Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (41)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Agulnik, A. I.
Right arrow Articles by Bishop, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Agulnik, A. I.
Right arrow Articles by Bishop, C. E.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1371-1377  

Evolution of the DAZ gene family suggests that Y-linked DAZ plays little, or a limited, role in spermatogenesis but underlines a recent African origin for human populations
Introduction
Results And Discussion
   Sequence comparison of the DAZ and DAZL1 genes
   Rate of male-driven evolution
   Conservation of DAZ coding sequences
   Analysis of DAZ polymorphism in different human populations
Materials And Methods
   Amplification of primate genomic DNA by PCR
   DNA sequencing
   Analysis of MboI polymorphism
   Sequence comparison and phylogenetic analysis
Acknowledgements
References

Evolution of the DAZ gene family suggests that Y-linked DAZ plays little, or a limited, role in spermatogenesis but underlines a recent African origin for human populations

Evolution of the DAZ gene family suggests that Y-linked DAZ plays little, or a limited, role in spermatogenesis but underlines a recent African origin for human populations

Alexander I. Agulnik1,+, Andrey Zharkikh4,+, Holly Boettger-Tong1,+, Thomas Bourgeron3,§, Ken McElreavey3,§,* and Colin E. Bishop1,2,§

1Department of Obstetrics and Gynecology and 2Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA, 3INSERM U276, Immunogenetique Humaine, Institute Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France and 4Myriad Genetics, Salt Lake City, UT, USA

Received February 2, 1998; Revised and Accepted June 11, 1998

The recent transposition to the Y chromosome of the autosomal DAZL1 gene, potentially involved in germ cell development, created a unique opportunity to study the rate of Y chromosome evolution and assess the selective forces that may act upon such genes, and provided a new estimate of the male-to-female mutation rate ([alpha]m). Two different Y-located DAZ sequences were observed in all Old World monkeys, apes and humans. Different DAZ copies originate from independent amplification events in each primate lineage. A comparison of autosomal DAZL1 and Y-linked DAZ intron sequences gave a new figure for male-to-female mutation rates of [alpha]m = 4. It was found that human DAZ exons and introns are evolving at the same rate, implying neutral genetic drift and the absence of any functional selective pressures. We therefore hypothesize that Y-linked DAZ plays little, or a limited, role in human spermatogenesis. The two copies of DAZ in man appear to be due to a relatively recent duplication event (55 000-200 000 years). A worldwide survey of 67 men from five continents representing 19 distinct populations showed that most males have both DAZ variants. This implies a common origin for the Y chromosome consistent with a recent `out of Africa' origin of the human race.

INTRODUCTION

The mammalian X and Y chromosomes are thought to have evolved from a common ancestral pair, the gene content of the non-recombining part of the Y chromosome being reduced by selection to those necessary only for sex differentiation and important male-specific functions, such as germ cell development. New material can also be directly acquired by the Y chromosome by de novo translocation of autosomal genes. According to the hypothesis of Fisher (1), later developed by Rice (2) and Hurst (3), any transposed genes involved in male differentiation, and thus increasing male reproductive fitness, would be retained and selected for after translocation. An example of such an acquisition is provided by the translocation of the single copy DAZL1 gene, located on human 3p, to the Y chromosome, resulting in the Y-linked DAZ (deleted in azoospermia) gene cluster (4-8). Unlike DAZL1, which remains single copy, DAZ has undergone a complex series of duplications and rearrangements on the Y chromosome, resulting in a gene family all of which is located on distal Yq (7). Southern blot analysis has shown that DAZ is only present on the Y chromosome of Catarrhini (Old World monkeys, apes and humans), but not in the Platyrrhini (New World monkeys) or any other mammals, indicating that the autosomal copy was translocated to the Y relatively recently, sometime after divergence of Old and New World primates (8). Since the DAZ cluster is deleted in 5-15% of infertile men with azoospermia and in fewer men with oligozoospermia, this would suggest that Y-linked DAZ has quickly acquired a male-specific function ensuring its retention on the Y chromosome (4,9,10). Formal proof for a direct role in spermatogenesis is lacking, however, as no mutations or small intragenic deletions/rearrangements have been reported to date. DAZ and DAZL1 both code for a protein that has a single RNA binding motif (RBM). In addition, DAZ has a variable number of copies of a 72 nt repeat unit termed a `DAZ repeat', whereas DAZL1 has only one copy of this motif (4-8). Both genes are expressed specifically in the germline, with DAZL1 additionally being expressed in the ovary (4-8). The recently cloned boule gene represents a Drosophila homolog of the DAZ/DAZL1 genes, interestingly showing greatest sequence similarity to the autosomal DAZL1 and mouse autosomal Dazl1 genes than to Y-linked DAZ (11). In Drosophila, loss of boule function results in azoospermia, caused by an apparent block in meiotic division. This provides strong evidence that Dazla/DAZL1 are involved in germ cell development in males and possibly females (11).

RESULTS AND DISCUSSION

Sequence comparison of the DAZ and DAZL1 genes

Approximately 2 kb of DNA from the DAZ and DAZL1 genes, containing four introns and five exons from the 5[prime]-end of the gene, were isolated from different species and sequenced (shown schematically in Fig. 1). Autosomal DAZL1-containing fragments were amplified from female human, chimpanzee, olive baboon and rhesus monkey (Old World monkeys), capuchin (New World monkey) and, as an outgroup, pig and cow. Similarly, using human DAZ-specific primers we obtained male-specific DAZ sequences from chimpanzee. Two clones were sequenced and used in analysis. Primers common for the DAZ/DAZL1 sequences were used for PCR amplification of genomic DNA from baboon and rhesus monkey. In these two species, in addition to a common male/female band, a second larger male-specific fragment of 2 kb was obtained. After cloning, sequencing and comparison with female DAZL1 fragments, two male-specific clones from baboon and rhesus monkey were used in subsequent analysis. Amplification and cloning of the human male-specific DAZ fragment resulted in isolation of two DAZ types of the clones. The clones have been sequenced and a single nucleotide difference between them was found in the third intron of the DAZ gene. Alignment of the obtained sequences shows their close similarity (the alignment is not shown due to space limitations, but is available upon request). All genomic fragments have the same exon-intron organization with the proper splice sites. One baboon (DAZB1) clone and one rhesus monkey (DAZR1) DAZ clone contain an Alu repeat at the same position in the second intron, indicating their common origin (Fig. 1). A sequence comparison of the Alu element showed that it belonged to the Catarrhini-specific Alu sub-family. Another rhesus monkey DAZ clone (DAZR2) contains an Alu repeat in the third intron. The DAZL1 fragment from the pig contains a SINE element in the fourth intron. Deduced cDNAs and combined intron sequences have been used to construct evolutionary trees using the neighbor-joining method (Fig. 2A and B). As an outgroup for exon sequences we have used the corresponding part of mouse Dazla cDNA (DDBJ/EMBL/GenBank accession no. U38690). Pig and cattle DAZL1 introns were the outgroup for primate sequences.


Figure 1. (a) Schematic representation of the 5[prime]-region of DAZ/DAZL1 genes showing the position of the primers used for PCR amplification. Exons are indicated by boxes. The amplified product of ~1.8 kb includes the RBM motif (indicated by solid boxes). Exon 7 contains the first of the DAZ repeat elements. (b) Schematic representation of the various clones obtained from amplification of primate DNA. An Alu element was present at the same position in a rhesus monkey and baboon clone. A second rhesus clone had an Alu insert between exons 3 and 4. The human DAZ clones have a single T->C transition in intron 3. This substitution generates an MboI site. (c) Analysis of the MboI polymorphism in DAZ. DAZ fragments were amplified by PCR from total genomic DNA, followed by digestion with MboI. Lane M, 1 kb marker; lane 1, sample with MboI+ and MboI- copies of DAZ; lane 2, sample with MboI+ copy of DAZ; lane 3, sample with only an MboI- DAZ copy. The sizes of the amplified fragments are indicated in base pairs.


Figure 2. Phylogenetic tree of (A) exons and (B) introns of the DAZL1 and DAZ genes in primates constructed by the neighbor-joining method. Two programs were used to construct the trees: (i) NJBOOTK2 for the intron trees [using distances described by Kimura (24)]; (ii) NJBOOTLI for coding sequences [using distances defined by Li (23)]. Numbers indicate the percentage of the bootstrapping trials in which an identical node was produced. The number of bootstrap replicates was 1000.

This resulted in 254 bp used to construct an exon tree and 1016 bp used to construct an intron tree. Both trees are clear DAZ/DAZL1 branching trees: all DAZL1 sequences are clustered together and this sequence analysis showed that the different DAZ copies originate from at least three independent amplifications in several primate lineages. The divergence between DAZL1 fragments is much smaller than between DAZ fragments in both trees. The degree of divergence between sequences corresponds to evolutionary distances between species. Human and chimpanzee as well as baboon and rhesus monkey are clustered together. One DAZ baboon clone (DAZB3) is more separated from both the human/chimpanzee and rhesus/baboon clades. The intron sequence of the capuchin DAZL1 fragment is more distant from the other primates. In the exon tree the capuchin sequence lies between the DAZL1 and DAZ clusters, although the bootstrap value (91%) for this branching shows that this position is not statistically significant. As the length of the branches on the neighbor-joining tree reflects the degree of divergence, it is clear that DAZ introns and exons evolve much faster than those of DAZL1. For example, the total number of nucleotide differences between human/chimpanzee DAZL1 introns is 23 per 1343 (1.7%) (gaps are excluded); exon sequences are identical. The average numbers of nucleotide substitutions between two human DAZ clones and two chimpanzee DAZ clones are (31 + 32 + 31 + 29)/4 = 30.75 per 1355 bp (2.27%) in introns and 6.5 per 325 bp (2%) in exons.

Rate of male-driven evolution

We used these data to compare the male:female ratio of mutation rate. Restricted recombination between X and Y chromosomes may lead to a higher mutation rate for Y-linked alleles compared with X chromosomal or autosomal alleles, due to the higher number of germ cell divisions in males than in females (12). If mutations arise mainly due to mistakes during DNA replication, then the male:female ratio of mutation rate ([alpha]m) will be high. Estimates based on intron sequences of the X/Y homologous genes ZFX/ZFY and SMCX/SMCY have produced [alpha] values ranging from 4.2 to 12.3 for different introns in higher primates (13). Using the formula rY/rA = 2[alpha]/(1 + [alpha]), where rY is the rate of nucleotide substitutions in Y sequences and rA is the rate in autosomal sequences, it is possible to calculate [alpha] based on the obtained DAZ/DAZL1 intron comparisons (14). As [alpha] increases (up to infinity) the rY/rA ratio approaches 2. A comparison of human/chimpanzee DAZ and DAZL1 sequences indicated that rY is equal to 2.4 and rA is equal to 1.5, thus giving a figure of [alpha]m = 4. This estimate corresponds remarkably well to that obtained for primates using X/Y homologous genes. However, when we included baboon and rhesus sequences into the same analysis, we obtained rY/rA > 2, with [alpha] becoming negative. This result is difficult to explain within the proposed model and may be attributed to specific features of DAZ. One of these peculiarities is the multiple duplication of DAZ during evolution. Increased variability in Y chromosomal copies may be caused by an intrachromosomal exchange between multiple copies of the gene on the Y chromosome or possibly between Y chromosomal/autosomal homologs. Recently, it has been reported that X-linked genes have a significantly lower rate of synonymous substitutions than autosomal genes (15). This may be caused by differences in nucleotide substitution rate in different parts of the genome and probably different parts of the chromosomes. It has led to speculation that previous estimates for a male-biased mutation rate are inaccurate, since such an analysis is based on a comparison of X- and Y-linked sequences. The reasons for this observed lower rate of mutation on the X chromosome are presently unknown, but do not impact on the conclusions of the current study.

Conservation of DAZ coding sequences

To determine if there are selective evolutionary forces on the DAZ and DAZL1 gene families, we calculated the rate of nucleotide substitutions in each of the three codon positions of the DAZL1 and DAZ gene families as well as intron substitutions. In the mouse lineage the rate of nucleotide substitutions in the third codon position is 17 times greater than in the first or second codons (Table 1). This contrasts with the ratio of nucleotide substitution in the human DAZ lineage, where the ratio between first, second and third codon positions is only 1.3. In addition, the intron substitution rates (which are presumably not under selective pressure) gave a value of 10.1 ± 0.1 for the human DAZ lineage, which is not significantly different from the human DAZ exon substitution rates. This strongly suggests that there are no functional constraints on the evolution of DAZ coding sequences and that the observed divergence is due to neutral drift. To further explore the evolutionary selective pressures we analyzed the relative rates of amino acid substitutions in the DAZ and DAZL1 lineages. A comparison of the frequency of DAZ point mutations at non-synonymous and synonymous codon positions gives the relative frequency of mutations that alter amino acids. A ratio of non-synonymous mutations per non-synonymous site (Ka) and synonymous mutations per synonymous site (Ks) >1 implies that the sequences are responding to a directed evolutionary selection rather than to random drift. Table 2 shows the relative Ka/Ks ratios based on 198 coding positions for DAZ and DAZL1 lineages. The Ka/Ks ratios range from 0.04 to 2.5, with the latter value obtained between chimpanzee and human DAZ sequences. These data must be treated with caution as the standard error is high; however, the high Ka/Ks DAZ ratio strongly contrasts with the Ka/Ks value of 0.06 between human DAZL1 and mouse Dazl1 genes, which indicates a high degree of amino acid conservation. The rapid divergence of DAZ sequences may be caused by either a strong selective pressure or the gene not being functionally constrained. Taken together with the data obtained from the analysis of codon usage, we favor the latter explanation. This hypothesis implies that Y-linked DAZ may in fact play a minor or a limited role in spermatogenesis.

Analysis of DAZ polymorphism in different human populations

The two human DAZ clones differed in only 1 nt in the third intron. This T->C transition was confirmed as the only variant in the 1.8 kb fragment by direct sequencing of male-specific PCR products from human genomic DNA. The variant causes the presence or absence of an MboI restriction site. Digestion of amplified genomic chimpanzee and gorilla DNA samples with MboI indicated that the site was present in all copies of DAZ from both species, whereas both a cut and an uncut fragment were observed in the human sample (Fig. 1c). Therefore, the ancestral form of DAZ in human lineages is the MboI+ variant. The T->C transition causing loss of this site presumably occurred sometime in recent human evolution. Indeed, the two copies of human DAZ differ in only 1 in 1361 bp of DAZ intron sequences. Taking into account that the average difference between chimpanzee and human clones is 30.5 bp and the human/chimpanzee lineages diverged ~6 000 000 years ago, we estimate that the rate of base pair substitution is 1.9 × 10-3 nucleotide substitutions/site/106 years. Thus, the earliest divergence time for the two human DAZ copies is ~200 000 years ago. A sequence comparison of two cosmids derived from the 5[prime]-end of DAZ genes indicated that this same single T->C substitution was the only change detected within a 5 kbp fragment (4). Thus, using the same calculation of the rate of base pair substitution per 106 years for a 5 kb fragment, the duplication in fact could have occurred as early as 55 000 years ago (these dates should be approached with caution, as the statistical analysis is based on a single nucleotide change). To further explore the evolutionary relatedness of the two DAZ variants, we used the MboI polymorphism between the two DAZ genes to screen for the presence or absence of the restriction site in worldwide samples of normal male Y chromosomes (Table 3). In most populations both MboI+ and MboI- variants of DAZ were present. The exceptions were eight males who lacked the MboI+ DAZ variant (a Pygmy, a Tswana, an Australian, three Mongolians, a Finn and a Bulgarian) and four males who carried only the MboI+ DAZ variant (three Indians and a Melanesian).

Table 1. Relative substitution rates in the three codon positions of the mouse Dazl1 gene and human DAZL1 and DAZ genes
  Codon position 1 Codon position 2 Codon position 3
Mouse Dazl1/human DAZ 8.8 ± 3.0 7.4 ± 2.8 30.1 ± 5.0
Mouse Dazl1/human DAZL1 1.2 ± 1.2 1.2 ± 1.2 20.0 ± 4.3
Human DAZ/human DAZL1 7.5 ± 2.9 6.1 ± 2.6 7.5 ± 2.9
Mouse Dazl1 lineage 1.25 ± 1.2 1.23 ± 1.2 21.3 ± 4.4
Human DAZL1 lineage -0.05 ± 1.0 0.05 ± 1.0 -1.3 ± 1.5
Human DAZ lineage 7.55 ± 2.9 6.15 ± 2.7 8.8 ± 3.1
In the human DAZL1 gene the negative values are the result of statistical error for estimates of small values of substituton rates in this gene. For mouse Dazl1, human DAZ and human DAZL1, the intron substitution rates were 25.9 ± 1.4, 10.1 ± 0.1 and 2.3 ± 0.05, respectively. The substitution rates were calculated by the Kimura (24) method implemented in the MATDISK2 program (23). The human DAZ and DAZL1 genes were taken as representatives of DAZ and DAZL1 genes, with mouse Dazl1 as an outgroup in this analysis. Using other species gave similar results. From a comparison of the three selected genes we can estimate the evolutionary rate in each particular evolutionary lineage: the human DAZ lineage (from the common ancestor of DAZ and DAZL1 to the extant human DAZ gene), human DAZL1 lineage (from the same ancestor to the extant human DAZL1 gene) and mouse Dazl1 lineage, which consists of two inseparable parts: from the common ancestor of mouse Dazl1 and human DAZL1 to the extant mouse gene and from the mouse/human ancestor to the DAZ/DAZL1 ancestor.

Table 2. Non-synonymous (Ka ± SE) and synonymous (Ks ± SE) substitutions per 100 sites and their ratio (Ka/Ks) for mammalian DAZ and DAZL1 coding sequences
  Ka Ks Ka/Ks
Human DAZ/chimp DAZ 3.5 ± 1.6 1.4 ± 1.5 2.5
Baboon DAZ/rhesus DAZ 0.6 ± 0.6 8.2 ± 4.6 0.07
Mouse Dazl1/human DAZL1 1.4 ± 1.0 24.9 ± 8.0 0.06
Chimp DAZL1/human DAZL1 0.6 ± 0.6 16.9 ± 6.8 0.04
Mouse Dazl1/human DAZ 7.8 ± 2.3 35.1 ± 10.3 0.22
Chimp DAZL1/human DAZ 6.9 ± 2.3 17.5 ± 6.3 0.39
Mouse Dazl1/baboon DAZB1 4.9 ± 1.8 38.1 ± 11.2 0.11
Chimp DAZL1/baboon DAZB1 4.1 ± 1.6 20.0 ± 7.3 0.21
Calculations were based on 198 coding positions using the MATDISLI program developed by Li (23).

Table 3. A worldwide survey of DAZ MboI variants
Population MboI+ DAZ variant MboI+ and MboI- DAZ variants MboI- DAZ variant
Africa (n = 11)
   Biaka pygmy (n = 2)   2  
   Kenyan (n = 1)   1  
   !Kung (n = 1)   1  
   Pygmy (n = 1)     1
   Nigerian (n = 1)   1  
   Berber (n = 1)   1  
   Tswana (n = 1)     1
   S. Sotho (n = 1)   1  
   Herero (n = 1)   1  
   Pedi (n = 1)     1
America (n = 2)
   Brazilian (n = 1)   1  
   Peruvian (n = 1)   1  
Asia (n = 27)
   Malay (n = 1)   1  
   Sri Lankan (n = 1)   1  
   Indian (n = 14) 3 11  
   Chinese (n = 4)   4  
   Cambodian (n = 1)   1  
   Mongolian (n = 6)   2 4
Europe (n = 25)
   German (n = 8)   8  
   English (n = 14)   14  
   Bulgerian (n = 1)     1
   Finn (n = 1)     1
   Ukranian (n = 1)   1  
Oceania (n = 2)
   Melanesian (n = 1) 1    
   Australian (n = 1)     1

The fact that most human populations carry both the ancestral and the MboI- DAZ variant suggests a recent common origin for the Y chromosome. As described above, this origin may be between 55 000 and 200 000 years before present, a figure consistent with recent studies of Y chromosome haplotype variation, which indicates a mean time for a common Y ancestor at 188 000 years before present (16). Such data have been interpreted to support a recent `out of Africa' hypothesis for the origin of modern man, rather than multi-regional evolution (17,18). The out of Africa model proposes that an African population gave rise to a founder population that carried genetic diversity to Asia and Europe. In this study, the four individuals who carried only the ancestral MboI+ DAZ variant may be interpreted as representing either a more recent evolutionary deletion event (or independent deletion events) or they may reflect multiple waves of migration out of Africa.

Recent data suggest that Finnish, Siberian and Mongolian populations share a common Y chromosome lineage (19,20). Our data indicate that some populations with a central Asian origin have only the MboI- DAZ variant and lack the ancestral MboI+ variant. There are several interpretations of these observations. The MboI- DAZ variant Y chromosome may represent either: (i) an independent deletion event that removed the ancestral MboI+ DAZ copy; (ii) multiple waves of migration out of Africa of an MboI- DAZ Y haplotype (this variant was also found in two sub-Saharan populations, supporting this idea); (iii) some Asian Y chromosome haplotypes have been shown to be ancestral to African forms, implying that there may at some time have been a flow of genetic markers into Africa from Asia (21). Additional analysis of other DAZ variants (22) coupled with Y-specific polymorphic markers may resolve some of these questions.

MATERIALS AND METHODS

Amplification of primate genomic DNA by PCR

DNA from male and female lymphocytes was obtained from human, chimpanzee (Pan trogloditus), rhesus monkey (Macaca mulatta), olive baboon (Papio anibus), capuchin (Cebus apella), cow (Bos taurus) and pig (Sus scrofa) using standard procedures. Primate blood samples were obtained from the University of Illinois (Chicago) and the University of Texas (Houston). Genomic fragments from female samples were amplified using primers designed based on the human DAZL1 cDNA sequence. Male-specific fragments were obtained using human DAZ-specific primers. Amplification was performed using a high fidelity Expand Long Template PCR kit from Boehringer according to the manufacturer's instructions. The resulting fragments were cloned into plasmid pCR-T (InVitrogen). Plasmid DNA was prepared from individual clones and sequenced as described previously (8). Human male-specific PCR fragments have also been directly sequenced using series of primers described previously (8). Sequence discrepancies between clones have been verified by direct sequencing of the genomic PCR products.

DNA sequencing

Sequence analysis was performed using at least 200 ng purified DNA, 20 ng primer and fluorescently labeled Taq DyeDeoxy[trade]terminator reaction mix (Applied Biosystems) according to the manufacturer's instructions. DNA sequence was determined using a 373A automated DNA sequencer (Applied Biosystems).

Analysis of MboI polymorphism

Genomic DNA, extracted from peripheral blood lymphocytes, was subjected to PCR under standard conditions using the primer pairs DAZ20 (GATCTGTCATGTACATCTTAGCA) and TPX8 (CTATCTTCTGGACATCCAC). This results in an amplification product of 193 bp. Digestion with MboI was performed overnight at 37°C. Complete digestion resulted in bands of 132 and 61 bp, which were resolved by electrophoresis in a 2% agarose gel. Human DNA samples were a gift from Drs Marc Jobling and Chris Tyler-Smith. Additional DNA samples were available in the Laboratoire d'Immunogénétique Humaine, Institut Pasteur.

Sequence comparison and phylogenetic analysis

Evolutionary distances between coding and non-coding parts of genes were calculated by the Li (23) and Kimura (24) methods, respectively. These methods were implemented in the programs MATDISLI and MATDISK2, respectively. The latter method is based on a two-parameter model describing the dependency of the rates of transversional and transitional nucleotide substitutions on the distance between nucleotide sequences. The estimation of these rates is done by counting the transitional and transversional differences between sequences and converting them into distances. The phylogenetic trees were inferred from the evolutionary distances using the neighbor-joining method (25), which is implemented in two programs, NJBOOTLI and NJBOOTK2. The bootstrap values showing the significance of each branch in the tree were calculated by the CP-bootstrap method (26). All programs were developed at the University of Texas by A.Zharkikh and are available from the author on request. DDBJ/EMBL/GenBank accession numbers for the DAZ/DAZL1 clones are as follows: chimpanzee DAZL1 (AF053606), olive baboon DAZ1 (AF053607), rhesus monkey DAZL1 (AF053608), capuchin DAZL1 (AF053608), olive baboon DAZ clone 1 (AF072320), olive baboon DAZ clone 3 (AF072321), rhesus monkey DAZ clone 1 (AF072322), rhesus monkey DAZ clone 2 (AF072323), chimpanzee DAZ clone 1 (AF072324), chimpanzee DAZ clone 4 (AF072325).

ACKNOWLEDGEMENTS

The authors thank Ms Maria T. Ty and Nicole Souleyreau for excellent technical support. We thank Drs A. Fazleabas, T. Blasdel, T. Ott, M. Jobling and C. Tyler-Smith for providing us with samples of primate and human DNA. C.E.B. and K.McE. are recipients of NATO travel fellowships.

REFERENCES

1. Fisher, R.A. (1931) The evolution of dominance. Biol. Rev., 6, 345-368.

2. Rice, W.R. (1987) Genetic hitchhiking and the evolution of reduced genetic activity of the Y sex chromosome. Genetics, 116, 161-167. MEDLINE Abstract

3. Hurst, L.D. (1994) Embryonic growth and the evolution of the mammalian Y chromosome. I. The Y as an attractor for selfish growth factors. Heredity, 73, 233-243. MEDLINE Abstract

4. Reijo, R., Lee, T.Y., Salo, P., Alagappan, R., Brown, L.G., Rosenberg, M., Rozen, S., Jaffe, T., Straus, D., Hovatta, O. et al). (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nature Genet., 10, 383-393. MEDLINE Abstract

5. Reijo, R., Seligman, J., Dinulos, M.B., Jaffe, T., Brown, L.G., Disteche, C.M., and Page, D.C. (1996) Mouse autosomal homolog of DAZ, a candidate male sterility gene in humans, is expressed in male germ cells before and after puberty. Genomics, 35, 346-352. MEDLINE Abstract

6. Cooke, H.J., Lee, M., Kerr, S. and Ruggiu, M. (1996) A murine homologue of the human DAZ gene is autosomal and expressed only in male and female gonads. Hum. Mol. Genet., 5, 513-516. MEDLINE Abstract

7. Saxena, R., Brown, L.G., Hawkins, T., Alagappan, R.K., Skaletsky, H., Reeve, M.P., Reijo, R., Rozen, S., Dinulos, M.B., Disteche, C.M. and Page, D.C. (1996) The DAZ gene cluster on the human Y chromosome arose from an autosomal gene that was transposed, repeatly amplified and pruned. Nature Genet., 14, 292-299. MEDLINE Abstract

8. Seboun, E., Barbaux, S., Bourgeron, T., Nishi, S., Algonik, A., Egashira, M., Nikkawa, N., Bishop, C., Fellous, M., McElreavey, K. and Kasahira, M. (1997) Gene sequence, localisation and evolutionary conservation of DAZLA, a candidate male sterility gene. Genomics, 41, 227-235. MEDLINE Abstract

9. Reijo, R., Alagappan, R.K., Patrizio, P. and Page, D.C. (1996) Severe oligospermia resulting from deletions of Azoospermia Factor gene on Y chromosome. Lancet, 347, 1290-1293. MEDLINE Abstract

10. Pryor, J.L. et al). (1997) Microdeletions in the Y chromosome of infertile men. New Engl. J. Med., 336, 534-539. MEDLINE Abstract

11. Eberhart, C.G., Maines, J.Z. and Wasserman, S.A. (1996) Meiotic cell cycle requirement for a fly homologue of human Deleted in azoospermia. Nature, 381, 783-785. MEDLINE Abstract

12. Miyata, T., Hayashida, H., Kuma, K., Mitsuyasu, K. and Yasunaga, T. (1987) Male-driven molecular evolution: a model and nucleotide sequence analysis. Cold Spring Harbor Symp. Quant. Biol., 52, 863-867. MEDLINE Abstract

13. Huang, W., Chang, B.H.J., Gu, X., Hewett-Emmett, D. and Li, W. (1997) Sex differences in mutation rate in higher primates estimated from AMG intron sequences. J. Mol. Evol., 44, 463-465. MEDLINE Abstract

14. Shimmin, L.C., Chang, B.H.J. and Li, W. (1993) Male-driven evolution of DNA sequences. Nature, 362, 745-747. MEDLINE Abstract

15. McVean, G.T. and Hurst, L.D. (1997) Evidence for a selectively favourable reduction in the mutation rate of the X chromosome. Nature, 386, 388-392. MEDLINE Abstract

16. Hammer, M.F. (1995) A recent common ancestry for human Y chromosomes. Nature, 378, 376-378. MEDLINE Abstract

17. Minugh-Purvis, N. (1995) The modern human origins controversy: 1984-1994. Evol. Anthropol., 4, 140-147.

18. Frayer, D.W., Wolpoff, M.H., Thorne, A.G., Smith, F.H. and Pope, G.G. (1993) Theories of modern human origins: the paleontological test. Am. Anthropol., 95, 14-50.

19. Jobling, M.A. and Tyler-Smith, C. (1995) Fathers and sons: the Y chromosome and human evolution. Trends Genet., 11, 449-456. MEDLINE Abstract

20. Jobling, M.J., Samara, V., Pandya, A., Fretwell, N., Bernasconi, B., Mitchell, R.J., Gerelsaikhan, T., Dashnyam, B., Sajantila, A., Salo, P.J. et al). (1996) Recurrent mutations and deletion polymorphisms on the long arm of the human Y chromosome in normal males. Hum. Mol. Genet., 5, 1767-1775. MEDLINE Abstract

21. Hammer, M.F., Spurdle, A.B., Karafet, T., Bonner, M.R., Wood, E.T., Novelletto, A., Malaspina, P., Mitchell, R.J., Horai, S., Jenkins, T. and Zegura, S.L. (1997) The geographic distribution of human Y chromosome variation. Genetics, 145, 787-805. MEDLINE Abstract

22. Yen, P.H., Chai, N.N. and Salido, E.C. (1997) The human DAZ genes, a putative male infertility factor on the Y chromosome, are highly polymorphic in the DAZ repeat regions. Mamm. Genome, 8, 756-759. MEDLINE Abstract

23. Li, W.H. (1993) Unbiased estimation of the rates of synonymous substitutions. J. Mol. Evol., 36, 96-99. MEDLINE Abstract

24. Kimura, M.A. (1980) Simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol., 16, 111-120. MEDLINE Abstract

25. Saitou, N. and Nei, M. (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4, 406-425. MEDLINE Abstract

26. Zharkikh, A. and Li, W.-H. (1995) Estimation of confidence in phylogeny: the complete and partial bootstrap technique. Mol. Phylogenet. Evol., 4, 44-63. MEDLINE Abstract

*To whom correspondence should be addresed. Tel: +33 1 45 68 89 20; Fax: +33 1 45 68 86 39; Email: kenmce@pasteur.fr
+Group I; §Group II

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 12 Aug 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Hum ReprodHome page
W. J. Huang, Y.-W. Lin, K.-N. Hsiao, K. S. Eilber, E. C. Salido, and P. H. Yen
Restricted expression of the human DAZ protein in premeiotic germ cells
Hum. Reprod., June 1, 2008; 23(6): 1280 - 1289.
[Abstract] [Full Text] [PDF]

Home page
 Genome ResHome page
B. K. Bhowmick, Y. Satta, and N. Takahata
The origin and evolution of human ampliconic gene families and ampliconic structure
Genome Res., April 1, 2007; 17(4): 441 - 450.
[Abstract] [Full Text] [PDF]

Home page
 Mol Biol EvolHome page
D. T. Gerrard and D. A. Filatov
Positive and Negative Selection on Mammalian Y Chromosomes
Mol. Biol. Evol., June 1, 2005; 22(6): 1423 - 1432.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. Lonjou, W. Zhang, A. Collins, W. J. Tapper, E. Elahi, N. Maniatis, and N. E. Morton
Linkage disequilibrium in human populations
PNAS, May 13, 2003; 100(10): 6069 - 6074.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
E. Y. Xu, D. F. Lee, A. Klebes, P. J. Turek, T. B. Kornberg, and R. A. Reijo Pera
Human BOULE gene rescues meiotic defects in infertile flies
Hum. Mol. Genet., January 15, 2003; 12(2): 169 - 175.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
Y.-N. Teng, Y.-M. Lin, Y.-H. Lin, S.-Y. Tsao, C.-C. Hsu, S.-J. Lin, W.-C. Tsai, and P.-L. Kuo
Association of a Single-Nucleotide Polymorphism of the Deleted-in-Azoospermia-Like Gene with Susceptibility to Spermatogenic Failure
J. Clin. Endocrinol. Metab., November 1, 2002; 87(11): 5258 - 5264.
[Abstract] [Full Text] [PDF]

Home page
 Mol Biol EvolHome page
D. A. Filatov and D. Charlesworth
Substitution Rates in the X- and Y-Linked Genes of the Plants, Silene latifolia and S. dioica
Mol. Biol. Evol., June 1, 2002; 19(6): 898 - 907.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
S. Fernandes, K. Huellen, J. Goncalves, H. Dukal, J. Zeisler, E. Rajpert De Meyts, N.E. Skakkebaek, B. Habermann, W. Krause, M. Sousa, et al.
High frequency of DAZ1/DAZ2 gene deletions in patients with severe oligozoospermia
Mol. Hum. Reprod., March 1, 2002; 8(3): 286 - 298.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
Y. M. Lin, C. W. Chen, H.S. Sun, S. J. Tsai, C. C. Hsu, Y. N. Teng, J. S. N. Lin, and P. L. Kuo
Expression patterns and transcript concentrations of the autosomal DAZL gene in testes of azoospermic men
Mol. Hum. Reprod., November 1, 2001; 7(11): 1015 - 1022.
[Abstract] [Full Text] [PDF]

Home page
 Mol Biol EvolHome page
M. Anisimova, J. P. Bielawski, and Z. Yang
Accuracy and Power of the Likelihood Ratio Test in Detecting Adaptive Molecular Evolution
Mol. Biol. Evol., August 1, 2001; 18(8): 1585 - 1592.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
K. Stouffs, W. Lissens, L. Van Landuyt, H. Tournaye, A. Van Steirteghem, and I. Liebaers
Characterization of the genomic organization, localization and expression of four PRY genes (PRY1, PRY2, PRY3 and PRY4)
Mol. Hum. Reprod., July 1, 2001; 7(7): 603 - 610.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
E. Y. Xu, F. L. Moore, and R. A. R. Pera
A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in metazoans
PNAS, May 30, 2001; (2001) 131090498.
[Abstract] [Full Text] [PDF]

Home page
 Mol Biol EvolHome page
J. P. Bielawski and Z. Yang
Positive and Negative Selection in the DAZ Gene Family
Mol. Biol. Evol., April 1, 2001; 18(4): 523 - 529.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
S. Tsui, T. Dai, S. T. Warren, E. C. Salido, and P. H. Yen
Association of the Mouse Infertility Factor DAZL1 with Actively Translating Polyribosomes
Biol Reprod, June 1, 2000; 62(6): 1655 - 1660.
[Abstract] [Full Text]

Home page
 Mol Hum ReprodHome page
V. Brekhman, J. Itskovitz-Eldor, E. Yodko, M. Deutsch, and J. Seligman
The DAZL1 gene is expressed in human male and female embryonic gonads before meiosis
Mol. Hum. Reprod., May 1, 2000; 6(5): 465 - 468.
[Abstract] [Full Text] [PDF]

Home page
 Mol Biol EvolHome page
R. Erlandsson, J. F. Wilson, and S. Paabo
Sex Chromosomal Transposable Element Accumulation and Male-Driven Substitutional Evolution in Humans
Mol. Biol. Evol., May 1, 2000; 17(5): 804 - 812.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
T Karashima, A Sugimoto, and M Yamamoto
Caenorhabditis elegans homologue of the human azoospermia factor DAZ is required for oogenesis but not for spermatogenesis
Development, January 3, 2000; 127(5): 1069 - 1079.
[Abstract] [PDF]

Home page
 Hum ReprodHome page
T. Vogel, R.M. Speed, P. Teague, and H.J. Cooke
Mice with Y chromosome deletion and reduced Rbm genes on a heterozygous Dazl1 null background mimic a human azoospermic factor phenotype
Hum. Reprod., December 1, 1999; 14(12): 3023 - 3029.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
R. Slee, B. Grimes, R. M. Speed, M. Taggart, S. M. Maguire, A. Ross, N. I. McGill, P. T. K. Saunders, and H. J. Cooke
A human DAZ transgene confers partial rescue of the mouse Dazl null phenotype
PNAS, July 6, 1999; 96(14): 8040 - 8045.
[Abstract] [Full Text] [PDF]

Home page
 Hum ReprodHome page
A. Ferlin, E. Moro, A. Garolla, and C. Foresta
Human male infertility and Y chromosome deletions: role of the AZF-candidate genes DAZ, RBM and DFFRY
Hum. Reprod., July 1, 1999; 14(7): 1710 - 1716.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
E. Y. Xu, F. L. Moore, and R. A. R. Pera
From the Cover: A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in metazoans
PNAS, June 19, 2001; 98(13): 7414 - 7419.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (41)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Agulnik, A. I.
Right arrow Articles by Bishop, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Agulnik, A. I.
Right arrow Articles by Bishop, C. E.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?