Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (83)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Van Hauwe, P.
Right arrow Articles by Van Camp, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Hauwe, P.
Right arrow Articles by Van Camp, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1099-1104  

Two frequent missense mutations in Pendred syndrome
Introduction
Results
   Mutation detection
   Haplotype comparison
Discussion
Materials And Methods
   Subjects
   Mutation analysis
Acknowledgements
Abbreviations
References

Two frequent missense mutations in Pendred syndrome

Two frequent missense mutations in Pendred syndrome

Peter Van Hauwe1, Lorraine A. Everett2, Paul Coucke1, Daryl A. Scott3, Michelle L. Kraft3, Carrie Ris-Stalpers4, Cuny Bolder5, Barto Otten5, Jan J.M. de Vijlder4, Nicole L. Dietrich2, Arabandi Ramesh7, Srikumari C. R. Srisailapathy7, Agnete Parving6, Cor W. R. J. Cremers5, Patrick J. Willems1, Richard J. H. Smith3, Eric D. Green2, Guy Van Camp1,*

1Department of Medical Genetics, University of Antwerp, Universiteitsplein 1, 2610 Wilrijk, Antwerp, Belgium, 2Genome Technology Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, MD, USA, 3Department of Otolaryngology, University of Iowa, Iowa City, IA, USA, 4Academic Medical Center, University of Amsterdam, Laboratory of Pediatric Endocrinology, Amsterdam, The Netherlands, 5Department of Otolaryngology, University Hospital Nijmegen, Nijmegen, The Netherlands, 6H.S. Bispebjerg Hospital, Audiological Department, Bispebjerg Bakke 23, 2400 Copenhagen NV, Denmark and 7Department of Genetics, University of Madras, Madras, India

Received March 2, 1998; Revised and Accepted April 21, 1998

Pendred syndrome is an autosomal recessive disorder characterized by early childhood deafness and goiter. A century after its recognition as a syndrome by Vaughan Pendred, the disease gene (PDS) was mapped to chromosome 7q22-q31.1 and, recently, found to encode a putative sulfate transporter. We performed mutation analysis of the PDS gene in patients from 14 Pendred families originating from seven countries and identified all mutations. The mutations include three single base deletions, one splice site mutation and 10 missense mutations. One missense mutation (L236P) was found in a homozygous state in two consanguineous families and in a heterozygous state in five additional non-consanguineous families. Another missense mutation (T416P) was found in a homozygous state in one family and in a heterozygous state in four families. Pendred patients in three non-consanguineous families were shown to be compound heterozygotes for L236P and T416P. In total, one or both of these mutations were found in nine of the 14 families analyzed. The identification of two frequent PDS mutations will facilitate the molecular diagnosis of Pendred syndrome.

INTRODUCTION

In 1896 Vaughan Pendred first described Pendred syndrome (MIM 274600) as a combination of congenital deafness and goiter (1). Estimations of the frequency of Pendred syndrome vary from 1/15 000 in the British Isles to 1/100 000 in Scandinavia (2). The disease accounts for an estimated 4-10% of congenitally deaf children (2). Most Pendred patients are prelingually deaf and have a type of cochlear malformation known as a Mondini defect (2). A Mondini malformation is characterized by one and a half coils instead of two and a half coils, with the upper two turns forming a common cavity (2). Although most Pendred patients develop a goiter during adolescence or adulthood, nearly every patient is euthyroid (3).

The basic defect in the thyroid is a less efficient organification of iodide (4,5), which can be demonstrated by the perchlorate discharge test (6). In this test, radioactive iodide is given to a patient. One hour later, perchlorate is administered and diffusion of inorganified iodine from the thyroid gland is measured as a drop in thyroid counting rate. An abnormal result is defined as a release of >20% of the radioactive iodide taken up by the thyroid gland.

Pendred syndrome is inherited as an autosomal recessive trait and in many families consanguinity is present (2). The phenotype of Pendred patients, however, can vary within and between families (7).

After Coyle et al. (8) and Sheffield et al. (9) found linkage between Pendred syndrome and markers on chromosome 7q31, we were able to reduce the Pendred candidate region to 1.7 cM (10). Recently, Everett et al. (11) reported the identification of the Pendred gene (PDS), with the identification of three different mutations in five Pendred families. PDS encodes a putative sulfate transporter. The open reading frame of PDS is distributed across 21 exons, with the 5 kb mRNA highly expressed in thyroid tissue. In a preliminary experiment, Everett et al. (11) were able to PCR amplify the PDS gene from a fetal cochlear cDNA library, suggesting that the gene is also expressed in the cochlea. The protein encoded by the PDS gene has been named pendrin and is predicted to consist of 780 amino acids (molecular weight 86 kDa). Analysis of the predicted amino acid sequence of pendrin reveals 11 transmembrane domains.

PDS is one of the first disease genes to be identified with the aid of genomic sequence information. Everett et al. (11) analyzed the available sequence from a BAC from the Pendred critical region with the GRAIL program (12), which revealed the presence of several putative exons. Comparison of these exons with sequences in GenBank revealed strong homology to the `down-regulated in adenoma' (DRA) gene, which had been previously mapped to the Pendred candidate region (13). DRA encodes a sulfate transporter (14) and mutations in this gene cause congenital chloride diarrhea (15). Interestingly, the PDS gene maps very close to the DRA gene. Both genes are positioned tail-to-tail and separated by only 48 kb, suggesting an evolutionary relationship.

In this study we performed mutation analysis of the PDS gene in 14 Pendred families from different ethnic origins. The 14 identified mutations included three frameshift mutations, one splice site mutation and 10 missense mutations. Interestingly, two missense mutations were present in more than half of the families analyzed in this study.

RESULTS

Mutation detection

To detect mutations in the PDS gene of Pendred patients, we PCR amplified and sequenced each of the 21 exons (11) from one affected individual of 14 anamnestically unrelated Pendred families. In family 1, two patients (II.1 and III.1) were analyzed, as the structure of the pedigree suggested the presence of three mutations (Fig. 1). Table 1 summarizes the clinical and molecular data for all 14 families. In these 14 families, originating from seven countries, 14 different mutations were found, including three frameshifts, one splice site mutation and 10 missense mutations (Table 2). A specific restriction enzyme assay was developed to facilitate the analysis of the remaining family members from whom DNA was available (Table 2).


Figure 1. Pedigree of Belgian family 1. Bars below the family markers indicate the segregation of the mutation.

Three different frameshift mutations leading to a premature stop codon were found (Tables 1 and 2). Two of these (FS 400 and FS 383) lead to a truncated protein with only the first eight transmembrane domains (Fig. 2). The FS 634 mutation, however, results in a pendrin protein containing all transmembrane domains (Fig. 2), but lacking the 146 amino acids at the C-terminus.

Table 1. Characteristics of PDS mutations in the Pendred families
Family Origin Early childhood deafness Goiter Abnormalperchlorate test Consanguinuity PDS mutations
1 Belgium 3/3 2/3 NP for II.1 and II.5;
normal for III.1		 No G209V, FS634, V138F
2 Holland 1/1 1/1 1/1 Yes L236P
3 Holland 1/1 1/1 1/1 No L445W, H723R
4 Lebanon 3/3 1/3 2/3 Yes FS400
5 Holland 2/2 2/2 2/2 Yes T416P
6 Holland 2/2 1/2 1/2 No FS383, T416P
7 Turkey 1/1 1/1 1/1 No D271H, R409H
8 Holland 1/1 1/1 1/1 No L236P, G139A
9 USA 1/1 1/1 1/1 No C565Y, L236P
10 Denmark 1/1 0/1 1/1 No L236P, T416P
11 Belgium 1/1 1/1 1/1 Yes L236P
12 Holland 1/1 1/1 1/1 No L236P, T416P
13 Holland 1/1 1/1 1/1 No L236P, T416P
14 India 2/2 2/2 NP Yes 1142+1G->A
NP, test was not performed; FSx, frameshift mutation in which x is the position of the first altered amino acid.
The two recurrent mutations are in bold type.

Table 2. Characteristics of PDS mutations in the Pendred families
Protein change Protein domain Sequence change Exon PCR primers Mutation confirmation Family
V138F TR3 636G->T 4 exon4-s1-exon4-as1 Sequencing 1
G139A TR3 640G->C 5 exon5-s1-exon5-as1 Sequencing 8
G209V TR4 850G->T 6 exon6-s1-exon6-as1 HinfI cuts WT 1
L236P EL3 931T->C 6 exon6-s1-exon6-as1 AlufI cuts WT 2, 8, 9, 10-13
D271H EL3 1035G->C 7 1035-F1m2-1035-R12 BclI cuts mutant 7
FS383 IL4 1370delC 9 exon9-s1-exon10-as1 BstNI cuts WT 6
FS400 TR9 1421delT 10 exon9-s1-exon10-as1 Sequencing 4
R409H EL5 1450G->A 10 exon9-s1-exon10-as1 Sequencing 7
T416P EL5 1470A->C 10 exon9-s1-exon10-as1 BanII cuts mutant 5, 6, 10, 12, 13
L445W TR10 1558T->G 11 exon11-s1-exon11-as1 Sequencing 3
C565Y C-terminus 1918G->A 15 1918-F12-1918-R1m2 SspI cuts mutant 9
FS634 C-terminus 2122delA 17 2122-F12-2122-R1m2 MboII cuts mutant 1
H723R C-terminus 2392A->G 19 exon19-s1-exon19-as1 Sequencing 3
Unknown Unknown 1142+1G->A 5[prime] intron 7 exon7-s1-exon8-as1 Sequencing 14
The numbering of amino acids and nucleotides is according to Everett et al. (11).
TR, transmembrane domain; WT, wild-type; EL, extracellular loop; IL, intracellular loop; FSx, frameshift mutation in which x is the position of the first altered amino acid.
1See Everett et al. (11).
2See Table 3.

In consanguineous family 14, a homozygous G->A transition in the first nucleotide of intron 7 (1142+1G->A) was identified. Determining the effect of this splice site mutation was not possible as the PDS gene is not expressed in blood cells, which was the only tissue available for this patient.

A total of 10 missense mutations were identified. The location of these mutations in the pendrin protein and their effect on the protein is given in Table 2. Two frequent PDS mutations (L236P and T416P) were identified. The L236P mutation was found in seven families (Tables 1 and 2) and occurred twice in the homozygous state and five times in the heterozygous state. L236P changes a non-conserved leucine to a proline. This leucine is part of an extracellular loop (EL3; see Table 2) between transmembrane domains 5 and 6 (Fig. 2). Another frequent mutation, T416P, was found in five families, once in the homozygous state and four times in the heterozygous state (Tables 1 and 2). T416P changes a conserved threonine residue into a proline. The threonine at position 416 is located in an extracellular loop (EL5; see Table 2) between transmembrane domains 9 and 10 (Fig. 2). To exclude that these two mutations are frequent in the general population (and thus represent polymorphisms), 48 unrelated control samples of Belgian origin (i.e. 96 chromosomes) were analyzed for L236P and T416P. In no instance was either mutation detected.

Haplotype comparison


Figure 2. Structure of the pendrin protein with indication of the position of all known PDS mutations. As the effect of the 1142+1G->A splice site mutation on the pendrin protein is not yet known, this mutation is not included in this figure. Mutations G, K and N were described by Everett et al. (11). White encircled letters indicate missense mutations, black encircled indicate frameshifts or splice site mutations.


Figure 3. Haplotype analysis in Pendred families with frequent PDS mutations. The haplotype for genetic markers closely linked to the PDS gene is given for families with the L236P mutation and with the T416P mutation. Shaded boxes indicate shared alleles. Intermarker distances are shown on the left. The black box indicates the position of the PDS gene relative to the genetic markers.

To investigate if common ancestral chromosomes accounted for one or both frequent mutations, we compared the disease haplotypes in these families. In a few instances, the linkage phase could not be determined and two possibilities remain for the linked allele. As shown in Figure 3, there is significant haplotype sharing among the families carrying the L236P mutation. Most likely, all patients in these families have inherited this mutation from a common founder.

In the families carrying the T416P mutation, haplotype sharing is also present, albeit to a lesser extent. However, the comparison is complicated by the fact that the linkage phase cannot be determined in family 10, as the family contains only one patient and no DNA is available from the parents. All five families with the T416P mutation share the same allele for marker D7S2459, which is located in an intron of the PDS gene. The frequency for this allele (150 bp) is 20%, as determined in CEPH pedigrees (http://www.genethon.fr/). Therefore, a founder effect is also likely for the T416P mutation.

DISCUSSION

In this study we identified a spectrum of mutations in PDS, the gene responsible for Pendred syndrome, in 14 anamnestically unrelated Pendred families. Ten of these families originate from Western Europe (The Netherlands, Belgium and Denmark). In addition, one family comes from the USA, one from Lebanon, one from Turkey and one from India. In all nine non-consanguineous families two discrete mutations were found, while a single mutation was encountered in every consanguineous family. This suggests that Pendred syndrome is genetically homogeneous and caused by a single gene in virtually all cases.

The 14 mutations consist of three frameshift mutations, one splice site mutation and 10 missense mutations, demonstrating the allelic heterogeneity of Pendred syndrome. Most (11 out of 14) of these mutations were private mutations occurring in a single family. The FS 400 mutation found in family 4 is also present in three Arab families living in northern Israel (11). As family 4 originates from Lebanon, it is possible that the FS 400 mutation is common in the Middle East Arab population.

Two mutations, L236P and T416P, proved to be particularly frequent, as they were present in nine of the 14 families. We looked at 96 control chromosomes for each of these mutations and did not find their occurrence in a single instance. Haplotype analysis (Fig. 3) revealed a partial shared haplotype between families of each group. The families carrying the frequent mutations originate from Western Europe and the USA and these mutations were not detected in the families from Lebanon, Turkey or India. Although the frequency of the mutations remains to be determined in other populations, it is possible that they will be frequent only in patients with ancestors originating from Europe.

The 14 identified PDS mutations are most probably disease causing. The FS 383, FS 400 and FS 634 mutations lead to a frameshift resulting in a truncated protein. The splice site mutation in family 14 changes a G at a position in the 5[prime] splice consensus sequence that is 100% conserved. We calculated that the CV value (16) for this splice site dropped from 0.928 (normal sequence) to 0.76 (mutated sequence). Such a mutation almost always leads to aberrant splicing, either by exon skipping or the use of a cryptic splice site (17). However, the exact effect on the mRNA needs to be determined by RT-PCR. Significant PDS expression has only been convincingly demonstrated in the thyroid (11), which was not available from this patient and RT-PCR amplification of the PDS gene from lymphoblast mRNA has not been successful (data not shown).

Six of the 10 missense mutations (V138F, G139A, G209V, D271H, T416P and L445W) replace amino acids that are conserved among several other related sulfate transporter genes from different species, suggesting their importance in pendrin function. The four missense mutations at non-conserved positions are L236P, C565Y, R209H and H723R. It cannot be excluded that these changes are polymorphisms rather than disease-causing mutations. However, we did not find any other mutation in the PDS coding region in patients of the respective families, although the disease-causing mutation could be located in other regions of the gene, such as the promoter, which were not screened for mutations.

It is possible that the 640G->C change not only results in a G139A change, but also in aberrant splicing of the PDS mRNA, as this mutation occurs immediately adjacent to the 5[prime] splice site of intron 5. The mutation changes the CV value of this splice site (16) from 0.87 (normal sequence) to 0.74 (mutated sequence). However, the exact effect of this mutation on the mRNA could not be determined.

The G209V substitution, found in patient III.1 of family 1 (Fig. 1), changes an amino acid that is conserved in all 14 known sulfate transporter family members. Since this is a conservative substitution (both amino acid residues belong to the same group of non-polar amino acids), one could argue that this does not reflect the disease-causing mutation. This 18-month-old patient has currently only non-syndromic deafness and does not display any thyroid dysfunction. Nonetheless, in the light of the evolutionary conservation at this amino acid position, it seems likely that G209V is disease causing.

Up to now, 16 different mutations in the PDS gene have been discovered (11; this study). Figure 2 is a graphical presentation of the position of these mutations in the pendrin protein. Mutations have been found in four transmembrane regions, two extracellular loops, one intracellular loop and in the C-terminal extracellular region, suggesting that there is no clustering of the mutations in any particular domain of the PDS gene. On the other hand, it should be noted that the four frameshift mutations (Fig. 2) and the splice site mutations,which probably all lead to a truncated protein,are located at the C-terminus of the pendrin protein, leaving a significant portion of the protein intact. It might be possible that a complete lack of pendrin is incompatible with life.

Knowledge of mutations in PDS will aid functional studies of the pendrin protein. Furthermore, with the identification of frequent mutations in the PDS gene, the diagnosis of Pendred syndrome will be facilitated. This is particularly the case for those mutations that can be detected by simple restriction enzyme-based screening methods.

MATERIALS AND METHODS

Subjects

Of the 14 Pendred families analyzed in this study, six have been described before and eight are unpublished. Families 1, 2, 4 and 5 have been described by Coucke et al. (10). Families 3 and 5 have been previously reported by Cremers (18). Table 1 summarizes the ethnic origin and the clinical data for the Pendred families, including the presence of early childhood deafness, goiter and the results of the perchlorate test. All Dutch families were ascertained by the University Hospital of Nijmegen. Some noteworthy clinical aspects of these families and the results of CT scanning of the temporal bone (when performed) are reported below.

Family 1 is a non-consanguineous family and originates from Belgium. Part of this family has already been described (10). Recently, individual II.2 had a congenitally deaf son (individual III.1). No goiter was present at the age of 18 months and the boy had a normal perchlorate test.

Interestingly, an intrafamilial clinical variation exists in families 4 and 6. Although all three patients from family 4 are prelingually deaf and have a Mondini malformation of the cochlea, the presence of goiter and the results of the perchlorate test are variable. The oldest patient has a goiter (examined at age 13) and an abnormal perchlorate test, her sister (examined atage 8) has no goiter but the perchlorate test was abnormal and her brother (examined at age 9) has no goiter and a normal perchlorate test.

In family 6, there is also variation in goiter and the outcome of the perchlorate test. One patient has a small goiter (examined at age 13) but a normal perchlorate test, while her affected sister has an abnormal perchlorate test but no goiter (examined at age 15).

In the Belgian patient of family 11, CT scanning revealed a partial fusion of the basal and apical coil of the cochlea, without the typical characteristics of a Mondini malformation and a widened vestibular aqueduct.

Mutation analysis

Mutation analysis was performed by genomic exon sequencing. All 21 exons were PCR amplified by intragenic primers and sequenced as described before (11). To enable rapid screening for the PDS mutations, we developed specific restriction enzyme assays for most of the mutations. If the mutation destroyed or created a restriction site for a commercially available restriction enzyme, we amplified the respective PDS sequence of all the family members and digested it with the respective restriction enzyme. If no suitable restriction site was created or destroyed by the mutation, we designed a modified primer containing a mismatch that, together with the mutation, artificially introduces a site for a commercially available restriction enzyme. Table 2 describes the restriction enzymes used to identify the different mutations. Table 3 describes which primers were used for the modified PCR experiments. PCR products were purified using the Sephaglas[trade] BandPrep kit (Pharmacia) before digestion. The digestion was carried out using 10-12 U restriction enzyme according to the manufacturer's specifications. If no suitable restriction enzyme was available, confirmation of the mutation in the remaining family members was performed by sequencing.

Table 3. Sequences of primers used for modified PCR to detect PDS mutations
Mutation Primer name Sequence
C565Y 1918-F1m gtaattaaatacttgaggcttg
  1918-R1m aatacttactgtggacttgaaa
D271H 1035-R1 gttggctccatatgaaatggc
  1035-F1m tattggtgataccaatcttgat
FS634 2122-F1 tcataagtgatgctgtttcaac
  2122-R1m ccaatccacttgaatctctctt

ACKNOWLEDGEMENTS

This study was supported by a grant from the University of Antwerp, a grant from the Flemish Fonds voor Wetenschappelijk Onderzoek (FWO) and by NIH grant R01DCO2842 (R.J.H.S.). P.V.H. holds a predoctoral research position with the Vlaams Instituut ter Bevordering van het Wetenschappelijk-Technologisch Onderzoek in de Industrie (IWT). G.V.C. holds a research position with the FWO.

ABBREVIATIONS

CV, consensus value; del, deletion; FS, frameshift.

REFERENCES

1. Pendred, V. (1896) Deaf mutism and goitre. Lancet, i, 532.

2. Gorlin, R.J. (1995) Genetic hearing loss associated with endocrine and metabolic disorders. In Gorlin, R.J. (ed.), Hereditary Hearing Loss and its Syndromes. Oxford University Press, New York, NY, pp. 337-339.

3. Batsakis, J.G. and Nishiyama, R.H. (1962) Deafness with sporadic goiter. Arch. Otolaryngol., 76, 25-30.

4. Fraser, G.R. (1965) Association of congenital deafness with goitre (Pendred's syndrome). A study of 207 families. Hum. Genet., 28, 201-249.

5. Morgans, M.E. and Trotter, W.R. (1958) Association of congenital deafness with goitre (Pendred's syndrome). A study of 207 families. Lancet, i, 607-609.

6. Illum, P., Kiaer, H.W., Hansen, J.H. and Sondergaard, G. (1972) Fifteen cases of Pendred's syndrome, congenital deafness with sporadic goiter. Arch. Otolaryngol., 96, 297-304. MEDLINE Abstract

7. Fraser, G.R., Morgans, M.E. and Trotter, W.R. (1960) The syndrome of sporadic goitre and congenital deafness. Q. J. Med., 29, 279-295.

8. Coyle, B. et al.) (1996) Pendred syndrome (goitre and sensorineural hearing loss) maps to chromosome 7 in the region containing the nonsyndromic deafness gene DFNB4. Nature Genet., 12, 421-423. MEDLINE Abstract

9. Sheffield, V.C., Kraiem, Z., Beck, J.C., Nishimura, D., Stone, E.M., Salameh, M., Sadeh, O. and Glaser, M. (1996) Pendred syndrome maps to chromosome 7q21-34 and is caused by an intrinsic defect in thyroid iodine organification. Nature Genet., 12, 424-426. MEDLINE Abstract

10. Coucke, P. et al.) (1997) The gene for Pendred syndrome is located between D7S501 and D7S692 in a 1.7-cM region on chromosome 7q. Genomics, 40, 48-54. MEDLINE Abstract

11. Everett, L.A. et al.) (1997) Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nature Genet., 17, 411-422. MEDLINE Abstract

12. Xu, Y., Mural, R., Shah, M. and Uberbacher, E. (1994) Recognizing exons in genomic sequence using GRAIL II. Genet. Engng (NY), 16, 241-253.

13. Hoglund, P., Haila, S., Scherer, S.W., Tsui, L.C., Green, E., Weissenbach, J., Holmberg, C., de la Chapelle, A. and Kere, J. (1996) Positional candidate genes for congenital chloride diarrhea suggested by high-resolution physical mapping in chromosome region 7q31. Genome Res., 6, 202-210. MEDLINE Abstract

14. Silberg, D.G., Wang, W., Moseley, R.H. and Traber, P.G. (1995) The down regulated in adeoma gene (dra) encodes an intestine-specific membrane sulphate transporter protein. J. Biol. Chem., 270, 11897-11902. MEDLINE Abstract

15. Hoglund, P. et al.) (1996) Mutations in the down-regulated in adenoma (DRA) gene cause congenital chloride diarrhea. Nature Genet., 14, 316-319. MEDLINE Abstract

16. Shapiro, M.B. and Senapathy, P. (1987) RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res., 15, 7155-7174. MEDLINE Abstract

17. Krawczak, M., Reiss, J. and Cooper, D.N. (1992) The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum. Genet., 90, 41-54. MEDLINE Abstract

18. Cremers, C.W.J.R. (1976) Het syndroom van Pendred. Een autosomaal recessief syndroom met doofheid en een synthesestoornis in de schildklier. T. Kindergeneesk., 44, 89-99.

*To whom correspondence should be addressed. Tel: +323 820 25 70; Fax: +323 820 25 66; Email: gvcamp@uia.ua.ac.be

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 8 Jun 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Physiol. GenomicsHome page
P. Dai, A. K. Stewart, F. Chebib, A. Hsu, J. Rozenfeld, D. Huang, D. Kang, V. Lip, H. Fang, H. Shao, et al.
Distinct and novel SLC26A4/Pendrin mutations in Chinese and U.S. patients with nonsyndromic hearing loss
Physiol Genomics, August 7, 2009; 38(3): 281 - 290.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
F. Palos, M. E. R. Garcia-Rendueles, D. Araujo-Vilar, M. J. Obregon, R. M. Calvo, J. Cameselle-Teijeiro, S. B. Bravo, O. Perez-Guerra, L. Loidi, B. Czarnocka, et al.
Pendred Syndrome in Two Galician Families: Insights into Clinical Phenotypes through Cellular, Genetic, and Molecular Studies
J. Clin. Endocrinol. Metab., January 1, 2008; 93(1): 267 - 277.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
L. Fugazzola, V. Cirello, S. Dossena, S. Rodighiero, M. Muzza, P. Castorina, F. Lalatta, U. Ambrosetti, P. Beck-Peccoz, G. Botta, et al.
High phenotypic intrafamilial variability in patients with Pendred syndrome and a novel duplication in the SLC26A4 gene: clinical characterization and functional studies of the mutated SLC26A4 protein
Eur. J. Endocrinol., September 1, 2007; 157(3): 331 - 338.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
K. Krohn, D. Fuhrer, Y. Bayer, M. Eszlinger, V. Brauer, S. Neumann, and R. Paschke
Molecular Pathogenesis of Euthyroid and Toxic Multinodular Goiter
Endocr. Rev., June 1, 2005; 26(4): 504 - 524.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
S. Makela, R. Eklund, J. Lahdetie, M. Mikkola, O. Hovatta, and J. Kere
Mutational analysis of the human SLC26A8 gene: exclusion as a candidate for male infertility due to primary spermatogenic failure
Mol. Hum. Reprod., February 1, 2005; 11(2): 129 - 132.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
U. Napiontek, G. Borck, W. Muller-Forell, N. Pfarr, A. Bohnert, A. Keilmann, and J. Pohlenz
Intrafamilial Variability of the Deafness and Goiter Phenotype in Pendred Syndrome Caused by a T416P Mutation in the SLC26A4 Gene
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5347 - 5351.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
G. Borck, C. Roth, U. Martine, G. Wildhardt, and J. Pohlenz
Mutations in the PDS Gene in German Families with Pendred's Syndrome: V138F Is a Founder Mutation
J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2916 - 2921.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
H-J Park, S Shaukat, X-Z Liu, S H Hahn, S Naz, M Ghosh, H-N Kim, S-K Moon, S Abe, K Tukamoto, et al.
Origins and frequencies of SLC26A4 (PDS) mutations in east and south Asians: global implications for the epidemiology of deafness
J. Med. Genet., April 1, 2003; 40(4): 242 - 248.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
P. Rotman-Pikielny, K. Hirschberg, P. Maruvada, K. Suzuki, I. E. Royaux, E. D. Green, L. D. Kohn, J. Lippincott-Schwartz, and P. M. Yen
Retention of pendrin in the endoplasmic reticulum is a major mechanism for Pendred syndrome
Hum. Mol. Genet., October 2, 2002; 11(21): 2625 - 2633.
[Abstract] [Full Text] [PDF]

Home page
 NEJMHome page
J. C. Moreno, H. Bikker, M. J.E. Kempers, A.S. P. van Trotsenburg, F. Baas, J. J.M. de Vijlder, T. Vulsma, and C. Ris-Stalpers
Inactivating Mutations in the Gene for Thyroid Oxidase 2 (THOX2) and Congenital Hypothyroidism
N. Engl. J. Med., July 11, 2002; 347(2): 95 - 102.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
J. P. Taylor, R. A. Metcalfe, P. F. Watson, A. P. Weetman, and R. C. Trembath
Mutations of the PDS Gene, Encoding Pendrin, Are Associated with Protein Mislocalization and Loss of Iodide Efflux: Implications for Thyroid Dysfunction in Pendred Syndrome
J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1778 - 1784.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
A. M. L. Yong, S. S. Goh, Y. Zhao, P. H. K. Eng, L. K. H. Koh, and D. H. C. Khoo
Two Chinese Families with Pendred's Syndrome--Radiological Imaging of the Ear and Molecular Analysis of the Pendrin Gene
J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3907 - 3911.
[Abstract] [Full Text] [PDF]

Home page
 Arch Otolaryngol Head Neck SurgHome page
S. Iwasaki, S.-i. Usami, S. Abe, H. Isoda, T. Watanabe, and T. Hoshino
Long-term Audiological Feature in Pendred Syndrome Caused by PDS Mutation
Arch Otolaryngol Head Neck Surg, June 1, 2001; 127(6): 705 - 708.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
E. Haberlandt, J. Löffler, A. Hirst-Stadlmann, B. Stöckl, W. Judmaier, H. Fischer, P. Heinz-Erian, T. Müller, G. Utermann, R. J H Smith, et al.
Split hand/split foot malformation associated with sensorineural deafness, inner and middle ear malformation, hypodontia, congenital vertical talus, and deletion of eight microsatellite markers in 7q21.1-q21.3
J. Med. Genet., June 1, 2001; 38(6): 405 - 409.
[Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
I. E. Royaux, S. M. Wall, L. P. Karniski, L. A. Everett, K. Suzuki, M. A. Knepper, and E. D. Green
Pendrin, encoded by the Pendred syndrome gene, resides in the apical region of renal intercalated cells and mediates bicarbonate secretion
PNAS, March 27, 2001; 98(7): 4221 - 4226.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
L. A. Everett, I. A. Belyantseva, K. Noben-Trauth, R. Cantos, A. Chen, S. I. Thakkar, S. L. Hoogstraten-Miller, B. Kachar, D. K. Wu, and E. D. Green
Targeted disruption of mouse Pds provides insight about the inner-ear defects encountered in Pendred syndrome
Hum. Mol. Genet., January 1, 2001; 10(2): 153 - 161.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
B. Bakker, H. Bikker, T. Vulsma, J. S. E. de Randamie, B. M. Wiedijk, and J. J. M. de Vijlder
Two Decades of Screening for Congenital Hypothyroidism in the Netherlands: TPO Gene Mutations in Total Iodide Organification Defects (an Update)
J. Clin. Endocrinol. Metab., October 1, 2000; 85(10): 3708 - 3712.
[Abstract] [Full Text]

Home page
 Hum Mol GenetHome page
D. A. Scott, R. Wang, T. M. Kreman, M. Andrews, J. M. McDonald, J. R. Bishop, R. J.H. Smith, L. P. Karniski, and V. C. Sheffield
Functional differences of the PDS gene product are associated with phenotypic variation in patients with Pendred syndrome and non-syndromic hearing loss (DFNB4)
Hum. Mol. Genet., July 1, 2000; 9(11): 1709 - 1715.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
L. Fugazzola, D. Mannavola, N. Cerutti, M. Maghnie, F. Pagella, P. Bianchi, G. Weber, L. Persani, and P. Beck-Peccoz
Molecular Analysis of the Pendred's Syndrome Gene and Magnetic Resonance Imaging Studies of the Inner Ear Are Essential for the Diagnosis of True Pendred's Syndrome
J. Clin. Endocrinol. Metab., July 1, 2000; 85(7): 2469 - 2475.
[Abstract] [Full Text]

Home page
 J. Clin. Endocrinol. Metab.Home page
E. PAUWS, J. C. MORENO, M. TIJSSEN, F. BAAS, J. J. M. de VIJLDER, and C. RIS-STALPERS
Serial Analysis of Gene Expression as a Tool to Assess the Human Thyroid Expression Profile and to Identify Novel Thyroidal Genes
J. Clin. Endocrinol. Metab., May 1, 2000; 85(5): 1923 - 1927.
[Abstract] [Full Text]

Home page
 NEJMHome page
P. J. Willems
Genetic Causes of Hearing Loss
N. Engl. J. Med., April 13, 2000; 342(15): 1101 - 1109.
[Full Text] [PDF]

Home page
 QJMHome page
W. Reardon, C.F. O Mahoney, R. Trembath, H. Jan, and P.D. Phelps
Enlarged vestibular aqueduct: a radiological marker of Pendred syndrome, and mutation of the PDS gene
QJM, February 1, 2000; 93(2): 99 - 104.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
L. A. Everett and EricD. Green
A family of mammalian anion transportersand their involvement in human genetic diseases
Hum. Mol. Genet., September 1, 1999; 8(10): 1883 - 1891.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
L. A. Everett, H. Morsli, D. K. Wu, and E. D. Green
Expression pattern of the mouse ortholog of the Pendred's syndrome gene (Pds) suggests a key role for pendrin in the inner ear
PNAS, August 17, 1999; 96(17): 9727 - 9732.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
B. Vaidya, R. Coffey, B. Coyle, R. Trembath, C. San Lazaro, W. Reardon, and P. Kendall-Taylor
Concurrence of Pendred Syndrome, Autoimmune Thyroiditis, and Simple Goiter in One Family
J. Clin. Endocrinol. Metab., August 1, 1999; 84(8): 2736 - 2738.
[Abstract] [Full Text]

Home page
 J. Med. Genet.Home page
P J Coucke, P Van Hauwe, L A Everett, O Demirhan, Y Kabakkaya, N L Dietrich, R J H Smith, E Coyle, W Reardon, R Trembath, et al.
Identification of two different mutations in the PDS gene in an inbred family with Pendred syndrome
J. Med. Genet., June 1, 1999; 36(6): 475 - 477.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (83)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Van Hauwe, P.
Right arrow Articles by Van Camp, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Hauwe, P.
Right arrow Articles by Van Camp, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?