Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (38)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cooper, G.
Right arrow Articles by Amos, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cooper, G.
Right arrow Articles by Amos, W.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1425-1429  

Ascertainment bias cannot entirely account for human microsatellites being longer than their chimpanzee homologues
Introduction
Results
Discussion
Materials And Methods
   Amplification of microsatellite loci
   DNA samples
Acknowledgements
References

Ascertainment bias cannot entirely account for human microsatellites being longer than their chimpanzee homologues

Ascertainment bias cannot entirely account for human microsatellites being longer than their chimpanzee homologues

Gillian Cooper*, David C. Rubinsztein1 and William Amos

University of Cambridge, Department of Zoology, Downing Street, Cambridge CB2 3EJ, UK and 1Department of Medical Genetics, Box 158, Addenbrooke's NHS Trust, Hills Road, Cambridge CB2 2QQ, UK

Received April 29, 1998; Revised and Accepted June 3, 1998

A large majority of human microsatellite markers are longer than their homologues in chimpanzees, suggesting that more expansion mutations have occurred in the lineage leading to humans. However, such a length difference has also been explained as arising from the selection of unusually long microsatellites as genetic markers. In order to resolve this controversy and to establish the true source of the observed length differences, we have now conducted the necessary reciprocal study. We have compared the lengths of size-selected markers cloned from chimpanzees between this species and humans. We find that of 19 markers which were informative and polymorphic in both species, 13 are longer in humans. This result is incompatible with ascertainment bias being the sole explanation for the inter-specific length differences. We estimate that dinucleotide repeat microsatellites are an average of 3.2 repeat units longer in humans than in chimpanzees, implying a mutational bias in favour of microsatellite expansions and a higher average genome-wide microsatellite mutation rate in the human lineage.

INTRODUCTION

Microsatellites are arguably the most important class of genetic markers yet discovered. Although it is widely accepted that most mutations involve a length change of just one repeat unit (1,2), other aspects of microsatellite evolution remain unclear and the subject of controversy. For example, there is growing evidence from direct detection of germline mutations in pedigrees as well as from population studies that mutations resulting in the addition of a repeat unit are more common than those resulting in the loss of a repeat unit (1-7). However, this pattern has yet to be reconciled satisfactorily with the general rarity of long microsatellites.

We previously examined 40 human microsatellite markers and their homologues in a panel of non-human primates, and showed that human loci tend to be longer (5), a trend which is apparent in several other studies (3,8-13). Taken at face value, these data indicate that, since their most recent common ancestor, more microsatellite expansion mutations have occurred in the lineage leading to humans compared with the lineage leading to chimpanzees. We suggested that this provided evidence that microsatellites tend to expand with time and are doing so more rapidly in humans (14). However, an alternative explanation is that the length differences are due to ascertainment bias arising from the selection of longer than average human loci as markers (15). Here we present the necessary reciprocal experiment showing that human microsatellites tend to be longer than their chimpanzee homologues, regardless of the species from which the loci were cloned. Our data comprise 38 chimpanzee-derived CA-repeat microsatellites (Table 1 and ref. 16) which were amplified in a panel of six chimpanzees and six humans.

RESULTS

Of the 38 chimpanzee-derived microsatellites, nine loci were excluded because they did not amplify products of the expected size consistently, and one because it amplified products from the chimpanzees but not from humans. Length comparisons for the remaining 28 informative loci are presented in Table 2. Fourteen loci were longer in humans than in chimpanzees, eight were longer in chimpanzees and the remaining six showed no significant difference (P > 0.05 by Mann-Whitney two-sample rank test). This ratio of 14:8 does not differ significantly from the ratio of 33:7 longer in humans for human markers (P = 0.18, Fisher's exact test) (5), but does differ very significantly from the converse ratio of 7:33 (P = 0.0007) which would be expected from a reciprocal ascertainment bias. It is important to note that the chimpanzee-derived loci used in this current study have a similar mean repeat length compared with the human microsatellites used previously (5) (P = 0.13, two-tailed t-test). We therefore reject the null hypothesis that the greater length of human microsatellites can be explained by ascertainment bias alone.

Table 1. Chimpanzee microsatellite loci characterized in this study
Primers Primer sequence (5[prime]->3[prime]) Repeat sequence
21.01F CCATTGCTATCTACTTCCCTGA (GT)12
21.01R2 CCTGACAAATACAGGTCCCA  
21.04F GCAGGAGAATCGCTTGAATC (CA)12
21.04R2 TGCATCACTAGGTAAAACAGGTG  
21.11F GCAACACAGCAAGACTCCAT (CA)21
21.11R2 CAGTAGAGGGTCTCAAACTCTTCA  
21.12F AAAACACCATGGCACGTGTA (TG)17
21.12R TGATTTTGTATCCTAAAACCTTACTG  
21.14F TCCTGATGTCAATTTCCTAAACAA (AC)16
21.14R CATTTTATACCAGGGACTTGGG  
21.22F AAAGATGGGGTGATGTGATAGG (GT)12
21.22R CAGGGCTCATCTCACTTGGT  
21.24F CCAAAATGTACTTCTATGGCCTG (GT)13
21.24R CAACCAGCCCTCCAGTTAAA  
21.26F2 GGGATGGTCTTGGCAATTTA (TG)12
21.26R CCCCACCAGAAACACCAAAT  
22.05F TCTGCCACTTAAAGATGGGG (GT)16
22.05R TCAGGAATTTTAAGAGAAGGAACA  
22.14F TTGAAAGAATCATTGTAAATACCACC (GT)14
22.14R GGTCTCGCACTTCTGACCTC  
22.37F2 TTAAAATGGCGTGTGCTCAA (AT)12T(TG)14
22.37R2 CACAAACCAAGGTAGTGGCA  
22.39F ACATGGCACAAGGGATTGTT (TG) 16
22.39R CCTCCCATGTGGCTAATGTT  
22.40F TCTTTTGGATTCTAAATCTGATGAAA (AC)21
22.40R2 TTGGTTTTCTCTCCCACCTG  
22.52F CTGTGGTCCCTTGAAGTCCT (AC)6ATG(CA)6TGT(AC)6GT(AC)3
22.52R2 TGCTCTTCCCAATCTTAGAATGTA  
22.57F GACCTACCATTGCCTTTGGA (GT)12
22.57R2 CATGTTGCAGGGAAACTGAA  
22.59F2 CAAAACAGAGGTGGGAGGAA (GT)14
22.59R GGGTCATGATGCTATCTCAGC  
22.62F2 TATTTTGGCTTCATCTGGCA (GT)22
22.62R ACTTTGTTTTGGGGCAAGTG  
22.67F2 AGGGGAGACAGTGGGTAGGT (TG)23
22.67R CAAACCTAGCCTGCCTGTTG  
24.30F AGCTTGTTAACCAGAATTAGG (GT)15
24.30R GCGGATAACAATTTCACACA  
26.06F CATGGCCCTGATAAGAGGAA (TG)21
26.06R AATGACTTTGGAGCATTGCC  
26.10F AGGGTGAGGCAGGAGAATTT (CA)20
26.10R TGTGGAACGAGTTCAGCATT  
26.17F GGTGTCTCTGCTTTCCTTGC (AC)22
26.17R CCAAAAGCATCACGTTACCA  
26.21F ACTGGTGCCAGGCTACATTT (GT)18
26.21R TGACCTCTGGTTAGTTGCCA  
26.22F CCCAAGTGTACTTTTCCACCTT (GA)13(GT)28
26.22R GAGGAGAGGTTAAATAGAGACATAGAA  
26.27F CACCCCTGCATCTTTCAAGT (AC)23
26.27R GTTGGCAGAATTCCCACATT  

Table 2. Chimpanzee-human size comparisons for chimpanzee microsatellites
Locus Human Chimpanzee Probability Conclusion
Median length Size range (bp) No. of alleles Median length Size range (bp) No. of alleles
21.01 180 170-188 7 176 170-184 7 0.20 NS
21.12 219 181-257 8 181 171-187 6 0.0002 hu > ch
21.14 168.5 160-184 7 172 154-180 6 >0.9 NS
21.22 260.5 256-265 7 256 254-258 3 0.0023 hu > ch
21.24 287 279-299 7 260 249-271 10 <0.0001 hu > ch
21.26 183 180-188 5 180 172-188 7 0.11 NS
22.05 147 145-151 3 135 131-141 5 <0.0001 hu > ch
22.14 288 282-296 7 276 260-280 6 <0.0001 hu > ch
22.37 182 178-184 4 197 192-200 5 <0.0001 ch > hu
22.39 192 184-198 6 190 186-194 5 0.029 hu > ch
22.40 177 173-181 4 173 159-177 6 0.0048 hu > ch
22.52 267 243-271 6 254 249-257 4 0.033 hu > ch
22.57 178 176-180 3 182 170-196 8 0.095 NS
22.59 174 168-174 3 189 174-200 7 0.0001 ch > hu
22.62 148 146-150 3 165 156-168 5 <0.0001 ch > hu
22.67 158 148-162 7 160 150-170 8 0.24 NS
26.06 163 163-175 5 155 149-165 8 0.0004 hu > ch
26.10 212 203-226 8 213 206-220 6 0.84 NS
26.17 191 190-198 4 181 180-186 4 <0.0001 hu > ch
26.21 216 212-226 7 210 198-222 6 0.0066 hu > ch
26.22 121 118-122 3 150 138-180 8 <0.0001 ch > hu
pTGT81 224 220-226 4 218 212-222 5 0.0009 hu > ch
pTGT211 106 100-108 5 116.5 110-120 5 <0.0001 ch > hu
pTGT241 110 107-117 5 114 109-121 6 0.018 ch > hu
pTGT221 90 87-93 4 87 87-89 2 0.0002 hu > ch
21.04 177 177 1 171 171-177 3 hu mono hu > ch
pTGT153 124 124 1 143 137-165 5 hu mono ch > hu
pTGT271 80 80 1 87 85-91 4 hu mono ch > hu
Locus names as given in Table 1 or ref. 16. Comparisons are made between six chimpanzees and six humans (three East Anglians and three South Africans). Probabilities result from two-tailed Mann-Whitney rank tests.
ch > hu, chimpanzee median allele size greater than human median allele size; hu > ch, human median greater than chimpanzee median; hu mono, no variation in allele size in humans, therefore statistical test not possible; NS, no significant difference between medians.

Since ascertainment bias alone cannot account for the observed pattern of length differences, we must consider the possibility that some of the effect is due to different rates of microsatellite expansion in the two lineages. This possibility raises a further complicating source of observer bias. Most markers are selected to be polymorphic in the species from which they were cloned. However, a proportion of homologues in other species are monomorphic. On average, monomorphic loci have lower mutation rates than equivalent polymorphic loci. Consequently, biased mutation favouring expansion will cause most monomorphic loci to be shorter than their polymorphic homologues. In practice, failure to exclude monomorphic loci will accentuate the ascertainment bias.

The size of the effect associated with monomorphism is shown clearly by a study in which 448 polymorphic microsatellites cloned from cattle were tested on sheep (17). Whereas most polymorphic sheep loci are significantly longer than their bovine homologues (198/308 longer in sheep, or 64%), this trend is reversed among monomorphic sheep loci, where a large majority are shorter (109/131 shorter in sheep, 83%). Given this dramatic difference, we repeated our analyses after excluding three further loci which were polymorphic in chimpanzees but monomorphic in humans. As expected, all P-values become a little more extreme. Thus, the amended ratio of 13:6 does not differ significantly from the ratio of 31:6 longer in humans (polymorphic in both species) for human markers (P = 0.325, Fisher's exact test) (5), but does differ very significantly from the converse ratio of 6:31 (P = 0.0003) which would be expected from a reciprocal ascertainment bias. In addition, the trend is maintained if we conservatively restrict our analyses to dinucleotide repeat loci only: 13:6 does not differ from 19:3 (P = 0.315) but it does differ from the converse ratio of 3:19 (P = 0.0009).

For loci which are polymorphic in both species, the difference between the reciprocal comparisons can be used to estimate the size of the ascertainment bias affecting human-chimpanzee comparisons. For dinucleotide repeat loci cloned and characterized in humans (n = 22), human loci were an average of 5.18 repeat units longer than in chimpanzees, while dinucleotide repeats cloned from chimpanzees (n = 25) were on average 1.23 repeat units longer in humans. Assuming that the ascertainment bias is identical in both directions, its magnitude can be calculated as half of the difference between these means, which is 1.97 repeat units. By subtraction of this estimate of ascertainment bias from the result of 5.18 repeat units, we find that a difference of 3.21 repeat units remains which cannot be attributed to the ascertainment bias. Similarly, if all repeat types are included in this analysis, we obtain an estimate of 1.74 repeat units for the ascertainment bias and 2.44 repeat units for the inter-species difference. It should be noted that the confidence limits on these estimates of ascertainment bias are rather large (standard error of the mean is 0.91 for dinucleotide repeats and 0.73 for all loci), and larger data sets would allow the calculation of more accurate values.

DISCUSSION

By means of a reciprocal comparison, we have been able to calculate the size of the artefactual length difference between human and chimpanzee microsatellites which can be ascribed to the initial selection for long microsatellites as human markers. Over and beyond this, there remains a significant trend for human dinucleotide repeats to be on average 3.21 repeat units longer than their chimpanzee homologues. To explain this, we are left with the alternative two-part hypothesis. First, that there is mutational bias favouring expansion, confirming population genetic and direct mutation data. Second, these results argue that the mutation rate of microsatellites in the human lineage is greater than that in the chimpanzee lineage.

Reciprocal tests of microsatellite lengths have also been conducted on sheep and cows, but two studies reach contrasting conclusions. The larger study (17), based on almost 500 markers, finds that of 20 ovine microsatellites which are polymorphic in both species, 16 are longer in sheep than in cattle. Conversely, among 308 microsatellites of bovine origin, 198 are longer in sheep than cattle (significantly different from 1:1, [chi]2 = 25.14, 1 df, P < 0.0001). This clear finding that sheep microsatellites tend to be significantly longer than those of cattle regardless of the species of origin of the marker supports our conclusion that ascertainment bias does not provide a complete explanation for length differences between species. The other study is much smaller, based on only 13 bovine-derived microsatellites and 14 ovine-derived microsatellites (18), and concludes that a strong ascertainment bias does operate. However, this study fails to exclude loci which are monomorphic in one or other species. Of their original 27 loci, only 14 loci (seven derived from each species) are polymorphic in both species, too few to detect a significant deviation from 1:1.

By quantifying the extent of the ascertainment bias and showing it to account for only about one-third of the observed length difference we originally reported, we have provided further support for the model in which human microsatellites are expanding more rapidly than their homologues in chimpanzees. The apparently greater mutation rate in humans could result from a number of phenomena. (i) Human polymerases and/or repair systems may be simply more error-prone than those in related species. (ii) The frequency of microsatellite mutations seems to be correlated with the number of cell divisions involved in genesis of the germline, as suggested by the higher frequency with which microsatellite mutations are derived from paternal rather than maternal genetic contribution, and increasing rates of mutation in sperm with age (1,2). Since there is a longer period between sexual maturity and reproduction in humans compared with chimpanzees, this phenomenon could lead to inter-specific differences in mutation rates. (iii) Microsatellite allele length may be constrained by some type of length ceiling, which is lower in chimpanzees than in humans (8,10,19). (iv) Microsatellite mutations may involve interchromosomal events (20,21) with mutations occurring preferentially in heterozygotes with a large length difference between the alleles (2). Such heterozygote instability would increase the mutation rate in larger or expanded populations such as humans.

At present, we cannot exclude any of these possible explanations and, indeed, more than one may contribute to the observed pattern. The demonstration that sheep microsatellites are longer than cow microsatellites (17) could be called on to support suggestions (i), (iii) or (iv) [but probably not (ii)]. We currently favour (iv) as an explanation which could be generalized to many species without invoking idiosyncrasies in polymerases or length boundaries in each species. Further reciprocal studies of microsatellites in abundant species and their non-abundant congeners would provide valuable tests of this hypothesis, and help both to quantify and to understand the precise nature of the ascertainment bias.

Our results show that human microsatellites are on average longer than their chimpanzee homologues. This provides further support for the empirical finding of a bias towards mutations which increase the length of microsatellites, and suggests further that mutation-driven expansion is progressing faster in humans than in chimpanzees. Although the exact mechanism for this cannot be determined at present, it would be interesting to see whether this major deviation from the molecular clock for microsatellite evolution reflects a nuclear genome-wide phenomenon for other types of mutation.

MATERIALS AND METHODS

Amplification of microsatellite loci

(CA)n microsatellite loci were identified from a library of 500-750 bp fragments of AluI-digested chimpanzee DNA by standard methods (22). Pairs of primers were designed from the sequences of 24 clones using the criterion of an uninterrupted TG/CA repeat of at least 12 repeat units (maximum cloned was 23 repeat units, mean size 17.3 repeat units). In addition, primers were designed to amplify one interrupted repeat of total 23 repeat units with four interruptions of two or three bases each (locus 22.52). Primer sequences for previously unpublished loci are given in Table 1. PCR reactions were labelled by incorporation of [[alpha]-32P]dCTP, and PCR products were compared with a known sequence ladder on 6% denaturing acrylamide gels.

DNA samples

Chimpanzee DNA samples were from unrelated Pan troglodytes troglodytes individuals at the International Centre for Medical Research, Gabon. Human DNA samples were collected from East Anglians and black South Africans. All DNA samples were from peripheral blood lymphocytes.

ACKNOWLEDGEMENTS

We thank E. Jean Wickings of CIRMF, Gabon, for providing chimpanzee DNA samples, and T. Jenkins, M. Kotze and R. Ramesar for human DNA samples from Africa. This work was supported by the Leverhulme Trust (Grant F/752/A). D.C.R. is a Glaxo Wellcome Research Fellow.

REFERENCES

1. Weber, J.L. and Wong, C. (1993) Mutation of human short tandem repeats. Hum. Mol. Genet., 2, 1123-1128. MEDLINE Abstract

2. Amos, W., Sawcer, S.J., Feakes, R.W. and Rubinsztein, D.C. (1996) Microsatellites show mutational bias and heterozygote instability. Nature Genet., 13, 390-391.

3. Rubinsztein, D.C., Amos, B., Leggo, J., Goodburn, S., Ramesar, R.S., Old, J., McMahon, R., Barton, D.E. and Ferguson-Smith, M.A. (1994) Mutational bias provides a model for the evolution of Huntington's disease and predicts a general increase in disease prevalence. Nature Genet., 7, 525-530.

4. Ashley, C.T. and Warren, S.T. (1995) Trinucleotide repeat expansion and human disease. Annu. Rev. Genet., 29, 703-728. MEDLINE Abstract

5. Rubinsztein, D.C., Amos, B., Leggo, J., Goodburn, S., Jain, S., Li, S., Margolis, R.L., Ross, C.A. and Ferguson-Smith, M.A. (1995) Microsatellite evolution-evidence for directionality and variation in rate between species. Nature Genet., 10, 337-343.

6. Crawford, A.M. and Cuthbertson, R.P. (1996) Mutations in sheep microsatellites. Genome Res., 6, 876-879. MEDLINE Abstract

7. Primmer, C.R., Ellegren, H., Saino, N. and Møller, A.P. (1996) Directional evolution in germline microsatellite mutations. Nature Genet., 13, 391-393.

8. Bowcock, A.M., Ruiz-Linares, A., Tomfohorde, J., Minch, E., Kidd, J.R. and Cavalli-Sforza, L.L. (1994) High resolution of human evolutionary trees with polymorphic microsatellites. Nature, 368, 455-457. MEDLINE Abstract

9. Deka, R., Shriver, M.D., Yu, L.M., Jin, L., Aston, C.E., Chakraborty, R. and Ferrell, R.E. (1994) Conservation of human chromosome 13 polymorphic microsatellite (CA)n repeats in chimpanzees. Genomics, 22, 226-230. MEDLINE Abstract

10. Garza, J.C., Slatkin, M. and Freimer, N.B. (1995) Microsatellite allele frequencies in humans and chimpanzees with implications for constraints on allele size. Mol. Biol. Evol., 12, 594-603. MEDLINE Abstract

11. Meyer, E., Wiegand, P., Rand, S.P., Kuhlmann, D., Brack, M. and Brinkmann, B. (1995) Microsatellite polymorphisms reveal phylogenetic relationships in primates. J. Mol. Evol., 41, 10-14. MEDLINE Abstract

12. Djian, P., Hancock, J.M. and Chana, H.S. (1996) Codon repeats in genes associated with human diseases: fewer repeats in the genes of nonhuman primates and nucleotide substitutions concentrated at the sites of reiteration. Proc. Natl Acad. Sci. USA, 93, 417-421.

13. Messier, W., Li, S. and Stewart, C. (1996) The birth of microsatellites. Nature, 381, 483. MEDLINE Abstract

14. Rubinsztein, D.C., Leggo, J. and Amos, W. (1995) Microsatellites evolve more rapidly in humans than in chimpanzees. Genomics, 30, 610-612. MEDLINE Abstract

15. Ellegren, H., Primmer, C.R. and Sheldon, B.C. (1995) Microsatellite `evolution': directionality or bias? Nature Genet., 11, 360-362.

16. Takenaka, O., Takasaki, H., Kawamoto, S., Arakawa, M. and Takenaka, A. (1993) Polymorphic microsatellite DNA amplification customized for chimpanzee paternity testing. Primates, 34, 27-35.

17. Crawford, A.M., Kappes, S.M., Paterson, K.A., deGotari, M.J., Dodds, K.G., Freking, B., Stone, R.T. and Beattie, C.W. (1998) Microsatellite evolution: testing the ascertainment bias hypothesis. J. Mol. Evol., 46, 256-260. MEDLINE Abstract

18. Ellegren, H., Moore, S, Robinson, N., Byrne, K., Ward, W. and Sheldon, B.C. (1997) Microsatellite evolution-a reciprocal study of repeat length at homologous loci in cattle and sheep. Mol. Biol. Evol., 14, 854-860. MEDLINE Abstract

19. Goldstein, D.B. and Pollock, D.D. (1997) Launching microsatellites: a review of mutation processes and methods of phylogenetic inference. J. Hered., 88, 335-342. MEDLINE Abstract

20. Igarashi, S., Takiyama, Y., Cancel, G., Rogaeva, E., Sasaki, H., Wakisaka, A., Zhou, Y., Takano, H., Endo, K., Sanpei, K., Oyake, M., Tanaka, H., Stevanin, G., Abbas, N., Durr, A., Rogaev, E., Sherrington, R., Tsuda, T., Ikeda, M., Cassa, E., Nishizawa, M., Benomar, A., Julien, J., Weissenbach, J., Wang, G., Agid, Y., Stgeorgehyslop, P., Brice, A. and Tsuji, S. (1996) Intergenerational instability of the CAG repeat of the gene for Machado-Joseph disease (MJD1) is affected by the genotype of the normal chromosome-implications for the molecular mechanisms of the instability of the CAG repeat. Hum. Mol. Genet., 5, 923-932. MEDLINE Abstract

21. Takiyama, Y., Sakoe, K., Soutome, M., Namekawa, M., Ogawa, T., Nakano, I., Igarashi, S., Oyake, M., Tanaka, H., Tsuji, S. and Nishizawa, M. (1997) Single sperm analysis of the CAG repeats in the gene for Machado-Joseph disease (MJD1): evidence for non-Mendelian transmission of the MJD1 gene and for the effect of the intragenic CGG/GGG polymorphism on the intergenerational instability. Hum. Mol. Genet., 6, 1063-1068. MEDLINE Abstract

22. Rassmann, K., Schlötterer, C. and Tautz, D. (1991) Isolation of simple sequence loci for use in PCR based DNA fingerprinting. Electrophoresis, 12, 113-118. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +44 1223 336677; Fax: +44 1223 336616; Email: gc215@cus.cam.ac.uk

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 12 Aug 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Mol Biol EvolHome page
C.L. Galindo, L.J. McIver, J.F. McCormick, M.A. Skinner, Y. Xie, R.A. Gelhausen, K. Ng, N.M. Kumar, and H.R. Garner
Global Microsatellite Content Distinguishes Humans, Primates, Animals, and Plants
Mol. Biol. Evol., December 1, 2009; 26(12): 2809 - 2819.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
M. Kayser, E. J. Vowles, D. Kappei, and W. Amos
Microsatellite Length Differences Between Humans and Chimpanzees at Autosomal Loci Are Not Found at Equivalent Haploid Y Chromosomal Loci
Genetics, August 1, 2006; 173(4): 2179 - 2186.
[Abstract] [Full Text] [PDF]

Home page
 Mol Biol EvolHome page
E. J. Vowles and W. Amos
Quantifying Ascertainment Bias and Species-Specific Length Differences in Human and Chimpanzee Microsatellites Using Genome Sequences
Mol. Biol. Evol., March 1, 2006; 23(3): 598 - 607.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
R. Sainudiin, R. T. Durrett, C. F. Aquadro, and R. Nielsen
Microsatellite Mutation Models: Insights From a Comparison of Humans and Chimpanzees
Genetics, September 1, 2004; 168(1): 383 - 395.
[Abstract] [Full Text] [PDF]

Home page
 Mol Biol EvolHome page
W. Amos, C. M. Hutter, M. D. Schug, and C. F. Aquadro
Directional Evolution of Size Coupled with Ascertainment Bias for Variation in Drosophila Microsatellites
Mol. Biol. Evol., April 1, 2003; 20(4): 660 - 662.
[Abstract] [Full Text] [PDF]

Home page
 Genome ResHome page
G. Liu, N. C. S. Program, S. Zhao, J. A. Bailey, S. C. Sahinalp, C. Alkan, E. Tuzun, E. D. Green, and E. E. Eichler
Analysis of Primate Genomic Variation Reveals a Repeat-Driven Expansion of the Human Genome
Genome Res., March 1, 2003; 13(3): 358 - 368.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. C. Stone, R. C. Griffiths, S. L. Zegura, and M. F. Hammer
High levels of Y-chromosome nucleotide diversity in the genus Pan
PNAS, December 21, 2001; (2001) 12364999.
[Abstract] [Full Text] [PDF]

Home page
 Mol Biol EvolHome page
D. Bachtrog, M. Agis, M. Imhof, and C. Schlotterer
Microsatellite Variability Differs Between Dinucleotide Repeat Motifs--Evidence from Drosophila melanogaster
Mol. Biol. Evol., September 1, 2000; 17(9): 1277 - 1285.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
H. Kaessmann, V. Wiebe, and S. Pääbo
Extensive Nuclear DNA Sequence Diversity Among Chimpanzees
Science, November 5, 1999; 286(5442): 1159 - 1162.
[Abstract] [Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. C. Stone, R. C. Griffiths, S. L. Zegura, and M. F. Hammer
High levels of Y-chromosome nucleotide diversity in the genus Pan
PNAS, January 8, 2002; 99(1): 43 - 48.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (38)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cooper, G.
Right arrow Articles by Amos, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cooper, G.
Right arrow Articles by Amos, W.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?