 400 nM each of a forward primer to exon 21 and reverse primer to exon 30.

Analysis and sequencing of PCR products

Nested reactions were run on a 2.5% TAE agarose gel and specific bands cut out and purified using a `glass milk' method (NucleiClean Kit; Sigma). Samples of 20-50 ng purified bands were directly sequenced in both directions by a dye primer chain termination method using 6 pmol forward primer FDY21 (see Table 1) and reverse primer RDY30 to dystrophin exons 21 and 30 respectively. Samples were run on a 6% polyacrylamide gel and read using an Applied Biosystems 377 Genescanner (CAMR Sequencing Service, Wiltshire).

ACKNOWLEDGEMENTS

This work was supported by a grant from the Central Research Fund of the University of London and by a Sir Henry Wellcome Commemorative Award for Innovative Research.

REFERENCES

1. Hoffman, E.P., Brown, R.H. and Kunkel, L.M. (1987) Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell, 51, 919-928. MEDLINE Abstract

2. Koenig, M. et al). (1989) The molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion. Am. J. Hum. Genet., 45, 498-506. MEDLINE Abstract

3. Monaco, A.P., Bertelson, C.J., Liechti-Gallati, S., Moser, H. and Kunkel, L.M. (1988) An explanation for phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics, 2, 90-95. MEDLINE Abstract

4. England, S.B., Nicholson, L.V.B., Johnson, M.A., Forrest, S.M., Love, D.R., Zubrzycka-Gaarn, E.E., Bulman, D.E., Harris, J.B. and Davies, K.E. (1990) Very mild muscular dystrophy associated with deletion of 46% of dystrophin. Nature, 343, 180-182. MEDLINE Abstract

5. Morandi, L., Mora, M., Bernasconi, P., Mantegazza, R., Gebbia, M., Balestrini, M.R. and Cornelio, F. (1993) Very small dystrophin molecule in a family with a mild form of Becker dystrophy. Neuromusc. Disorders, 3,65-70. MEDLINE Abstract

6. Nicholson, L.V.B., Johnson, M.A., Bushby, K.M.D. and Gardner-Medwin, D. (1992) Functional significance of dystrophin-positive fibres in Duchenne muscular dystrophy. Arch. Dis. Child., 68, 632-636.

7. Wells, D.J., Wells, K.E., Asante, E.A., Turner, G., Sunada, Y., Campbell, K.P., Walsh, F.S. and Dickson, G. (1995) Expression of human full-length and minidystrophin in transgenic mdx mice: implications for gene therapy of Duchenne muscular dystrophy. Hum. Mol. Genet., 4, 1245-1250. MEDLINE Abstract

8. Sherratt, T.G., Vulliamy, T., Dubowitz, V., Sewry, C.A. and Strong, P.N. (1993) Exon skipping and translation in patients with frameshift deletions in the dystrophin gene. Am. J. Hum. Genet., 53, 1007-1015. MEDLINE Abstract

9. Thanh, L.T., Man, N.T., Helliwell, T.R. and Morris, G.E. (1995) Characterisation of revertant muscle fibres in Duchenne muscular dystrophy, using exon-specific monoclonal antibodies against dystrophin. Am. J. Hum. Genet., 56, 725-731. MEDLINE Abstract

10. Wilton, S.D., Dye, D.E. and Laing, N.G. (1997) Dystrophin gene transcripts skipping the mdx mutation. Muscle Nerve, 20, 728-734. MEDLINE Abstract

11. Dunckley, M.G., Wells, D.J., Walsh, F.S. and Dickson, G. (1993) Direct retroviral-mediated transfer of a dystrophin minigene into mdx mouse muscle in vivo. Hum. Mol. Genet., 2,717-723. MEDLINE Abstract

12. Fassati, A., Wells, D.J., Serpente, P.A.S., Walsh, F.S., Brown, S.C., Strong, P.N. and Dickson, G. (1997) Genetic correction of dystrophin deficiency and skeletal muscle remodeling in adult mdx mouse via transplantation of retroviral producer cells. J. Clin. Invest., 100, 620-628. MEDLINE Abstract

13. Vincent, N. et al.) (1993) Long-term correction of mouse dystrophic degeneration by adenovirus-mediated transfer of a minidystrophin gene. Nature Genet., 5, 130-134. MEDLINE Abstract

14. Trivedi, R.A. and Dickson, G. (1995) Liposome-mediated dystrophin gene transfer. J. Neurochem., 64, 2230-2238. MEDLINE Abstract

15. Ahn, A.H. and Kunkel, L.M. (1993) The structural and functional diversity of dystrophin. Nature Genet., 3, 283-291. MEDLINE Abstract

16. Rojanasakul, Y. (1996) Antisense oligonucleotide therapeutics: drug delivery and targeting. Adv. Drug Delivery Rev., 18, 115-131

17. Kozarsky, K.F. and Couture, L.A. (1997) Message therapy: gene therapy that targets mRNA sequence and stability. Am. J. Hum. Genet., 61, 790-794. MEDLINE Abstract

18. Helene, C. and Toulme, J.J. (1990) Specific regulation of gene expression by antisense, sense, and antigene nucleic acids. Biochim. Biophys. Acta, 1049, 99-125. MEDLINE Abstract

19. Mayeda, A., Hayase, Y., Inoue, H., Ohtsuka, E. and Ohshima, Y. (1990) Surveying cis-acting sequences of pre-messenger RNA by adding antisense 2[prime]-O-methyl oligoribonucleotides to a splicing reaction. J. Biochem., 108, 399-405. MEDLINE Abstract

20. Wang, S. and Kool, E.T. (1995) Relative stabilities of triple helices composed of combinations of DNA, RNA, and 2[prime]-O-methyl RNA backbones: chimeric circular oligonucleotides as probes. Nucleic Acids Res., 23, 1157-1164. MEDLINE Abstract

21. Dominski, Z. and Kole, R. (1993) Restoration of correct splicing in thalassemic pre-mRNA by antisense oligonucleotides. Proc. Natl Acad. Sci. USA, 90, 8673-8677. MEDLINE Abstract

22. Takeshima, Y., Nishio, H., Sakamoto, H., Nakamura, H. and Matsuo, M. (1995) Modulation of in vitro splicing of the upstream intron by modifying an intra-exon sequence which is deleted from the dystrophin gene in dystrophin Kobe. J. Clin. Invest., 95, 515-520. MEDLINE Abstract

23. Sierakowska, H., Sambade, M.J., Agrawal, S. and Kole, R. (1996) Repair of thalassemic human [beta]-globin mRNA in mammalian cells by antisense oligonucleotides. Proc. Natl Acad. Sci. USA, 93, 12840-12844. MEDLINE Abstract

24. Pramono, Z.A.D., Takeshima, Y., Alimsardjono, H., Ishii, A., Takeda, S. and Matsuo, M. (1996) Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence. Biochem. Biophys. Res. Commun., 226, 445-449. MEDLINE Abstract

25. Sicinski, P., Geng, Y., Ryder-Cook, A.S., Barnard, E.A., Darlison, M.G. and Barnard, P.J. (1989) The molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science, 244, 1578-1580. MEDLINE Abstract

26. Boussif, O., Lezonalc'h, F., Zanta, M.A., Mergny, M.D., Scherman, D., Demeneix, B., and Behr, J.-P. (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethyleneimine. Proc. Natl Acad. Sci. USA, 92, 7297-7301. MEDLINE Abstract

27. Abdallah, B., Hassan, A., Benoist, C., Goula, D., Behr, J.-P. and Demeneix, B.A. (1996) A powerful nonviral vector for in vivo gene transfer into the adult mammalian brain: polyethyleneimine. Hum. Gene Ther., 7, 1947-1954. MEDLINE Abstract

28. Dodds, E., Dunckley, M.G., Naujoks, K., Michaelis, U. and Dickson, G. (1998) Lipofection of cultured mouse muscle cells: a direct comparison of Lipofectamine and DOSPER. Gene Ther., 5, 542-551. MEDLINE Abstract

29. Monia, B.P. et al.) (1996) Sequence-specific antitumor activity of a phosphorothioate oligodeoxyribonucleotide targeted to human c-raf kinase supports an antisense mechanism of action in vivo. Proc. Natl Acad. Sci. USA, 93, 15481-15484. MEDLINE Abstract

30. Bennett, C.F., Chiang, M.-Y., Chan, H., Shoemaker, J.E.E. and Mirabelli, C.K. (1992) Cationic lipids enhance cellular uptake and activity of phosphorothioate antisense oligonucleotides. Mol. Pharmacol., 41, 1023-1033. MEDLINE Abstract

31. Lewis, J.G., Lin, K.-Y., Kathavale, A., Flanagan, W.M., Matteucci, M.D., DePrince, R.B., Mook, R.A., Hendren, R.W. and Wagner, R.W. (1996) A serum-resistant cytofectin for cellular delivery of antisense oligodeoxynucleotides and plasmid DNA. Proc. Natl Acad. Sci. USA, 93, 3176-3181. MEDLINE Abstract

32. Monia, B.P., Lesnik, E.A., Gonzalez, C., Lima, W.F., McGee, D., Guinosso, C.J., Kawasaki, A.M., Cook, P.D. and Freier, S.M. (1993) Evaluation of 2[prime]-modified oligonucleotides containing 2[prime]-deoxy gaps as antisense inhibitors of gene expression. J. Biol. Chem., 268, 14514-14522. MEDLINE Abstract

33. Cummins, L.L., Owens, S.R., Risen, L.M., Lesnik, E.A., Freier, S.M., McGee, D., Guinosso, C.J. and Cook, P.D. (1995) Characterisation of fully 2[prime]-modified oligoribonucleotide hetero- and homoduplex hybridisation and nuclease sensitivity. Nucleic Acids Res., 23, 2019-2024. MEDLINE Abstract

34. Altmann, K.H. et al.) (1996) Second generation of antisense oligonucleotides: from nuclease resistance to biological efficacy in animals. Chimia, 50, 168-176.

35. Zhang, R., Lu, Z., Zhang, X., Zhao, H., Diasio, R.B., Liu, T., Jiang, Z. and Agrawal, S. (1995) In vivo stability and disposition of a self-stabilised oligodeoxynucleotide phosphorothioate in rats. Clin. Chem., 41, 836.

36. Altmann, K.-H., Fabbro, D., Dean, N.M., Geiger, T., Monia, B.P., Mueller, M. and Nicklin, P. (1996b) Second-generation antisense oligonucleotides: structure-activity relationships and the design of improved signal transduction inhibitors. Biochem. Soc. Trans., 24, 630-637. MEDLINE Abstract

37. Beltinger, C. et al.) (1995) Binding, uptake and intracellular trafficking of phosphorothioate-modified oligodeoxynucleotides. J. Clin. Invest., 95, 1814-1823. MEDLINE Abstract

38. Baker, B.F., Lot, S., Condon, T.P., Cheng-Flourney, S., Lesnik, E., Sasmor, H. and Bennett, C.F. (1997) 2[prime]-O-(2-Methoxy)ethyl-modified anti-intercellular adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 mRNA level by formation of the ICAM-1 translation initiation complex in human umbilical vein endothelial cells. J. Biol. Chem., 272, 11994-12000. MEDLINE Abstract

39. Griffey, R.H., Lesnik, E., Freier, S., Sanghvi, Y.S., Teng, K., Kawasaki, A., Guinosso, C. and Cook, P.D. (1996) In Sanghvi, Y.S. and Cook, P.D. (eds), Carbohydrate Modifications in Antisense Research, ACS Symposium Series 580. American Chemical Society, Washington, DC, pp. 212-224.

40. Crooke, S.T. et al.) (1996) Pharmacokinetic properties of several novel oligonucleotide analogs in mice. J. Pharmacol. Exp. Ther., 277, 923-937. MEDLINE Abstract

41. Manoharan, M., Tivel, K.L., Andrade, L.K. and Cook, P.D. (1995) 2[prime]-O- and 3[prime]-O-pyrimidine aminoether-containing oligonucleotides: synthesis and conjugation chemistry. Tetrahedron Lett., 36, 3647-3650.

42. Cooper, D.N. and Krawczak, M. (1993) Human Gene Mutation. Bios, Oxford.

43. Tennyson, C.N., Klamut, H.J. and Worton, R.G. (1995) The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced. Nature Genet., 9, 184-190. MEDLINE Abstract

44. Nordstrom, J.L., Roop, D.R., Tsai, M.J. and O'Malley, B.W. (1979) Identification of potential ovomucoid mRNA precursors in chick oviduct nuclei. Nature, 278, 328-331. MEDLINE Abstract

45. Danko, I., Chapman, V. and Wolff, J.A. (1992) The frequency of revertants in mdx mouse genetic models for Duchenne muscular dystrophy. Pediat. Res., 32, 128-131. MEDLINE Abstract

46. Zhao, J., Yoshioka, K., Miike, T. and Miyatake, M. (1993) Developmental studies of dystrophin-positive fibers in mdx, and DRP localisation. J. Neurol. Sci., 114, 104-108. MEDLINE Abstract

47. Milner, N., Mir, K.U. and Southern, E.M. (1997) Selecting effective antisense reagents on combinatorial oligonucleotide arrays. Nature Biotechnol., 15, 537-541.

48. Chelly, J. et al.) (1990) Effect of dystrophin gene deletions on mRNA levels and processing in Duchenne and Becker muscular dystrophies. Cell, 63, 1239-1248. MEDLINE Abstract

49. Maquat, L.E. (1996) Defects in RNA splicing and the consequences of shortened translational reading frames. Am. J. Hum. Genet., 59, 279-286. MEDLINE Abstract

50. Tennyson, C.N., Shi, Q. and Worton, R.G. (1996) Stability of the human dystrophin transcript in muscle. Nucleic Acids Res., 24, 3059-3064. MEDLINE Abstract

51. Pegoraro, E. et al). (1995) Genetic and biochemical normalisation in female carriers of Duchenne muscular dystrophy: evidence for failure of dystrophin production in dystrophin-competent myonuclei. Neurology, 45, 677-690. MEDLINE Abstract

52. Allamand, V. et al.) (1997) Mild congenital muscular dystrophy in two patients with an internally deleted laminin [alpha]2 chain. Hum. Mol. Genet., 6, 747-752. MEDLINE Abstract

53. Dunckley, M.G., Eperon, I.C. and Dickson, G. (1997) Modulation of splicing in the DMD gene using antisense oligoribonucleotides. Nucleosides Nucleotides, 16, 1665-1668.

54. Walsh, F.S. and Ritter, M.A. (1981) Surface antigen differentiation during human myogenesis in culture. Nature, 289, 60-64. MEDLINE Abstract

55. Dunckley, M.G., Davies, K.E., Walsh, F.S., Morris, G.E. and Dickson, G. (1992) Retroviral-mediated transfer of a dystrophin minigene into mdx mouse myoblasts in vitro. FEBS Lett., 296, 128-134. MEDLINE Abstract

56. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156-159. MEDLINE Abstract MEDLINE Abstract

*To whom correspondence should be addressed at present address: Neuromuscular Unit, Department of Paediatrics, Hammersmith Hospital, Ducane Road, London W12 0NN, UK. Tel. +44 181 383 2126; Fax: +44 181 746 2187; Email: m.dunckley@rpms.ac.uk

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 8 Jun 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Cardiovasc ResHome page
N. Jearawiriyapaisarn, H. M. Moulton, P. Sazani, R. Kole, and M. S. Willis
Long-term improvement in mdx cardiomyopathy after therapy with peptide-conjugated morpholino oligomers
Cardiovasc Res, November 3, 2009; (2009) cvp335v2.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
F.-O. Desmet, D. Hamroun, M. Lalande, G. Collod-Beroud, M. Claustres, and C. Beroud
Human Splicing Finder: an online bioinformatics tool to predict splicing signals
Nucleic Acids Res., May 1, 2009; 37(9): e67 - e67.
[Abstract] [Full Text] [PDF]

Home page
 Arch NeurolHome page
T. Yokota, S. Takeda, Q.-L. Lu, T. A. Partridge, A. Nakamura, and E. P. Hoffman
A Renaissance for Antisense Oligonucleotide Drugs in Neurology: Exon Skipping Breaks New Ground
Arch Neurol, January 1, 2009; 66(1): 32 - 38.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
G. D. Ivanova, A. Arzumanov, R. Abes, H. Yin, M. J. A. Wood, B. Lebleu, and M. J. Gait
Improved cell-penetrating peptide-PNA conjugates for splicing redirection in HeLa cells and exon skipping in mdx mouse muscle
Nucleic Acids Res., November 1, 2008; 36(20): 6418 - 6428.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
B. Wu, H. M. Moulton, P. L. Iversen, J. Jiang, J. Li, J. Li, C. F. Spurney, A. Sali, A. D. Guerron, K. Nagaraju, et al.
Effective rescue of dystrophin improves cardiac function in dystrophin-deficient mice by a modified morpholino oligomer
PNAS, September 30, 2008; 105(39): 14814 - 14819.
[Abstract] [Full Text] [PDF]

Home page
 RNAHome page
A. Aartsma-Rus and G.-J. B. van Ommen
Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications
RNA, October 1, 2007; 13(10): 1609 - 1624.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. A. Denti, A. Rosa, G. D'Antona, O. Sthandier, F. G. De Angelis, C. Nicoletti, M. Allocca, O. Pansarasa, V. Parente, A. Musaro, et al.
Body-wide gene therapy of Duchenne muscular dystrophy in the mdx mouse model
PNAS, March 7, 2006; 103(10): 3758 - 3763.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J. Soret, N. Bakkour, S. Maire, S. Durand, L. Zekri, M. Gabut, W. Fic, G. Divita, C. Rivalle, D. Dauzonne, et al.
Selective modification of alternative splicing by indole derivatives that target serine-arginine-rich protein splicing factors
PNAS, June 14, 2005; 102(24): 8764 - 8769.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
J. S. Mattick and I. V. Makunin
Small regulatory RNAs in mammals
Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R121 - R132.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
A. Goyenvalle, A. Vulin, F. Fougerousse, F. Leturcq, J.-C. Kaplan, L. Garcia, and O. Danos
Rescue of Dystrophic Muscle Through U7 snRNA-Mediated Exon Skipping
Science, December 3, 2004; 306(5702): 1796 - 1799.
[Abstract] [Full Text] [PDF]

Home page
 Postgrad. Med. J.Home page
S M Selkirk
Gene therapy in clinical medicine
Postgrad. Med. J., October 1, 2004; 80(948): 560 - 570.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
S. Liu, M. Asparuhova, V. Brondani, I. Ziekau, T. Klimkait, and D. Schumperli
Inhibition of HIV-1 multiplication by antisense U7 snRNAs and siRNAs targeting cyclophilin A
Nucleic Acids Res., July 14, 2004; 32(12): 3752 - 3759.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
D. Ittig, S. Liu, D. Renneberg, D. Schumperli, and C. J. Leumann
Nuclear antisense effects in cyclophilin A pre-mRNA splicing by oligonucleotides: a comparison of tricyclo-DNA with LNA
Nucleic Acids Res., January 15, 2004; 32(1): 346 - 353.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
C. Bertoni, C. Lau, and T. A. Rando
Restoration of dystrophin expression in mdx muscle cells by chimeraplast-mediated exon skipping
Hum. Mol. Genet., May 15, 2003; 12(10): 1087 - 1099.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. Aartsma-Rus, A. A.M. Janson, W. E. Kaman, M. Bremmer-Bout, J. T. den Dunnen, F. Baas, G.-J. B. van Ommen, and J. C.T. van Deutekom
Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients
Hum. Mol. Genet., April 15, 2003; 12(8): 907 - 914.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
F. G. De Angelis, O. Sthandier, B. Berarducci, S. Toso, G. Galluzzi, E. Ricci, G. Cossu, and I. Bozzoni
Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells
PNAS, July 9, 2002; 99(14): 9456 - 9461.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. Kalbfuss, S. A. Mabon, and T. Misteli
Correction of Alternative Splicing of Tau in Frontotemporal Dementia and Parkinsonism Linked to Chromosome 17
J. Biol. Chem., November 9, 2001; 276(46): 42986 - 42993.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
G. E. Crawford, Q. L. Lu, T. A. Partridge, and J. S. Chamberlain
Suppression of revertant fibers in mdx mice by expression of a functional dystrophin
Hum. Mol. Genet., November 1, 2001; 10(24): 2745 - 2750.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
J. C.T. van Deutekom, M. Bremmer-Bout, A. A.M. Janson, I. B. Ginjaar, F. Baas, J. T. den Dunnen, and G.-J. B. van Ommen
Antisense-induced exon skipping restores dystrophin expression in DMD patient derived muscle cells
Hum. Mol. Genet., July 1, 2001; 10(15): 1547 - 1554.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. J. Friedman, J. Kole, J. A. Cohn, M. R. Knowles, L. M. Silverman, and R. Kole
Correction of Aberrant Splicing of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene by Antisense Oligonucleotides
J. Biol. Chem., December 17, 1999; 274(51): 36193 - 36199.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
J. Tyson, S. Malcolm, and M. Bitner-Glindzicz
Splice Mutations in KVLQT1?
Circulation, May 11, 1999; 99 (18): 2476 - 2479.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. R. Lim and K. J. Hertel
Modulation of Survival Motor Neuron Pre-mRNA Splicing by Inhibition of Alternative 3' Splice Site Pairing
J. Biol. Chem., November 21, 2001; 276(48): 45476 - 45483.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (85)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Dunckley, M. G.
Right arrow Articles by Dickson, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dunckley, M. G.
Right arrow Articles by Dickson, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?