Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (28)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yuan, Z. R.
Right arrow Articles by Yamada, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yuan, Z. R.
Right arrow Articles by Yamada, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1363-1369  

Mutational analysis of the Jagged 1 gene in Alagille syndrome families
Introduction
Results
   Frameshift mutations
   Nonsense mutation
   Splice site mutation
   Large deletion
Discussion
Materials And Methods
   Patients and families with AGS
   SSCP analysis
   DNA sequencing
   Mutation analysis
   Southern blotting and densitometric analysis
Acknowledgements
Abbreviations
References

Mutational analysis of the Jagged 1 gene in Alagille syndrome families

Mutational analysis of the Jagged 1 gene in Alagille syndrome families

Zeng-Rong Yuan1, Takao Kohsaka1,2,*, Takeshi Ikegaya2, Teruaki Suzuki2, Sachiko Okano2, Jun Abe1, Noboru Kobayashi2 and Masao Yamada1

1National Children's Medical Research Center, 3-35-31 Taishido, Setagaya-ku, Tokyo 154, Japan and 2National Children's Hospital, Tokyo, Japan

Received February 2, 1998; Revised and Accepted June 8, 1998

Alagille syndrome (AGS) is an autosomal dominant disease characterized by five major abnormalities in the liver, heart, face, vertebrae and eye. The responsible gene has been recently identified as the human Jagged 1 (JAG1) gene, which encodes a ligand for the Notch receptor. We analyzed the JAG1 gene in eight AGS families, including affected and unaffected individuals, at the genomic DNA level, mainly by single-strand conformational polymorphism (SSCP) and DNA sequencing analysis. Four categories of mutations were identified: (i) four frameshift mutations in exons 9, 22, 24 and 26 were exhibited respectively in affected individuals of four AGS families, which resulted in moving the translational frame of JAG1; (ii) one nonsense mutation, a 1 bp substitution in exon 5 of the EGF-like repeat domain, was detected in two unrelated AGS families, which altered codon 235 from arginine to stop; (iii) one acceptor splice site mutation of exon 5 was revealed in a sporadic patient; and (iv) a 1.3 Mb deletion, which included the entire JAG1 gene, was found in another patient. Our results further demonstrate that AGS is a dominant disease and suggest that the JAG1 gene exerts a fundamental role in regulating genes involved in development.

INTRODUCTION

Alagille syndrome (AGS; MIM 118450), first described in 1975, occurs in 1/70 000-100 000 live births and is one of the important causes of intrahepatic cholestasis in infancy. Affected individuals are usually characterized by paucity of interlobular bile ducts, characteristic facies, peripheral pulmonary artery stenosis, butterfly-like vertebral anomalies and posterior embryotoxon (1,2). The clinical phenotype of AGS patients shows highly variable expressivity, from asymptomatic to severe cases who require liver transplantation.

Genetic studies have demonstrated that AGS is an autosomal dominant disease with 94% penetrance and 15% sporadic occurrence (3). Based on karyotype observations in multiple AGS patients with deletions or translocations, the AGS gene was first mapped to the short arm of chromosome 20, as only monosomy is associated with the phenotypic abnormalities (4-10). However, the fact that most patients have normal karyotypes suggested that mutations in a single gene may be the primary cause of this disorder (11-14).

Combined with molecular studies of deletions in chromosome 20p from AGS patients, the AGS locus was mapped to the region between D20S5 and D20S42. A 3.7 Mb YAC clone contig was constructed and five CpG islands were discovered in this candidate region for the AGS gene (15). The other results of molecular analysis in two AGS patients with a balanced translocation or submicroscopic deletion also demonstrated a 1.3 Mb critical region within a YAC clone contig (10,13). Recently, this critical region has been further narrowed to 250 kb by one group studying the AGS gene. They focused on a CpG island and finally identified a human homolog of rat Jagged 1 (JAG1) which encodes a ligand for the Notch1 receptor (16,17). Another research group took a different approach. They isolated the human JAG1 gene first and mapped it to chromosome 20p12, to which AGS is linked, then hypothesized that JAG1 may be the gene responsible for AGS based on the known function of Notch genes. Several mutations in human JAG1 have been confirmed in AGS families, indicating that it is a critical gene for AGS (17,18).

We analyzed the JAG1 gene in eight AGS families, mainly by single-strand conformational polymorphism (SSCP) and DNA sequencing, at the genomic level and identified seven mutations of the JAG1 gene that were present in affected individuals of our AGS families. The majority of these mutations have not been reported before. This result further demonstrates that the human JAG1 gene is the gene responsible for AGS.

RESULTS

Twenty-six exons of the JAG1 gene were analyzed at the genomic level in eight AGS families. The mutation analysis and identification were mainly performed by SSCP and DNA sequencing in all family members, except for one case with a visible deletion (U3) by Southern blotting and densitometric analysis. Of the eight AGS families in this study, six abnormal JAG1 genes were obviously inherited from affected parents and the other two mutations appeared to be sporadic. Seven mutations, divided into four categories, are summarized in Table 1 and briefly described below.

Table 1. Mutations of the JAG1 gene in our AGS study
Mutation type and AGS family Genetic type Position in JAG1 Nucleotide location(bp)a Changea Result Affcted domain of JAG1 Effectb Verificationc
Frameshift
S5 Familial Exon 9 1665 A insertion Glu415->Stop EGF-like repeats Truncated protein SSCP and DNA sequencing
N3 Familial Exon 22 3067 T insertion Asp878->Stop CR region Truncated protein SSCP and DNA sequencing
O4 Familial Exon 26 3683 CT deletion Ser1107->Stop TM region Truncated protein SSCP and DNA sequencing
Y3 Familial Exon 24 3495 TA insertion Ile1036->Stop TM region Truncated protein SSCP and DNA sequencing
Nonsense
D3 Familial Exon 5 1162 C->T Arg235->Stop EGF-like repeats Truncated protein SSCP and DNA sequencing
E3 Sporadic Exon 5 1162 C->T Arg235->Stop EGF-like repeats Truncated protein SSCP and DNA sequencing
Splice site
A4 Sporadic Exon 5 1154-2 A->G Aberrant splicing DSL region Exon skipping SSCP and DNA sequencing
Large deletion
U3 Familial? All JAG1 1.3 Mb Deletion   All domains Haploprotein Southern blotting and densitometric analysis
aBased on the published sequence of JAG1 cDNA (17).
bThe effects of mutation on the JAG1 protein are assumed and have not yet been proven.
cSSCP and DNA sequencing were performed on both affected and unaffected family members.

Frameshift mutations

In family S5 the father and two children had the same aberrant band in exon 9 by SSCP analysis. Genomic DNA sequencing showed a single A insertion at position 1665, which led to a translational frameshift and produced a truncated protein with an altered region of 12 amino acids and a premature stop codon in the EGF-like repeat domain of JAG1 (Fig. 1a). The phenotypes of the affected members in this family were different from each other, although the mutation was obviously transmitted from the father to the two children. The father was a sub-clinical case with mild [gamma]-glutamyltransferase elevation, heart murmur and an atypical face, but had no abnormal complaints before his children were diagnosed with AGS. The children, however, were typical AGS cases with chronic cholestasis, peripheral pulmonary arterial stenosis, posterior embryotoxon of the eye and Alagille facies.a

Figure 1. Mutational analysis of the human JAG1 gene in seven AGS families. We analyzed the JAG1 gene of all members of seven AGS families and unrelated individuals, marked o, as a control, by SSCP and DNA sequencing and revealed only six different mutations here because of the same nonsense mutation in two AGS families. [squ], mutant base in sequencing analysis. The number order for all individuals is the same in each panel.    a
   d
   b
   e
   c
   f

Another 1 bp insertion (T) mutation was detected in family N3. The mutation was identified at position 3067 of exon 22, changing codon 878 from an asparagine to a stop in the cysteine-rich (CR) domain. The abnormal JAG1 transcript was deleted of most of the CR domain and the transmembrane (TM) domain. In this family, the affected father was an asymptomatic AGS case with an atypical face only, but the proband apparently suffered from AGS disease with severe hepatogenic cholestasis and other abnormalities (Fig. 1b).

Two fraternal twin boys in family O4 were diagnosed as AGS patients. Although both of them suffered from five major abnormalities and growth retardation, the clinical features were different from each other. In particular, one proband was severely compromised with cholestasis, while the other was affected by extreme tetralogy of Fallot syndrome and died at the age of three as a consequence of heart failure. The father was a sub-clinical AGS case and the mother had normal status. After analysis of the JAG1 gene, a novel mutation in exon 26 was confirmed in the three affected members only. A 2 bp (CT) deletion at position 3683 changed the following translational codons, with 33 different amino acids and a stop codon after the CR domain (Fig. 1c).

Mutation analysis of the JAG1 gene in family Y3 demonstrated a 2 bp (TA) insertion at position 3495 in exon 24, changing codon 1036 from isoleucine to stop. The JAG1 transcript lost the TM domain. This mutation existed in both the affected mother and proband, indicating a familial inheritance mode. The father was normal status and did not have the same mutation of the JAG1 gene as judged by SSCP and DNA sequencing analysis (Fig. 1d).

Nonsense mutation

The same nonsense mutation was detected in two unrelated AGS families (D3 and E3). In family D3, the father and proband revealed the same mutation, but the mother was normal. However, in family E3, only the proband had the same mutation as that in family D3, while the father and mother did not show any abnormalities (data not shown). The mutation was located in exon 5 and was characterized as a 1 nt change (C->T) at position 1162 of JAG1 (Fig. 1e). As this substitution altered an arginine codon to a stop codon, the JAG1 transcript was very short, containing only a complete DSL domain and five amino acids of the EGF-like repeat region.

Splice site mutation

A novel band was found by SSCP and demonstrated as a splice site mutation at the acceptor splice site of exon 5 by genomic DNA sequencing. This mutation was only present in an AGS girl of family A4. The parents and elder brother were normal and did not show the same abnormality in mutation analysis. The substitution AG->GG at position 1154-2 of exon 5 changed the conservative constitution at the intron-exon junction, causing loss of a restriction enzyme site (Fig. 1f). Based on mutation studies involving the splice site (19,20), exon skipping could be predicted.

Large deletion

The proband of family U3 was a typical AGS patient and his karyotype showed a visible deletion of 20p11.23-12.1. We screened a YAC library with 12 allele markers and two STS markers and constructed a YAC contig in the deletion region based on linkage analysis (21-27). Genotype analysis of this AGS case indicated a one allele region from D20S175 to D20S58 which was significantly different from that in other AGS patients and normal individuals. It indicated that part of this region may not be homozygous but hemizygous. Haplotype inheritance analysis in two other AGS families with two affected children (S5 and O4) revealed a common region from D20S188 to D20S61 for the AGS gene, which was located in the one allele region. We thus hypothesized that the overlapping region is a real candidate region for the AGS gene, which was mapped to two entire overlapping YAC clones (791E9 and 742F5). Many probes were produced by subcloning EcoRI fragments from the two YAC clones, and were arranged in each marker segment of the candidate region by dot blotting with another six overlapping YAC clones in this region. We then checked the break-point of the deletion in this patient by Southern blotting and densitometric analysis and finally identified a 1.3 Mb deletion region from D20S507 to D20S61 containing the JAG1 gene (Fig. 2). This large deletion in the proband may be inherited from his affected father, who had an atypical face and mild abnormal liver function, however, the father refused to undergo further examination. This patient suffered from severe cholestasis and a subacute failure of liver function and had been accepted for liver transplantation. His severe phenotype may, at the very least, be associated with the loss of other related segments, besides the JAG1 gene, within this large deleted region.


Figure 2. Southern blotting and densitometric analysis for detecting a large deletion in an AGS patient. (a) The same amount (3 µg) of DNA from an AGS patient with the deletion (P) and the control (N) were digested with EcoRI, HindIII, PstI and XbaI and run in a 0.7% agarose gel at 20 V overnight, then blotted into a nylon filter. A target probe and the control (C) produced from chromosome 1 were simultaneously applied in the Southern hybridization. (b) The band density of both the patient and the control was checked by densitometric analysis, which revealed that the patient has only half the copy number of the control, indicating that the probe was located in the deletion region. (c) The same filter was rehybridized with another target probe only after being stripped. (d) Densitometric analysis revealed that the patient and the control have the same copy number, indicating that this probe was located in the normal region.

DISCUSSION

Eight families with a diagnosis of AGS disease in our study were analyzed for mutations in the JAG1 gene at the genomic DNA level. Seven mutations, belonging to four categories, were identified mainly by SSCP and DNA sequencing. All of the mutations, except a large deletion in one AGS patient, were newly detected. They were located in five exons and apparently affected the EGF-like repeat and CR and TM domains. To date, combining our data with other mutations of the JAG1 gene in two published papers (17,18), a total of 19 mutations has been identified. The majority are frameshift mutations (11/19), followed by splice site mutations (4/19), nonsense mutations (2/19) and a large deletion (2/19). The point mutations occurred in 10 exons (4-6, 11-13, 22-24 and 26) associated with the EGF-like repeat and CR region and, possibly, the Delta/Serrate/Lag-2 (DSL) region. Mutations located in the TM region have not yet been discovered. In our study, two fraternal twin children in family O4 had inherited the same mutation from the father and undergone the same intra-uterine conditions of development but had different phenotypes. The only hypothesis is that the pathogenesis of AGS involves the regulation of other genes, besides JAG1, or that expression of the mutant JAG1 gene was affected by different maternal genes. However, if this condition occurred in identical twins, environment factors might be important in modifying expression of the JAG1 gene. There were three mutations in exon 5, two of which are identical and existed in two unrelated AGS families with different inheritance patterns, familial in family D3 and sporadic in family E3. Since exon 5 is a small exon with only 61 bp, this phenomenon might suggest a mutation hotspot for the JAG1 gene in this region. A final conclusion can be made only after analysis of many mutations of the JAG1 gene in cases of AGS. It could also be that these two apparently unrelated families share a common ancestor.

The human JAG1 gene has a very important function in development. Expression analysis of JAG1 by northern blotting indicated that it is extensively expressed in various tissues of the adult and in some tissues of the fetus. It is already known that the JAG1 gene encodes a ligand for the Notch receptor which is vertically inserted in the cell membrane and is divided into two parts, extracellular and intracellular. Both regions contain conserved domains. This molecular structure suggests that Notch signaling may be directly transmitted from the cell surface to the nucleus and control cell fate during development, especially in precursor cell progress to a more differentiated state (28,29). Pathogenesis caused by targeted disruption of the Notch family has already been demonstrated in some disorders of humans and animals (30-32). Although it has been confirmed that AGS is caused by mutations of the JAG1 gene, we do not know why these mutations only affect specific organs in AGS patients, since JAG1 protein is widely presented in many tissues. It is obvious that the different mutation patterns of the JAG1 gene are not related to the phenotype of AGS patients, because variable manifestations in affected members of an AGS family result from the same mutation. As the ligand encoded by the JAG1 gene has been considered to have a fundamental effect in transmission of Notch signaling, we think that this is probably due to redundancy of multiple Notch ligands, such as Jagged 2, which shows an overlapping expression pattern with JAG1 in some tissues. Thus, cooperation with other Notch gene family members in specific tissues and different stages of embryonic development may result in different pathological disorders.

At present, we do not know the exact correlation between mutations of the JAG1 gene and AGS phenotype. The different mutation patterns and translational isoproteins are apparently not associated with clinical features in AGS patients in the present study. In view of the loss of one JAG1 allele in AGS patients with a visible deletion, haplo-insufficiency of JAG1 is considered to be one important cause of AGS. This probable cause of AGS has also been supported by the observation that a patient with a point mutation in the JAG1 gene lacks expression of the mutant allele (17). However, most patients with point mutations could generate both normal and abnormal JAG1 protein. If the aberrant JAG1 has no biological function it may act in a dominant negative manner, so that the result is similar to haplo-insufficiency. The third possibility is dosage-dependent efficiency of the JAG1 protein, as the aberrant proteins of variable size have different degrees of biological function, as animal studies have revealed that Notch is very sensitive to gene dosage. On the basis of studies on co-expression of Jagged and Notch (28,29), we conclude that although the mutations in the JAG1 gene are responsible for AGS, its expression pattern might suggest that JAG1 exerts a fundamental role in gene regulation, probably associated with the Notch family.

MATERIALS AND METHODS

Patients and families with AGS

Our study covered seven unrelated two generation families and one three generation family that included a total of 28 individuals. All 10 probands met the criteria of typical AGS (1). Affected parents, except an asymptomatic father in family N3, were sub-clinical AGS cases; the AGS diagnosis was made only after the probands had been diagnosed as AGS and then traced back to their parents (Table 2). A liver biopsy was performed for all patients to confirm the diagnosis. The pathological characteristics, as in previous reports, revealed significant intrahepatic biliary hypoplasia in which the ratio of bile ducts per portal triad was <0.5 (0.9-1.8 in normal individuals). Other abnormalities were biliary epithelial vacuolization, irregularity and mild inflammatory infiltration in the portal areas and intrahepatic cholestasis, giant cell transformation and even fibrosis in some cases of longer duration (33-36). Karyotype analysis of metaphase lymphocytoblasts revealed a visible deletion involving 20p11.23-p12.1 in the proband of family U3.

SSCP analysis

Genomic DNA was isolated from leukocytes or established cell lines of affected and unaffected members in each AGS family and unrelated individuals as a control by the standard method of phenol and chloroform extraction. A total of 31 primer pairs was used to amplify the complete coding region of the JAG1 gene; 59 primer sequences followed a published report (17) while three oligonucleotide primers for exons 1 and 2 were selected by us (Table 3) according to the published sequence of JAG1. PCR reactions were carried out by a radioactive procedure using [[alpha]-32P]dATP (Amersham, UK) with reaction parameters as follows: 1 min at 94°C denaturation, 1 min at 60°C annealing and 2 min at 72°C extension, with a final 10 min extension, for a total of 30 cycles. Exons 1 and 2 of the JAG1 gene were amplified under different conditions, as shown in Table 3. After denaturation, the PCR products were loaded into the slots of a 5% SSCP gel containing 5% glycerol. The running conditions were 250 and 1000 V, respectively, with 1× TBE buffer at room temperature. The results were analyzed by Fujix Bastation v.1.2 in an Image Analyzer (FuJiPhoto Film, Japan).

DNA sequencing

After a novel SSCP band was identified, a PCR reaction was performed under the same conditions as for SSCP analysis. The DNA products were purified by low melting point agarose electrophoresis and the GELase method, following the protocol of Epicentre Technologies. These purified DNAs were used for direct DNA sequencing with the same primers as in the SSCP analysis, labeled with [[gamma]-32P]dATP by T4 polynucleotide kinase, and/or SmaI-digested pUC18-cloned DNA sequencing with primer M4 internally labeled with [[alpha]-32P]dATP by Thermo Sequenase. DNA sequencing was carried out with a Thermo Sequenase Cycle Sequencing Kit (Amersham Life Science, Arlington Heights, IL) according to the manufacturer's protocol with some modification for the ASTEC automatic PCR programer (ASTEC, Japan). Sequence analysis was carried out under the same conditions as for the SSCP study.

Table 2. Clinical features of the affected members in AGS families
Members of AGS families Clinical type Major abnormalities Minor abnormalities Severityd
Livera Heartb Facec Eye Skeleton Kidney Growth Mental
S5
Father Sub-clinical + + ± - - - - - +
Girl 1 Typical + + + + - - - - ++
Girl 2 Typical + + + + - - - - ++
N3
Father Asymptomatic - - ± - - - - - -
Girl Typical +++ + + + + - - - +++
O4
Father Sub-clinical + + ± - - - - - +
Boy 1 Typical ++ ++++ + + + - + - ++++
Boy 2 Typical ++++ + + + + - + - ++++
Y3
Mother Sub-clinical + + ± + - - - - +
Girl Typical +++ + + + - - + - +++
D3
Father Sub-clinical + + ± - - - - - +
Boy Typical + + + + - - - - +
E3
Boy Typical + + + - - - - - +
A4
Girl Typical +++ + + + - - - - +++
U3
Father Sub-clinical + - ± - - - - - +
Boy Typical ++++ + + + + + + - ++++
a+, mild abnormality of [gamma]-glutamyltransferase, glutamic-oxalacetic transaminase or glutamic-pyruvic transaminase; ++, constant abnormalities of liver function; +++, active chronic hepatitis; ++++, failure of liver function.
b+, murmur only; ++, peripheral pulmonary stenosis (PPS); +++, valvular abnormality and PPS; ++++, extreme tetralogy of Fallot or heart failure.
c+, typical Alagille face; ±, atypical Alagille face.
dMainly dependent on liver function and heart abnormality.

Table 3. Primers for amplifying exons 1 and 2 in the JAG1 gene
Exon 5[prime]-End Foward primer sequence 3[prime]-End Reverse primer sequence Size (bp) Ta (°C)a MgCl2 (mM)
1 235 AGAATAATAAAAGGAGGCCGGG 540+40 AGAGGACGGCTGGGAGGGAb 346 50 0.5
2 541-31 GCGCTGACCTACCTCCTTCCCTb 808 GAGGTTGAAGGTGTTGCCCCCG 277 60 0.5
2 556 GGTCAGTTCGAGTTGGAGAT 846+52 CCAGGCGCGGGTGTGAGb 343 55 1.0
aThe temperature for annealing in the PCR reaction.
bThe prime sequence was based on a published paper (18).

Mutation analysis

The human JAG1 cDNA and human JAG1 protein sequences were taken from DDBJ/EMBL/GenBank (accession no. AF003837) and a published paper (16). Mutation analysis of JAG1 was performed using GENETYX-Mac v.8.0 software. Novel mutations were finally identified after verification by several criteria, including: (i) that the mutation existed in every affected member in an AGS family; (ii) that the mutation produced an aberrant JAG1 protein as assumed by computer analysis; and (iii) that the mutation in sporadic cases could be checked by direct DNA sequencing and cloned DNA sequencing using different PCR products in order to avoid artificial mutations caused by the PCR reaction.

Southern blotting and densitometric analysis

The same amount (3 µg) of genomic DNA from an AGS patient with a deletion (U3) and a control were digested with EcoRI, HindIII, PstI and XbaI and run on a 0.7% agarose gel at 20 V overnight and then were blotted onto a nylon filter by a capillary method. A target probe against a critical region of the AGS gene and a control probe produced from chromosome 1 were simultaneously applied in the Southern hybridization. The band densities of both the patient and the control were checked by densitometric analysis in an Image Analyzer. When the results showed that the patient had only half the copy number of the control in the target bands, this indicated that the probe was located in the deleted region; however, if the bands of the patient and the control showed the same density, this indicated that the probe was located outside the deletion. The same filter was rehybridized with another target probe and the densitometric analysis repeated only after being stripped (Fig. 2).

ACKNOWLEDGEMENTS

This study was supported by the grant `The investigation of molecular biological mechanisms of inflammatory diseases of kidney and liver' from the Human Science Foundation and grants for Pediatric Research and for the Human Genome from the Ministry of Health and Welfare, Japan.

ABBREVIATIONS

AGS, Alagille syndrome; CR, cysteine-rich; DSL, Delta/Serrate/Lag-2; EGF, epidermal growth factor; PPS, peripheral pulmonary stenosis; SSCP, single-strand conformational polymorphism; JAG1, human Jagged 1 gene; TM, transmembrane.

REFERENCES

1. Alagille,D., Estrada,A., Hadchonel,M., Gautier,M., Odievre,A.M. and Dommergues,J.P. (1987) Syndromic paucity of interlobular bile ducts (Alagille syndrome or arteriohepatic dysplasia): review of 80 cases. J. Pediat., 110, 195-200. MEDLINE Abstract

2. Alagille,D. (1996) Alagille syndrome today. Clin. Invest. Med., 19, 325-330. MEDLINE Abstract

3. Dhorne-Pollet,S., Deleuze,J.F., Hadchouel,M. and Bonaiti-Pellie,C. (1994) Segregation analysis of Alagille syndrome. J. Med. Genet., 31, 453-457. MEDLINE Abstract

4. Anad,F., Burn,J., Matthews,D., Cross,I., Davison,B.C., Mueller,R., Sands,M, Lillington,D.M. and Eastham,E. (1990) Alagille syndrome and deletion of 20p. J. Med. Genet., 27, 729-737. MEDLINE Abstract

5. Byrne,J.L., Harrod,M.J., Friedman,J.M. and Howard-Peebles,P.N. (1986) Del(20p) with manifestations of arteriohepatic dysplasia. Am. J. Med. Genet., 24, 673-678. MEDLINE Abstract

6. Krantz,I.D., Rand,E.B., Genin,A., Hunt,P., Jones,M., Louis,A.A. and Graham,J.M. (1997) Deletion of 20p12 in Alagille syndrome: frequency and molecular characterization. Am. J. Med. Genet., 70, 80-86. MEDLINE Abstract

7. Legius,E., Fryns,J.P., Eyskens,B., Eggermont,E., Desmet,V., de-Bethune,G. and Van-den-Berghe,H. (1990) Alagille syndrome (arteriohepatic dysplasia) and del (20) (p11.2). Am. J. Med. Genet., 35, 532-535. MEDLINE Abstract

8. Schnittger,S., Hofers,C., Heidemann,P., Beermann,F. and Hansmann,I. (1989) Molecular and cytogenetic analysis of interstitial 20p deletion associated with syndromic intrahepatic ductular hypoplasia (Alagille syndrome). Hum. Genet., 83, 239-244. MEDLINE Abstract

9. Zhang,F.R., Deleuze,J.F., Aurias,A., Dutrillaux,A.M., Hugon,R.N., Alagille,D., Thomas,G. and Hadchouel,M. (1990) Interstitial deletion of short arm of chromosome 20 in arteriohepatic dysplasia (Alagille syndrome). J. Pediat., 116, 73-77.

10. Spinner,N.B., Rand,E.B., Fortina,P., Genin,A., Taub,R., Semeraro,A. and Piccoli,D.A. (1994) Cytologically balanced t(2;20) in a two-generation family with Alagille syndrome: cytogenetic and molecular studies. Am. J. Hum. Genet., 55, 238-243. MEDLINE Abstract

11. Deleuze,J.F., Hazan,J., Dhorne,S., Weissenbach,J. and Hadchouel,M. (1994) Mapping of microsatellite markers in the Alagille region and screening of microdeletion by genotyping 23 patients. Eur. J. Hum. Genet., 2, 185-190. MEDLINE Abstract

12. Desmaze,C., Deleuze,J.F., Dutrillaux,A.M., Thomas,G., Hadchouel,M. and Aurias,A. (1992) Screening of micro deletions of chromosome 20 in patients with Alagille syndrome. J. Med. Genet., 29, 233-235. MEDLINE Abstract

13. Rand,E.B., Spinner,N.B., Piccoli,D.A., Whitington,P.F. and Taub,R. (1995) Molecular analysis of 24 Alagille syndrome families identifies a single submicroscopic deletion and futher localizes the Alagille region within 20p12. Am. J. Hum. Genet., 57, 1068-1073. MEDLINE Abstract

14. Hol,F.A., Hamel,B.C., Geurds,M.P.A., Hansmann,I., Nabben,F.A., Daniels,O. and Mariman,E.C. (1995) Localization of Alagille syndrome to 20p11.2-p12 by linkage analysis of a three-generation family. Hum. Genet., 95, 687-690. MEDLINE Abstract

15. Pollet,N., Deorne-Pollet,S., Deleuze,J., Boccaccio,C., Driancourt,C., Raynaud,N., Le-Paslier,D., Hadchouel,M. and Meunier-Rotival,M. (1995) Construction of a 3.7-Mb physical map within human chromosome 20p12 ordering 18 markers in the Alagille syndrome locus. Genomics, 27, 467-474. MEDLINE Abstract

16. Oda,T., Elkahloun,A.G., Meltzer,P.S. and Chandrasekharappa,S.C. (1997) Identification and cloning of the human homolog (JAG1) of the rat Jagged1 gene from the Alagille syndrome critical region at 20p12. Genomics, 43, 376-379. MEDLINE Abstract

17. Oda,T., Elkahloun,A.G., Pike,B.L., Okajima,K., Krants,I.D., Genin,A., Piccoli,D.A., Meltzer,P.S., Spinner,N.B., Collins,F.S. and Chandrasekharappa,S.C. (1997) Mutations in the human Jagged1 gene are responsible for Alagille syndrome. Nature Genet., 16, 235-242. MEDLINE Abstract

18. Li,L., Krantz,I.D., Deng,Y., Genin,A., Banta,A.B., Collins,C.C., Qi,M., Trask,B.J., Kuo,W.L., Cochran,J., Costa,T., Pierpont,M.E.M., Rand,E.B., Piccoli,D.A., Hood,L. and Spinner,N.B. (1997) Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch1. Nature Genet., 16, 243-251. MEDLINE Abstract

19. Gardella,R., Belletti,L., Zoppi,N., Marini,D., Barlati,S. and Colombi,M. (1996) Identification of two splicing mutations in the collagen type VII gene (COL7A1) of a patient affected by the localisata variant of recessive dystrophic epidermolysis bullosa. Am. J. Hum. Genet., 59, 292-300. MEDLINE Abstract

20. Haire,R.N., Ohta,Y., Strong,S.J., Litman,R.T., Liu,Y., Prchal,J.T., Cooper,M.D. and Litman,G.W. (1997) Unusual patterns of exon skipping in Bruton Tyrosine Kinase are associated with mutations involving the intron 17 3[prime] splice site. Am. J. Hum. Genet., 60, 798-807. MEDLINE Abstract

21. Gyapay,G., Morissette,J., Vignal,A., Dib,C., Fizames,C., Millasseau,P., Marc,S, Bernardi,G., Lathrop,M. and Weissenbach,J. (1994) The 1993-94 Genethon human genetic linkage map. Nature Genet., 7, 246-339. MEDLINE Abstract

22. Hazan,J., Dubay,C., Pankowiak,M.P., Becuwe,N. and Weissenbach,J. (1992) A genetic linkage map of human chromosome 20 composed entirely of microsatellite markers. Genomics, 12, 183-189. MEDLINE Abstract

23. NIH/CEPH Collaborative Mapping Group (1992) A comprehensive genetic linkage map of the human genome. Science, 258, 67-86.

24. Buetow,K.H., Weber,J.L., Ludwigsen,S., Scherpbier-Heddema,T., Duyk,G.M., Sheffield,V.C., Wang,Z. and Murray,J.C. (1994) Integrated human genome-wide maps constructed using the CEPH reference panel. Nature Genet., 6, 391-393. MEDLINE Abstract

25. Smith,C.L., Keith,T., Hansmann,I., Weissenbach,J., Asimakopoulos,F.A., Bowden,D.W., Deleuze,J.F., Dutton,E.R., Fasman,K.H. and Green,T. (1994) Report of the First International Workshop on Human Chromosome 20 Mapping 1993. Cytogenet. Cell Genet., 66, 78-82. MEDLINE Abstract

26. Weissenbach,J., Gyapay,G., Dib,C., Vignal,A., Morissette,J., Millasseau,P., Vaysseix,G. and Lathrop,M. (1992) A second-generation linkage map of the human genome. Nature, 359, 794-801. MEDLINE Abstract

27. Cohen,D., Chumakov,I. and Weissenbach,J. (1993) A first-generation physical map of the human genome. Nature, 359, 380-387.

28. Artavanis-Tsakonas,S., Matsuno,K. and Fortini,M.E. (1995) Notch signaling. Science, 268, 225-232. MEDLINE Abstract

29. Lindsell,C.E., Shawber,C.J., Boulter,J. and Weinmaster,G. (1995) Jagged: a mammalian ligand that activates Notch1. Cell, 80, 909-917. MEDLINE Abstract

30. Swiatek,P.J., Lindsell,C.E., del Amo,F., Weinmaster,G. and Gridley,T. (1994) Notch1 is essential for postimplantation development in mice. Genes Dev., 8, 707-719. MEDLINE Abstract

31. Ellisen,L.W., Bird,J., West,D.C., Soreng,A.L., Reynolds,T.C., Smith,S.D. and Sklar,J. (1991) TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell, 66, 649-661. MEDLINE Abstract

32. Joutel,A., Corpechot,C., Ducros,A., Vahedi,K., Chabriat,H., Mouton,P., Alamowitch,S., Domenga,V., Cecillion,M., Marechal,E., Maciazek,J., Vayssiere,C., Cruaud,C., Cabanis,E.A., Ruchoux,M.M., Weissenbach,J., Bach,J.F., Bousser,M.G. and Tournier-Lasserve,E. (1996) Notch3 mutations in CADASIL, a hereditary adult-onset condition causing stroke and dementia. Nature, 383, 707-710. MEDLINE Abstract

33. Hadchouel,M. (1992) Paucity of interlobular bile ducts. Semin. Diagnostic Pathol., 9, 24-30.

34. Perez,B.E., Fuster,M., Fraga,M., Antunez,J., Pintos,E., Pavon,P. and Forteza,J. (1991) Alagille syndrome: a family case and its associated with hepatocellular carcinoma. Rev. Clin. Esp., 188, 459-462. MEDLINE Abstract

35. Alagille,D. (1985) Management of paucity of interlobular bile ducts. J. Hepatol., 1, 561-565. MEDLINE Abstract

36. Novotny,N.M., Zetterman,R.K., Antonson,D.L.and Vanderhoof,J.A. (1981) Variation in liver histology in Alagilles syndrome. Am. J. Gastroenterol., 75, 449-506. MEDLINE Abstract

*To whom correspondence should addressed at: National Children's Medical Research Center, 3-35-31 Taishido, Setagaya-ku, Tokyo 154, Japan. Tel: +81 3 3419 9555; Fax: +81 3 3419 9555; Email: tkohsaka@nch.go.jp

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 12 Aug 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Circ. Res.Home page
S. A. Stowell and J. Kitajewski
Hey, There's a Hole in My Heart
Circ. Res., March 30, 2007; 100(6): 764 - 765.
[Full Text] [PDF]

Home page
 Hum Mol GenetHome page
J. J.D. Morrissette, R. P. Colliton, and N. B. Spinner
Defective intracellular transport and processing of JAG1 missense mutations in Alagille syndrome
Hum. Mol. Genet., February 1, 2001; 10(4): 405 - 413.
[Abstract] [Full Text] [PDF]

Home page
 CROBMHome page
M. Mina
Regulation of Mandibular Growth and Morphogenesis
Critical Reviews in Oral Biology & Medicine, January 1, 2001; 12(4): 276 - 300.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
D. A Cabezas, R. Slaugh, F. Abidi, J F. Arena, R. E Stevenson, C. E Schwartz, and H. A Lubs
A new X linked mental retardation (XLMR) syndrome with short stature, small testes, muscle wasting, and tremor localises to Xq24-q25.
J. Med. Genet., September 1, 2000; 37(9): 663 - 668.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (28)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yuan, Z. R.
Right arrow Articles by Yamada, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yuan, Z. R.
Right arrow Articles by Yamada, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?