Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (40)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yavari, R.
Right arrow Articles by Xu, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yavari, R.
Right arrow Articles by Xu, T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1161-1167  

Human metalloprotease-disintegrin Kuzbanian regulates sympathoadrenal cell fate in development and neoplasia
Introduction
Results
Discussion
Materials And Methods
   cDNA cloning
   Riboprobe in situ hybridization
   kuz constructs and cell transfection experiments
   Immunohistochemistry
   Fluorescence in situ hybridization
Acknowledgements
References

Human metalloprotease-disintegrin Kuzbanian regulates sympathoadrenal cell fate in development and neoplasia

Human metalloprotease-disintegrin Kuzbanian regulates sympathoadrenal cell fate in development and neoplasia

Reza Yavari1,2,3, Colette Adida4, Patricia Bray-Ward2, Michael Brines3, Tian Xu1,2,*

1Howard Hughes Medical Institute and Departments of 2Genetics, 3Medicine and 4Pathology, Yale School of Medicine, Boyer Center for Molecular Medicine, 295 Congress Avenue, New Haven, CT 06536-0812, USA

Received February 18, 1998; Revised and Accepted April 15, 1998

The development of the sympathetic nervous system involves cell-cell interactions that regulate the fate and migration of progenitor neural cells. Recent evidence shows that focal membrane-bound protease activity is critical for such interactions. The Drosophila kuzbanian (kuz) gene is required in neurogenesis and encodes a highly conserved, membrane-bound metalloprotease- disintegrin closley related to the TNF-[alpha] converting enzyme (TACE). We have characterized the human and mouse kuz homologs and mapped human kuz to chromosome 15q22. During mouse embryonic development Kuz is expressed mainly in the sympathoadrenal and olfactory neural precursors. Once sympathoadrenal cells differentiate into chromaffin cells in the adult adrenal medulla, they no longer express Kuz. However, we found that tumors of sympathoadrenal origin, such as pheochromocytomas and neuroblastomas, overexpress Kuz. Further, transfection of a kuz construct lacking the protease domain, but not the full-length construct, induces neurite formation in PC12 chromaffin tumor cells. Taken together our results suggest a critical role for Kuz in regulation of sympathoadrenal cell fate.

INTRODUCTION

Metalloprotease-disintgerins constitute a growing family of proteins implicated in many important biological processes involving cell-cell and cell-matrix interactions (1). Since the initial isolation of soluble hemorrhagic metalloprotease-disintegrins from snake venom (2,3), both soluble and related membrane-bound proteins have been identified in numerous organisms and are now referred to as the ADAM family (4,5). Moreover, the functions of these metalloprotease-disintegrins are no longer confined to the hemorrhagic or fibrinolytic activity seen in snake venom. Fertilin plays a role in sperm maturation and sperm-egg fusion (6,7), while meltrin-[alpha] is involved in myoblast fusion (8). ADAMs may also exert their function by focal cell surface-mediated protease activity. Direct evidence confirming such activity has been demonstrated for TNF-[alpha] converting enzyme (TACE), a newly described ADAM (9,10).

The Drosophila kuzbanian (kuz) gene encodes a highly conserved, membrane-bound metalloprotease-disintegrin (11). Genetic studies in Drosophila revealed that Kuzplays multiple roles during neural development. First, inactivation of kuz results in embryonic lethality caused by massive neural hyperplasia and mosaic flies containing patches of kuz mutant cells develop extra sensory bristles (11). Second, mosaic analysis in the fly adult peripheral nervous system shows that Kuz is also involved in positive signaling between neighboring cells to promote development of mechanosensory neural precursors (11). Finally, Kuz has also been implicated in axon pathfinding during Drosophila embryonic development (12). In mammals, a bovine homolog of Kuz known as MADM was discovered in an assay designed to isolate proteins able to degrade myelin basic protein, but its function in vivo has not been investigated (13). MADM and its human homolog ADAM 10 have previously been investigated as TNF-[alpha] convertases (14,15). The function of mammalian Kuz in development and in particular in neurogenesis is not yet known.

In this report we describe the cloning of two human kuz cDNAs and examine the expression pattern of human and mouse Kuz. The two cDNAs correspond to a full-length form of Kuz (called KuzL) and a short form (called KuzS), which lacks the cysteine-rich, transmembrane and cytoplasmic domains, possibly encoding a soluble form of the same gene product. Our results show that Kuz is involved in the development of sensory neurons of the olfactory epithelium and the sympathoadrenal lineage. In the olfactory system our findings suggest that Kuz plays a role in neuronal differentiation and in axon pathfinding. In the sympathetic nervous system, Kuz is expressed in the developing neuroblasts and tumors of the adrenal medulla, such as neuroblastomas, but not in normal adult adrenals. Our investigation of Kuz expression during development and in neoplasia, together with our cell transfection studies using a kuz construct lacking the region encoding the protease function, previously shown to act in a dominant negative fashion in vivo (16), suggest a critical role for Kuz in regulation of sympathoadrenal cell fate.


Figure 1. Human kuzL and kuzS cDNAs (A) and their predicted products (B and C). (A) The location of the start and stop codons are marked by an arrow and a star respectively. The sequence of kuzS cDNA diverges from that of kuzL immediately after the disintegrin domain. The BamHI-BamHI fragment (probe A), the BamHI-PstI fragment (probe B, specific for kuzL), and the BspMI-XbaI fragment (probe C, specific for kuzS) were used for northern analysis. (B) The Kuz protein products are diagrammed with individual domains. SP, signal peptide; PD, prodomain; MP, metalloprotease domain; D, disintegrin domain; CR, cysteine-rich region; TM, transmembrane domain; CT, cytoplasmic tail. The dominant negative construct kuzDN-myc lacks the region containing the metalloprotease domain and most of the prodomain (see Materials and Methods). (C) The human KuzL and KuzS amino acid sequences. Individual domains are indicated above the amino acid sequence. Potential myristilation sites are underlined. The prodomain of human Kuz is separated from the metalloprotease domain by a furine-type serine protease cleavage site shown in parentheses. The sequence surrounding Cys173, PQGGCAD, is similar in motif and location to the so-called `cysteine switch' present in matrix metalloproteases (26). The presumed cysteine switch and the furine-type cleavage site in the prodomain suggest that Kuz is synthesized as an inactive pro-enzyme and is proteolytically activated. Potential amidation sites are underlined and marked +. The consensus sequence defining the metalloprotease catalytic site is marked by a black box. In the disintegrin domain, a putative integrin binding site (RDD) is boxed and potential SH3 binding proline-rich sequences in the cytoplasmic domain are underlined and marked with asterisks. KuzS diverges from KuzL after G565 and has three different amino acid residues (VSI) followed by a stop codon (shown below the KuzL sequence).


Figure 2. Northern analysis of human and mouse Kuz expression. (A) Human fetal and adult multiple tissue northern blots were probed with probe A (see Fig. 1A). Tissues are labeled above the lanes. The 4.9 kb kuzL and 4.4 kb kuzS transcripts are marked with arrowheads. (B) A human adult brain northern blot was probed with either probe B (kuzL-specific, left) or probe C (kuzS-specific, right), showing that both transcripts are expressed in these adult brain tissues. (C) A mouse adult multiple tissue northern blot showing a single 5.7 kb kuz transcript. All blots were also probed with an actin probe as a control.

RESULTS

To investigate the function(s) of mammalian Kuz, we cloned the human and mouse homologs of kuz using PCR with primers designed based on conserved regions in the fly and bovine sequences followed by library screening. Analysis of positive clones isolated from a human fetal brain library revealed two related groups of cDNAs. The first group of cDNAs encode a 748 amino acid modular protein KuzL, containing all domains present in fly and bovine Kuz (Fig. 1). The second group of cDNAs encode a shorter protein KuzS (568 amino acids). KuzS lacks the cysteine-rich, transmembrane and cytoplasmic domains of KuzL. After the disintegrin domain, the kuzS cDNA differs from kuzL and encodes three amino acids followed by a stop codon. A kuz cosmid clone containing the coding sequence present in both cDNAs was isolated by screening a human genomic library and used for chromosome mapping. Fluorescence in situ hybridization (FISH) using this cosmid clone showed a single location at 0.61-0.66 FLpter on chromosome 15 or 15q22 by cytogenetic banding. We next analyzed the tissue distribution of the two transcripts. Northern blots from fetal and adult human tissues were hybridized with three different probes: probe A is common to both kuzL and kuzS; probes B and C are unique to kuzL and kuzS respectively (Fig. 1A). Probe B specifically hybridized to a 4.9 kb transcript (kuzL) and probe C only hybridized to a 4.4 kb transcript (kuzS), while the common probe A hybridized to both transcripts (Fig. 2A and B). Both transcripts are expressed in developing human fetal tissues with a variable pattern (Fig. 2A). For example, fetal brain expresses much more kuzS than kuzL, while fetal lung expresses predominantly kuzL. On the other hand, adult tissues express mainly kuzS, with the exception of thymus and brain tissues, which express both transcripts (Fig. 2A and B). In addition, kuzS expression is notably elevated in adult human gonads (Fig. 2A). Screening a mouse fetal brain cDNA library and PCR amplification of two additional mouse cDNA libraries yielded only one type of cDNA encoding a product similar to human kuzL (16) A mouse northern blot from multiple adult tissues showed a single 5.7 kb transcript (Fig. 2C), as did a mouse northern blot from embryonic tissues (not shown). Therefore, the presence of the kuzS transcript appears to be unique to humans.

We examined Kuz expression in mouse embryos using immunohistochemistry with an anti-human Kuz Mab and RNA in situ with a mouse cRNA probe. Both analyses revealed concordant expression patterns in the developing mouse nervous system. As shown in Figure 3C-F, Kuz is expressed in the developing olfactory neuroepithelium. The olfactory receptor neurons are contained in a pseudostratified columnar epithelium surrounded by sustentacular cells (support cells). These neurons are readily distinguished by their apical cilia and the location of their cell bodies in the lower two thirds of the epithelium above the neuroprecursor basal cells. As shown in Figure 3E and F, Kuz immunoreactivity is clearly demonstrated in both olfactory receptor neurons and basal cells but not in the sustentacular cells. Axons of the olfactory receptor neurons penetrate the basal lamina of the epithelium, join and form the olfactory nerve. Figure 3G shows Kuz expression in the olfactory nerve and in fibers of the optic nerve. In addition to the olfactory and optic nerves, Kuz expression is observed in the sensory trigeminal innervation of the head. This is most notable in the terminal fibers of the trigeminal nerve converging on vibrissae (Fig. 3H). The trigeminal ganglion where the cell bodies of these neurons are located expresses Kuz, but to a lesser degree (Fig. 3I). Kuz is also expressed in the neuroepithelial and the intermediate zone of the neopallial cortex, where differentiating and migrating neurons are located (Fig. 3J). Kuz is also expressed in the cervical superior sympathetic ganglia (Fig. 3K), in the stellate chain (not shown) and the dorsal root ganglia of the autonomic nervous system (Fig. 3A and L).


Figure 3. Kuz expression in mouse embryos. RNA in situ (A-C) immunohistochemical staining (D-L) of day 15.5 mouse embryo and adult mouse adrenal (M). (A) Mouse embryo showing positive hybridization with antisense mouse kuz riboprobe. The cervical ganglia (cg), thymus (t) and dorsal ganglia (dg) are marked. (B) Control RNA in situ with a sense riboprobe confirming the signal in the liver as a false positive. (C) A high magnification image of another section showing signal in the main olfactory epithelium (moe) and forebrain. (D) Kuz immunoreactivity in the nasal neuroepithelium. (E) Higher magnification view of (D) showing Kuz expression in the olfactory receptor neurons marked by their apical cilia and the position of their nuclei (orn, arrows) surrounded by sustentacular cells. (F) High magnification view of the base of the olfactory neuroepithelium showing Kuz expression in basal precursor cells (bc) and in the acini of the vomeronasal organ (vno). Nerve fibers attached to an acinus are marked by an arrowhead. (G) Kuz expression in the olfactory (olf) and optic (opt) nerves. (H) Kuz expression in the trigeminal nerve termini converging on vibrissae. (I) Trigeminal ganglion (tg). (J) Kuz expression in the neuroepithelial layer (ne) and the intermediate zone (iz) layer of the neopallial cortex, where differentiating and migrating CNS neurons are located. (K) Superior cervical ganglia; the second vertebrate is marked (C2). (L) Dorsal ganglion. (M) Normal adult mouse adrenal medulla showing no Kuz immunoreactivity. Scale bar 50 µm.

Kuz expression in the developing olfactory and sympathetic nervous systems resembles that of Mash1, a mouse homolog of the Drosophila proneural Achaete-Scute proteins (17,18). Activation of Mash1 has been implicated in tumors of the adrenal medulla (19). Thus, we studied the expression of Kuz in tumors of sympathoadrenal origin. We found high Kuz immunoreactivity in four out of five human adrenal pheochromocytomas (chromaffin cell tumors) but not in normal adjacent adrenal medulla (Fig. 4A and B). A high level of Kuz expression was also observed in a significant number of neuroblastomas (eight of 12 tumors; Fig. 4C). In contrast, normal adult adrenal medulla of mouse or human show no Kuz expression by immunohistochemistry (Fig. 3M and the section containing normal human and tumor tissue shown in Fig. 4A and B) or by northern analysis (human multiple endocrine blot, not shown). To study whether Kuz is involved in the determination of sympathoadrenal cell fate, we transfected PC12 cells (derived from a rat pheochromocytoma) with the kuzDN construct, which lacks the region encoding the protease domain (and part of the prodomain; Fig. 1B; 16). Both transient transfections and stably transfected cell lines showed that KuzDN was able to induce neurite formation in PC12 cells (Fig. 5), while full-length Kuz did not. These cells were characterized by extensive neurite formation in the absence of NGF as well as other phenotypic markers of neuronal differentiation, such as flattened cell bodies, prolonged, curved neurites with growth cones and spiny processes (Fig. 5C and D). These results support the notion that Kuz maintains cells in a precursor state and inactivation or down-regulation of Kuz function results in neuronal differentiation.


Figure 4. (A) Human pheochromocytoma showing high Kuz expression in the tumor but not in adjacent normal adrenal medulla. (B) A high magnification view of an area in (A) showing Kuz expression in neoplastic (arrows) but not in normal chromaffin (arrowheads) cells. (C) Human neuroblastoma showing Kuz expression in ganglionic cells. (D) A negative control of the same tumor hybridized in the absence of the primary (anti-Kuz) antibody. Scale bar 50 µm.


Figure 5. PC12 lines stably transfected with kuzDN. (A) Wild-type PC12 cells grown on collagen I-coated plastic dishes stretch somewhat but do not extend neurites. A stably transfected cell line (801) grown at high density (B) or lower density (C). (D) A second stable line (852) grown at low density as in (C). Both (C) and (D) show the characteristics of neuronal differentiation of PC12 cells: flattened cell bodies, long and curved neurites, spiny processes and growth cones (arrowheads). Scale bar 50 µm.

DISCUSSION

Our in situ and immunohistochemical studies show that as in Drosophila, mammalian Kuz could be involved in the differentiation of sensory neurons. In the olfactory system Kuz is expressed in the neuroepithelial precursor basal cells and olfactory receptor neurons but not in the support cells, which also derive from basal cells. In addition, Kuz expression is markedly elevated in nerve fibers converging on their targets, such as the terminal trigeminal nerve fibers and the olfactory neurons. Detection of Kuz expression in nerve fibers provides direct evidence in support of Kuz function in axon pathfinding, as indicated by phenotypic analysis of Drosophila kuz mutants (12). In the peripheral nervous system, sympathoadrenal precursor cells move ventrally from the neural tube and differentiate into sympathetic neurons or migrate further to the adrenal medulla, where they undergo chromaffin differentiation (17,20). Neoplastic transformation in the sympathoadrenal lineage therefore results in neuroblastoma or pheochromocytoma (chromaffin cell tumor). We have found that Kuz is expressed in the sympathetic ganglia, in the fetal adrenal and in adrenal medullary tumors, such as neuroblastoma and pheochromocytoma, but not in the normal adult adrenal medulla. That Kuz is expressed in progenitor and neoplastic cells of the sympathoadrenal lineage but not in normal adrenal medulla is intriguing. It suggests that Kuz expression is a characteristic common to neoplastic neuroblast and chromaffin cells as well as their normal progenitor cells. Thus, Kuz expression may imply that neoplastic cells of the adrenal medulla undergo `dedifferentiation' to a common progenitor state and Kuz activity may be essential to maintain such a state. Finally, given the unpredictable behavior of neuroblastomas in vivo, which have the remarkable ability to undergo either chromaffin differentiation or become more undifferentiated and aggressive, Kuz immunoreactivity in these tumors may be of prognostic value. PC12 cells transfected with the kuzDN construct but not the full-length kuzL construct, undergo neurite formation and show morphological signs of differentiation. It was previously suggested that transfection of kuzDN affects Notch processing in Drosophila cells (16). However, examining western blots from cells transfected with kuzDN, we did not detect any obvious difference in the processing products of the mammalian Notch homologs Notch1 and Notch2 in PC12 or Cos cells (data not shown). Nevertheless, our transfection experiments with kuzDN support the notion that Kuz maintains cells in a precursor state and inactivation or down-regulation of Kuz function results in neuronal differentiation.

It has been suggested that mammalian Kuz may play a role in the pathogenesis of demyelinating disorders such as multiple sclerosis, but so far supporting evidence is lacking (21,22) and no such disorders have been linked to the kuz locus on 15q22. Our findings of Kuz expression during mouse development and in human neoplasia and our cell transfection studies, together with previous observations in Drosophila, indicate that Kuz plays a critical role in neuronal cell fate determination in mammals (11,16) and shed light on the type of disorder that may result from Kuz dysfunction.

MATERIALS AND METHODS

cDNA cloning

The primers ATGATGACTACTGTTTGGCCTA (corresponding to the amino acid sequence HDDYCLAY) and TGCATGGGGATCCAGGTTGCAG (amino acids LQPGSPC) were used to PCR amplify a 0.9 kb fragment from a human fetal brain cDNA library (Stratagene). This fragment was used to screen ~1 000 000 plaques to obtain 42 positives. The positives were grouped by PCR and restriction analysis, followed by sequencing. The same PCR fragment was used to screen the 500 000 entries of a mouse fetal brain cDNA library (Stratagene). Four positives were analyzed and a 4 kb mouse cDNA (mKuz1) was used as probe for northern analysis and for in situ hybridization.

Riboprobe in situ hybridization

35S-labeled mKuz1 riboprobe was synthesized in both sense and antisense orientations using an RNA labeling kit (Amersham). Ten micrometer thick sections of day 13.5 and 15.5 mouse embryos mounted on slides were dehydrated and incubated in 1 ml hybridization buffer containing 3 × 106 c.p.m./ml riboprobe activity as described previously (23).

kuz constructs and cell transfection experiments

A 2.9 kb kuzL cDNA was C-terminal myc-tagged by cloning into pcDNA3.1c (Invitrogen) to generate kuzL-myc. kuzDN-myc was constructed according to the fly KUZDN construct (W.Y. Wang and T. Xu, unpublished results; 16). Several steps of subcloning were used to delete the sequence encoding most of the prodomain and the metalloprotease domain (Fig. 1, the XbaI-MscI fragment, L62-G456), resulting in an in-frame fusion of the rest of the coding sequence. The constructs were tested for expression by western analysis using anti-Myc antibody (Calbiochem). Approximately 2 × 105 PC12 cells were plated in RPMI with glutamine, 10% heat-inactivated horse serum, 5% FBS and penicillin/streptomycin on rat collagen I-coated plates (Beckton). Forty eight hours later cells were transfected with the kuz constructs and a control pcDNA3.1-lacZ (Invitrogen) using Lipofectamine according to the manufacturer's instructions (Gibco BRL). Each experiment was repeated at least three times. The transfection efficiency in our experiments was ~30%, as judged by X-gal staining of the control cells. To establish stably transfected cell lines an identical protocol was followed except for the addition of G418 to culture medium at a final concentration of 400 µg/ml. The medium was changed three times a week. After 2-3 weeks individual colonies of neomycin-resistant PC12 cells were passaged by gentle suction.

Immunohistochemistry

A rat anti-human Kuz monoclonal antibody (KZ14) was generated against a GST fusion construct containing G390-G629, which recognizes both human and mouse Kuz proteins. Five micrometer tissue sections were prepared, deparaffinized and rehydrated, followed by quenching of endogenous peroxidase activity with 2% H2O2 in methanol. Slides were washed in distilled water, immersed in citrate buffer (0.01 mol/l, pH 6.0) and boiled for 5 min in a standard pressure cooker and were then incubated in 10% normal horse serum with or without KZ14 overnight at 4°C. After three washes in PBS (pH 7.4), slides were incubated with a biotin-conjugated anti-rat IgG (Vector Laboratories) for 30 min at room temperature, then washed in PBS. After incubation with streptavidin-biotin-conjugated peroxidase (Boehringer Mannheim) for 30 min at room temperature, slides were washed in PBS and immunoreactivity was visualized with 3,3[prime]-diaminobenzidine. To exclude false positive staining due to residual endogenous biotin, the alkaline phosphatase/anti-alkaline phosphatase method was used with an alkaline phosphatase-conjugated anti-rat IgG under otherwise identical conditions.

Fluorescence in situ hybridization

A kuz cosmid clone was labeled with digoxigenin-11-dUTP by nick translation and co-hybridized with biotinylated GM-009 Alu oligonucleotide on metaphase chromosome spreads. Hybridization conditions, post-hybridization washes and probe detection with DAPI counterstaining were as previously described (24). The cytogenetic band location was determined by analysis of the GM-009 banding pattern (R-like banding) on 10 individual chromosomes and was confirmed by inference from the FLpter measurement (25).

ACKNOWLEDGEMENTS

The authors thank Wufan Tao and Gabriel Haddad for invaluable input during this project and Jenny Rooke for insightful discussions and critical reading of the manuscript. R.Y. is the recipient of a Howard Hughes Post-doctoral Fellowship Award for Physicians. This work was also supported in part by grants from the National Institutes of Health, the Pew Scholars Program in the Biomedical Sciences and the Lucille P. Markey Charitable Trust.

REFERENCES

1. Basbaum, C.B. and Werb, Z. (1996) Focalized proteolysis: spatial and temporal regulation of extracellular matrix degradation at the cell surface. Curr. Opin. Cell Biol., 8, 731-738. MEDLINE Abstract

2. Hite, L.A., Shannon, J.D., Bjarnason, J.B. and Fox, J.W. (1992) Sequence of a cDNA clone encoding the zinc metalloproteinase hemorrhagic toxin from Crotaus atrox: evidence for signal, zymogen, and disintegrin-like structures. Biochemistry, 31, 6203-6211. MEDLINE Abstract

3. Kini, R.M. and Evans, H.J. (1992) Structural domains in venom proteins: evidence that metalloproteinases and nonenzymatic platelet aggregation inhibitors (disintegrins) from snake venoms are derived by proteolysis from a common precursor. Toxicon, 30, 265-293. MEDLINE Abstract

4. Weskamp, G. and Blobel, C.P. (1994) Family of cellular proteins related to snake venom disintegrins. Proc. Natl Acad. Sci. USA, 91, 2749-2751.

5. Wolfsberg, T.G., Straight, P.D., Gerena, R.L., Huovla, A.J., Primakoff, P., Myles, D.G. and White, J.D. (1995) ADAM, a widely distributed and developmentally regulated gene family encoding membrane proteins with a disintegrin and metalloprotease domain. Dev. Biol., 169, 378-383. MEDLINE Abstract

6. Blobel, C.P., Wolfsberg, T.G., Turck, C.W., Myles, D.G., Primakoff, P. and White, J.D. (1992) A potential fusion peptide and an integrin ligand domain in a protein active in sperm-egg fusion. Nature, 356, 248-252. MEDLINE Abstract

7. Wolfsberg, T.G. and White, J.M. (1996) ADAMs in fertilization and development. Dev. Biol., 180, 389-401.

8. Yagami-Hiromasa, T., Sato, T., Kurisaki, T., Kamijo, K., Nabeshima, Y. and Fujisawa-Sehara, A. (1995) A metalloprotease-disintegrin participating in myoblast fusion. Nature, 377, 652-656. MEDLINE Abstract

9. Black, R.A. et al.) (1997) A metalloproteinase disintegrin that releases tumor-necrosis factor-[alpha] from cells. Nature, 385, 729-733. MEDLINE Abstract

10. Moss, M.L. et al.) (1997) Cloning of a disintegrin metalloprotease that processes precursor tumor-necrosis factor-[alpha]. Nature, 385, 733-736. MEDLINE Abstract

11. Rooke, J., Pan, D., Xu, T. and Rubin, G.M. (1996) KUZ, a conserved metalloprotease-disintegrin protein with two roles in Drosophila neurogenesis. Science, 273, 1227-1231. MEDLINE Abstract

12. Fambrough, D., Pan, D., Rubin, G.M. and Goodman, C.S. (1996) The cell surface metalloprotease/disintegrin Kuzbanian is required for axonal extension in Drosophila. Proc. Natl Acad. Sci. USA, 93, 13233-13238. MEDLINE Abstract

13. Howard, L., Lu, X., Mitchell, S., Griffiths, S. and Glynn, P. (1996) Molecular cloning of MADM: a catalytically active mammalian disintegrin-metalloprotease expressed in various cell types. Biochem. J., 317, 45-50. MEDLINE Abstract

14. Lunn, C.A., Fan, X., Dalie, B., Miller, K., Zavodny, P.J., Narula, S.K. and Lundell, D. (1997) Purification if ADAM 10 from bovine spleen as a TNF[alpha] convertase. FEBS Lett., 400, 333-335. MEDLINE Abstract

15. Rosendhal, M.S. et al.) (1997) Identification and characterization of a pro-tumor necrosis factor-[alpha]-processing enzyme from the ADAM family of zinc metalloproteases. J. Biol. Chem., 272, 24588-24593.

16. Pan, D. and Rubin, G.M. (1997) Kuzbanian controls proteolytic processing of Notch and mediates lateral inhibition during Drosophila and vertebrate neurogenesis. Cell, 90, 271-280. MEDLINE Abstract

17. Anderson, D.J. (1993) Molecular control of cell fate in the neural crest: the sympathoadrenal lineages. Annu. Rev. Neurosci., 116, 129-158.

18. Guillemot, F., Lo., L.C., Johnson, J.E., Auerbach, A., Anderson, D.J. and Joyner, A.L. (1993) Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons. Cell, 75, 463-476. MEDLINE Abstract

19. Ball, D.W., Azzoli, C.G., Baylin, S.B., Chi, D., Dou, S., Donis-Keller, H., Cumaraswamy, A., Borges, M. and Nelkin, B.D. (1993) Identification of a human achaete-scute homolog highly expressed in neuroendocrine tumors. Proc. Natl Acad. Sci. USA, 90, 5648-5652. MEDLINE Abstract

20. Douarin, N.M.L., Dupin, E. and Ziller, C. (1994) Genetic and epigenetic control in neural crest development. Curr. Opin. Genet. Dev., 4, 685-695.

21. Chantry, A., Gregson, N.A. and Glynn, P. (1989) A novel metalloprotease associated with brain myelin membranes. Isolation and characterization. Biol. Chem., 264, 21603-21607.

22. Chantry, A. and Glynn, P. (1990) A novel metalloprotease originally isolated from brain myelin membranes is present in many tissues. Biochem. J., 268, 245-248. MEDLINE Abstract

23. Schmauss, C., Brines, M.L. and Lerner, M.R. (1992) The small ribonucleoprotein-associated protein N is expressed in neurons but not in glia. J. Biol. Chem., 267, 8521-8529. MEDLINE Abstract

24. Lu-Kuo, J., Ward, D.C. and Spitz, R.A. (1993) Fluorescence in situ hybridization mapping of 25 markers on distal human chromosome 2q surrounding the human Waardenburg syndrome, type 1 (WS1) locus (PAX3 gene). Genomics, 16, 173-179. MEDLINE Abstract

25. Bray-Ward, P., Menninger, J., Lieman, J., Desai, T., Mokady, N., Banks, A. and Ward, D.C. (1996) Integration of the cytogenetic, genetic, and physical maps of the human genome by FISH mapping of CEPH YAC clones. Genomics, 32,1-15. MEDLINE Abstract

26. Grams, F., Huber, R., Kress, L.F., Moroder, L. and Bode, W. (1993) Activation of snake venom metalloproteases by a cysteine switch-like mechanism. FEBS Lett., 335, 76-80. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +1 203 737 2623; Fax: +1 203 737 2630; Email: tian.xu@yale.edu.

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 8 Jun 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Am. J. Respir. Crit. Care Med.Home page
H. M. Haitchi, R. M. Powell, T. J. Shaw, P. H. Howarth, S. J. Wilson, D. I. Wilson, S. T. Holgate, and D. E. Davies
ADAM33 Expression in Asthmatic Airways and Human Embryonic Lungs
Am. J. Respir. Crit. Care Med., May 1, 2005; 171(9): 958 - 965.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
T. Kodama, E. Ikeda, A. Okada, T. Ohtsuka, M. Shimoda, T. Shiomi, K. Yoshida, M. Nakada, E. Ohuchi, and Y. Okada
ADAM12 Is Selectively Overexpressed in Human Glioblastomas and Is Associated with Glioblastoma Cell Proliferation and Shedding of Heparin-Binding Epidermal Growth Factor
Am. J. Pathol., November 1, 2004; 165(5): 1743 - 1753.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
R. M. Powell, J. Wicks, J. W. Holloway, S. T. Holgate, and D. E. Davies
The Splicing and Fate of ADAM33 Transcripts in Primary Human Airways Fibroblasts
Am. J. Respir. Cell Mol. Biol., July 1, 2004; 31(1): 13 - 21.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
N. V. Popova, K. A. Teti, K. Q. Wu, and R. J. Morris
Identification of two keratinocyte stem cell regulatory loci implicated in skin carcinogenesis
Carcinogenesis, March 1, 2003; 24(3): 417 - 425.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
D. F. Seals and S. A. Courtneidge
The ADAMs family of metalloproteases: multidomain proteins with multiple functions
Genes & Dev., January 1, 2003; 17(1): 7 - 30.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Cao, Q. Kang, Z. Zhao, and A. Zolkiewska
Intracellular Processing of Metalloprotease Disintegrin ADAM12
J. Biol. Chem., July 12, 2002; 277(29): 26403 - 26411.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
M. Hattori, M. Osterfield, and J. G. Flanagan
Regulated Cleavage of a Contact-Mediated Axon Repellent
Science, August 25, 2000; 289(5483): 1360 - 1365.
[Abstract] [Full Text]

Home page
 EndocrinologyHome page
L. Liu and J. W. Smith
Identification of ADAM 31: A Protein Expressed in Leydig Cells and Specialized Epithelia
Endocrinology, June 1, 2000; 141(6): 2033 - 2042.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
S. Cal, J. M.P. Freije, J. M. López, Y. Takada, and C. López-Otín
ADAM 23/MDC3, a Human Disintegrin That Promotes Cell Adhesion via Interaction with the alpha vbeta 3 Integrin through an RGD-independent Mechanism
Mol. Biol. Cell, April 1, 2000; 11(4): 1457 - 1469.
[Abstract] [Full Text]

Home page
 ScienceHome page
N. Sestan, S. Artavanis-Tsakonas, and P. Rakic
Contact-Dependent Inhibition of Cortical Neurite Growth Mediated by Notch Signaling
Science, October 22, 1999; 286(5440): 741 - 746.
[Abstract] [Full Text]

Home page
 J. Cell Sci.Home page
J Schlondorff and C. Blobel
Metalloprotease-disintegrins: modular proteins capable of promoting cell-cell interactions and triggering signals by protein-ectodomain shedding
J. Cell Sci., January 11, 1999; 112(21): 3603 - 3617.
[Abstract] [PDF]

Home page
 J. Biol. Chem.Home page
S. Cal, J. M. Arguelles, P. L. Fernandez, and C. Lopez-Otin
Identification, Characterization, and Intracellular Processing of ADAM-TS12, a Novel Human Disintegrin with a Complex Structural Organization Involving Multiple Thrombospondin-1 Repeats
J. Biol. Chem., May 18, 2001; 276(21): 17932 - 17940.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (40)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yavari, R.
Right arrow Articles by Xu, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yavari, R.
Right arrow Articles by Xu, T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?