Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sahly, I.
Right arrow Articles by Abitbol, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sahly, I.
Right arrow Articles by Abitbol, M. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1437-1447  


Prominent neuronal-specific tub gene expression in cellular targets of tubby mice mutation
Introduction
Results
   Northern blot analysis of tub gene expression during embryogenesis
   Northern blot analysis of tub gene expression in adult tissues
   tub gene expression during mouse embryogenesis
   tub gene expression in postnatal eyes
   tub gene expression in the adult pituitary and pancreas
   tub gene expression in adult mouse brain
Discussion
Materials And Methods
   Tissue preparation
   DNA probes for in situ hybridization
   In situ hybridization procedure (28)
   Northern blot hybridization
Acknowledgements
References


Prominent neuronal-specific tub gene expression in cellular targets of tubby mice mutation

Prominent neuronal-specific tub gene expression in cellular targets of tubby mice mutation

I. Sahly+, K. Gogat, A. Kobetz, D. Marchant, M. Menasche, M.-N. Castel, F. Revah, J.-L. Dufier, M. Guerre-Millo1 and M. M. Abitbol*

CERTO, Faculté Necker, 156 rue de Vaugirard, 75015 Paris, France and 1INSERM U465, 15 rue de l'Ecole de Médecine, 75006 Paris, France

Received 9 May, 1998; Revised and Accpeted 18 June, 1998

The tubby strain of mice exhibits maturity-onset obesity and sensory deficits in vision and hearing. The mutated gene, tub, responsible for this phenotype was identified recently, but the function of the TUB protein has not been deduced from its amino acid sequence. This prompted us to undertake expression mapping studies with the hope that they might help to elucidate the biological role of the TUB protein. We report the tub gene expression pattern in embryonic, fetal and adult mice tissues as determined by northern blots and in situ hybridization, using antisense oligonucleotidic probes. In mouse embryos, tub is expressed selectively in differentiating neurons of the ensemble of central and peripheral nervous systems, starting at 9.5 days after conception. In adult mice, tub is transcribed in several major brain areas, including cerebral cortex, hippocampus, several nuclei of the hypothalamus controlling feeding behavior, in the spiral ganglion of the inner ear and in the photoreceptor cells of the retina. These structures contain potential cellular targets of the tubby mutation-induced pathogenesis. The neuronal-specific tub gene distribution allows the establishment of a genotype-phenotype correlation in the tubby mice. This correlation is reminiscent of that observed in fat/fat mice, whose phenotype, also characterized by obesity, is caused by a null mutation in the carboxypeptidase E (CPE) gene. Our observations highlight similarities between CPE, prohormone convertases, several neuropeptides and tub gene expression patterns during embryogenesis, and may narrow down the avenues to explore in order to determine ultimately the function of the TUB protein.

INTRODUCTION

The tubby strain of mice exhibits an unusual phenotype which combines maturity-onset obesity and sensory deficits (1,2). Compared with the massive, early-onset obesity seen in ob/ob and db/db mice, obesity in these mice develops more slowly and is less severe (1). The sensory defects in the tubby mice appear restricted to vision and hearing. Previous observations (2,3) indicate that the tubby retina is characterized by a progressive loss of photoreceptors resulting in a reduced amplitude of the electroretinogram which is extinguished by 6 months of age. Hearing loss is due to the degeneration of the organ of Corti and loss of afferent neurons in the basal end of the cochlea. These deficits resemble those found in various human syndromes including Usher, Alström and Bardet-Biedl syndromes.

The mutated gene responsible for the tubby phenotype was identified recently. A G->T transversion abolishes a donor splice site in the 3[prime] coding region of this gene (4,5). This alteration results in a larger than normal transcript containing an unspliced intron, and the mutant mRNA is predicted to encode a truncated protein. The mouse tub gene belongs to a novel gene family, including three recently identified human genes: TUB, the homologue of the mouse tub gene, and two related genes TULP1 and TULP2. The normal tub gene encodes a hydrophilic protein that lacks any known secretory sequence, mitochondrial transit signal sequence, transmembrane domain, DNA- or RNA-binding domain. Recent data suggest that tub genes exist in a large number of species, ranging from human to yeast (6). However, the function of the protein has not been deduced from knowledge of its amino acid sequence. Consequently, we decided to undertake expression mapping studies with the hope that they might help us to understand the biological role of the TUB protein.

We report here the tub gene expression pattern in embryonic, fetal and adult mice tissues as determined by northern blots and in situ hybridization. In embryos, tub is expressed selectively throughout the central and peripheral nervous systems in differentiating neurons, starting at 9.5 days post-conception (d.p.c.). In adult mice, tub is transcribed in several major brain areas, including nuclei controlling feeding behavior, in the spiral ganglion of the inner ear and in the photoreceptor cells of the retina. These structures contain potential cellular targets of the tubby mutation-induced pathogenesis. The strongly neuronal-specific tub gene distribution allows the establishment of a genotype-phenotype correlation in the tubby mice. This correlation is reminiscent of the one observed in fat/fat mice, whose phenotype, also characterized by obesity, is caused by a null mutation in the carboxypeptidase E (CPE) gene (7). Our observations highlight similarities between the CPE, prohormone convertases, neuropeptides and tubby gene expression patterns during embryogenesis.

RESULTS

Northern blot analysis of tub gene expression during embryogenesis

To determine whether the tub gene is expressed during embryogenesis, we performed a Northern blot analysis of poly(A)+ RNA from mouse embryos at different stages of development (Fig. 1). tub mRNA is first detected at 11 d.p.c. and persists at 15 and 17 d.p.c. One single species of mRNA was recognized by each of the four probes used. The size of this transcript decreased slightly from 7.5 to 7 kb along with embryonic development. This slight decrease in size of the tub transcripts, observed as embryogenesis proceeds, may result either from the use of alternative transcription start sites or from the differential utilization of alternative polyadenylation sites. The 7 kb transcript detected at the latest stage is identical in size to the most abundant mRNA species detected in the adult mouse brain (see below and refs 4,5).


Figure 1. Northern blot analysis of mouse embryos at various stages and adult mice tissues. A 2 µg aliquot of poly(A)+ RNA was loaded in each lane. The same blots were hybridized successively with the antisense oligonucleotidic probes described in Materials and Methods. The four probes gave identical hybridization signals in embryos (shown for probe 3). The tub mRNA-specific signals obtained with the mouse tissues differ according to the probe used. The signals obtained with probes 2 (not shown) and 3 were identical.

Northern blot analysis of tub gene expression in adult tissues

The tissue distribution of the tub mRNA was examined by northern blot analysis of poly(A)+ RNA extracted from various adult organs (Fig. 1). No expression was detected in kidney, liver, lung and spleen. The oligonucleotidic probe 4, which hybridizes to the most 3[prime] part of the tub cDNA, detected an abundant 7 kb mRNA in brain. This transcript is expressed at a lower level in testis, skeletal muscle and heart. Less abundant transcripts of different sizes are observed in brain (9.8 kb), testis (3.9 kb), skeletal muscle and heart (8.8 kb). Both the 7 and the 8.8 kb transcripts are barely detectable in heart. The pattern of hybridization signals in adult tissues, unlike in the embryonic tissues, differs according to the probe used. Probe 1, which hybridizes to the most 5[prime] part of the tub cDNA, detects a 7 kb transcript in brain and skeletal muscle but not in testis. Probes 2 (data not shown) and 3 corresponding to nucleotides inside the coding sequence detect an mRNA of similar size only in brain and testis. These data suggest the possibility of tissue-specific alternative splicing of the tub pre-mRNA.

tub gene expression during mouse embryogenesis

By in situ hybridization, tub gene expression is first detected in the ventral basal plate of the neural tube at 9.5 d.p.c.

At 10.5 d.p.c., the rostral end of the primitive spinal cord exhibits strong labeling in the future ventral horns which contain the first differentiating motor neurons. The external zone of the mantle layer in the caudal part of the hindbrain also expresses the tub gene, while no labeling is detectable in the ventricular zone. A similar pattern of labeling is detected in the floor of the midbrain (mesencephalon) and in the diencephalon, but at a weaker intensity than in the hindbrain. In addition, the sympathetic ganglia which develop at this stage start to transcribe the tub gene.

At 11.5 d.p.c., labeling of differentiating neurons continues to be observed in the spinal cord and in the brain. A number of cranial nerve ganglia (V, VII-IX and X) display significant levels of tub mRNA.

At 12.5 d.p.c. (Fig. 2A and B), the major components of the forebrain are differentiating and this is particularly obvious for the hypothalamus and the thalamus. Labeling of moderate intensity is detectable in these structures. The anterior and firstly differentiated part of the developing spinal cord is clearly labeled while the posterior part is not. Landmarks of tub gene expression at this stage are the labeling of cells located just beneath the superficial layer of the olfactory epithelium and the labeling of the dorsal root ganglia sensory neurons. The anlage of the cervical sympathetic ganglia is strongly labeled. The medulla oblongata and the basal plate of the pons start to be labeled in the most differentiating regions. The ventral tegmentum nucleus, the ventral tegmental area and the substantia nigra in the mesencephalon do express the tub gene. The ganglionic eminence is faintly labeled in its most external and caudal parts, as well as the roof of the midbrain in the outer superficial part of the mantle layer. The roof of the neopallial cortex, the rhombic lip, the medial regions of the ganglionic eminence and the tectum are not labeled. Although at earlier stages no tub mRNA-positive cells can be identified in the migratory pathway of the presumptive enteric neuroblasts of the vagal neural crest nor in the myenteric ganglia of the gut, at 12.5 d.p.c., the tub gene is expressed in the post-migratory cells of the enteric nervous system (ENS) in the upper part of the gut (data not shown).


Figure 2. (A) Autoradiogram of a 12.5 d.p.c. embryonic medial parasagittal section: schg, sympathetic chain of ganglia; mo, medulla oblongata; p, pons; IIIV, third ventricle; dt, dorsal thalamus; h, hypothalamus; cfr, frontal cortex; ge, ganglionic eminence; poa, preoptic area; drg, dorsal root ganglia. (B) Bright field aspect of the same embryonic tissue section. (C) Autoradiograms of a 13.5 d.p.c. embryonic medial parasagittal section: Xg, vagal ganglia; t, thalamus; lv, lateral ventricle; mes, mesencephalon; sa, septal area; ob, olfactory bulb; mf, mesencephalic flexure; lboe, labeling located beneath the olfactory epithelium. (D) Autoradiogram of a different 13.5 d.p.c. embryonic medial parasagittal section: sg, sympathetic ganglia; spc, spinal cord; rmb, roof of the midbrain. (E) Bright field aspect of the same embryonic tissue section. (F) Autoradiogram of a 14.5 d.p.c. embryonic medial parasagittal section showing more differentiated previously described structures. For (A), (C), (D) and (F), bar corresponds to 5 mm; (B) bar corresponds to 2 mm; (E) bar corresponds to 2.5 mm.

At 13.5 d.p.c. (Fig. 2C-E), the neuronal structures already labeled at previous developmental stages exhibit stronger signals which extend over larger areas, e.g. the roof of the midbrain, the roof of the telencephalic vesicles and the striatum. The superficial nuclear layer of the telencephalic neopallial cortex starts to become labeled. The olfactory neuronal structures including the cortex, the bulb and the tubercle express significant amounts of tub mRNAs which increase at subsequent developmental stages. Furthermore, tub transcripts are detected in the adrenal chromaffin cells (Fig. 3C and D), in the inferior sympathetic ganglia (Fig. 3G and H) and in differentiating cells of the cerebellum. The neural retina displays a strong signal corresponding to tub gene transcription in its innermost layer where the first post-mitotic neurons are born. The components of the inner ear apparatus are showing increased evidence of differentiation, and the ganglionic cells of the spiral ganglion exhibit a strong hybridization signal.


Figure 3. (A) The dark field aspect of the tub cellular hybridization signal arising from the dorsal root ganglia (drg) of a 14.5 d.p.c. mouse embryo. (B) The bright field histology of the same section indicating the localization of the dorsal root ganglia between the vertebral cartilages. (C) The dark field aspect of the tub cellular hybridization signal arising from the adrenal medulla (am) of a 13.5 d.p.c. mouse embryo. The kidney is not labeled. (D) The bright field histology of the same tissue section emphasizing the anatomical situation of the adrenal medulla adjacent to the kidney (ki). (E) The dark field aspect of the tub cellular hybridization signal originating from the parasympathetic myenteric ganglia (mp) surrounding the small intestine (si) of a 15.5 d.p.c. mouse embryo. (F) The bright field aspect of the same section describing the histology of the small intestine at a low magnification. (G) The dark field aspect of the tub cellular hybridization signal arising from the inferior mesenteric sympathetic ganglia (imsg) of a 13.5 d.p.c. mouse embryo. (H) The bright field aspect of the same tissue section describing the histology of the inferior mesenteric sympathetic ganglia at a low magnification. Bar corresponds to 100 µm.

At 14.5 d.p.c. (Fig. 2F), the intensity of labeling in differentiating cerebellar cells and the size of the labeled cerebellar areas increase. The choroid plexuses begin to differentiate, but do not express the tub gene. The corpus striatum laterale is increasingly labeled, while the corpus striatum mediale is not. The epithalamus or lateral ganglionic eminence starts to display tub hybridization signals. The dorsal root ganglia are labeled more intensely than at previous developmental stages (Fig. 3A and B). Another feature of note is the first indication of stratification within the nuclear region of the neural retina, corresponding to the birth of the future bipolar and photoreceptor cells. However, only the ganglionic cells of the retina express the tub gene (Fig. 4A and B).


Figure 4. (A) The dark field aspect of the tub cellular hybridization signal arising from the differentiating ganglionic layer of a 14.5 d.p.c. mouse embryonic retina. (B) The bright field histology of the same section emphasizing the thickness of the non-labeled undifferentiated neuroblastic layer (nbl) of the retina. For (A) and (B), bar corresponds to 100 µm. (C) The dark field aspect of the tub cellular hybridization signal originating from the ganglionic cell layer (gcl) of an 18.5 d.p.c. embryonic eye. (D) The bright field aspect of the same section visualizing the anatomical situation of the neuroblastic layer between the ganglionic cell layer and the pigment epithelium (pe) which is non-pigmented in NMRI mice. For (C) and (D), bar corresponds to 100 µm. (E) The dark field aspect of the tub cellular labeling arising from adult photoreceptors (ph). (F) The bright field aspect of the same section allowing the visualization of the silver grains on the outer nuclear layer containing the nuclei of photoreceptors. No cellular labeling is detected on bipolar cells (bi). For (E) and (F), bar corresponds to 100 µm.

At 15.5 d.p.c., as previously observed since E13.5 developmental stage, ganglionic cells of the spiral ganglion are still significantly labeled (Fig. 5A and B). A major molecular landmark is the unambiguous detection of tub hybridization signals in numerous small parasympathetic ganglia embedded in the walls of the heart. The preaortic abdominal sympathetic paraganglia of Zuckerkandl and the extremely large paraaortic bodies are strongly labeled. A clear tub labeling in the media of the aortic wall is also detectable. The periventricular zone is still devoid of any labeling throughout the whole central nervous system (CNS), as well as the posterior part of the roof of the midbrain. The tub gene expression, already detected in the future myenteric ganglia of the upper part of the gut since embryonic stage E12.5, is observed in the myenteric plexus along the entire axis of the gut (Fig. 3E and F).


Figure 5. (A) The dark field aspect of the tub hybridization signals originating from the spiral ganglia (spg) on a parasagittal tissue section of a 15.5 d.p.c. embryo. Bar which corresponds to 100 µm. (B) The bright field aspect of the same section displaying the histological aspect of the spiral ganglia and of the cochlea (coh). (C) The dark field aspect of the tub hybridization signal around the nasal cavity (nc) and originating from cells located beneath the olfactory epithelium (oe). Bar corresponds to 100 µm. (D) The bright field aspect of the same section exhibiting the histology of the labeled structure at a low magnification. This low magnification combined with the bright field observation explains why the silver grains are not visible. (E) The dark field aspect of the tub hybridization signals originating from the olfactory cortex (oc). Significantly, around the labeled differentiated olfactory cortex is located the unlabeled ventricular zone comprising cortical olfactory progenitor cells. Bar corresponds to 100 µm. (F) A bright field aspect of the same section highlighting the cresyl violet-colored olfactory progenitor cells of the ventricular zone.

At 16.5 d.p.c., the whole spinal cord is strongly labeled. There is an intense labeling in the cranial nerve ganglia, the medulla oblongata, the pons and in several hypothalamic and thalamic nuclei. The deep cerebellar nuclei, the roof of the midbrain, the roof of the telencephalic vesicles including the neopallial cortex, the olfactory cortex, the olfactory bulb, the olfactory tubercle and the spinal cord ganglia exhibit strong labeling. The dorsal root ganglia, the sympathetic ganglia, the chromaffin cells of the adrenal and the parasympathetic ganglia still express tub transcripts.

At 17.5 d.p.c., tub expression is very strong in the brain and particularly in the cerebral cortex, the hippocampal formation, several hypothalamic nuclei and some thalamic nuclei, such as the lateral geniculate nuclei. tub transcription is significant in the midline thalamic nuclei, the dorsal tegmental nuclei and cranial nerve nuclei. The tub gene is still strongly expressed in all olfactory structures including the vomeronasal organs. The dorsal and ventral cochlear nuclei and the nuclei of the lateral lemniscus area are also labeled but at a lower intensity. A steady level of labeling is still detectable in sympathetic ganglia whereas a decrease in tub gene expression is observed in the dorsal root ganglia and in the myenteric ganglia. It is particularly pronounced in the lower parts of the gut. In contrast, the ectomesenchymal cells forming connective tissue, smooth muscle of the truncoconal septa and parasympathetic post-ganglionic neurons of the heart (the cardiac ganglia) are still strongly labeled (Fig. 6A-D).


Figure 6. (A) Dark field aspect of a tub-labeled parasympathetic ganglia (pg) located close to the atrial cavity (atr). Bar corresponds to 200 µm. Beneath the inferior part of the section of the atrial cavity, putative post-ganglionic parasympathetic neurons display a significant hybridization signal. (B) Bright field aspect of the same tissue section. (C) Dark field aspect of a cluster of ectomesenchymal cells participating to the structure of truncoconal septa (tcs) and exhibiting a strong tub hybridization signal. Bar corresponds to 200 µm. (D) Bright field aspect of the same tissue section. Blood cells (bc) are visible in the lumen of the vessel originating from the heart. (E) Autoradiogram of adult mouse pituitary tissue section showing the significant tub hybridization signal arising from the anterior part of this gland. Bar corresponds to 2 mm. (F) The absence of any autoradiographic signal originating from adjacent serial pituitary tissue section hybridized with the tub sense probe 4.

At 18.5 d.p.c., the tub hybridization pattern is very similar to that observed at 17.5 d.p.c., with a strong expression in the CNS including the differentiated retinal ganglionic cells (Fig. 4C and D). tub hybridization signals are also detectable just beneath the olfactory epithelium surrounding the nasal cavity (Fig. 5C and D) and in the differentiating olfactory cortex (Fig. 5E and F). The ventricular zone comprising cortical olfactory progenitor cells surrounding the labeled differentiated olfactory cortex is not labeled. Whereas tub gene transcription persists in sympathetic ganglia and parasympathetic cardiac ganglia, the labeling continues to fade in the parasympathetic ganglia of the gut as well as in the dorsal root ganglia. From 13.5 to 18.5 d.p.c., tub gene expression is not detected by in situ hybridization on tissue sections of developing testis and ovaries (data not shown). These negative results contrast with the hybridization signals detected by northern blot analysis of adult mice testis mRNAs and also reported by other teams (6).

tub gene expression in postnatal eyes

While the tub gene is expressed only in retinal ganglionic cells throughout embryogenesis, mostly the photoreceptor cells are labeled in postnatal eyes (Fig. 4E and F). In contrast, bipolar, ganglionic and horizontal cells express faint tub hybridization signals, if any. The abundant specific photoreceptor tub expression is maintained in adult retinas.

tub gene expression in the adult pituitary and pancreas

tub transcripts, as detected by in situ hybridization, dot-blot and northern blot analysis (data not shown) of adult rodent pituitaries, are significantly expressed in the intermediate and posterior lobes. The anterior lobe of the pituitary also displays specific tub hybridization signals (Fig. 6E). tub transcripts are also detected in pancreatic structures likely to be Langerhans islets (data not shown).

tub gene expression in adult mouse brain

At the autoradiographic level, several major brain structures provide specific hybridization signals. All cerebral cortices, the hippocampal formation, the dentate gyrus, several hypothalamic nuclei, the lateral and dorsal septal nuclei, the cerebellar Purkinje cell layer, the substantia nigra pars compacta and the ventral tegmental area are labeled. In contrast, the tub gene is not detected in the striatum or thalamus (data not shown).

An analysis of the tub hybridization signals at the cellular level suggests that the tub gene is not expressed in glial cells since no expression is detected in the corpus callosum and in the white matter in general. In order to be established definitely, the neuronal-specific expression of the tub gene requires double labeling experiments using both neuronal markers such as antibodies anti-neuron-specific enolase or anti-elav and glial markers such as antibodies recognizing exclusively either the glial fibrillary acidic protein (specific for astrocytes) or carbonic anhydrase type II (specific for oligodendrocytes). This study allows refinement of the identification of the neuronal subpopulations expressing tub mRNAs. All neurons of the primary olfactory cortex (Fig. 7A) and of the cingular cortex (Fig. 7B) produce tub mRNAs. The neurons of the different layers of the cerebellar cortex and principally the Purkinje cells (Fig. 7F), as well as the neurons of the inferior olivary nuclear complex, also express the tub gene. In the hippocampus, both the pyramidal and the basket cells produce tub transcripts. The granule cells of dentate gyrus express the tub gene strongly. In the subiculum, both interneurons and pyramidal cells are characterized by a high level of tub gene expression (Fig. 7C). In contrast, the tub gene is not expressed in striatal cells. Most thalamic nuclei do not express the tub gene at detectable levels, except the midline thalamic nuclei. Among the hypothalamic nuclei, the most strongly labeled are the arcuate, paraventricular and ventromedial nuclei (Fig. 7G-I). Other hypothalamic nuclei also display significant labeling: the dorso-medial hypothalamic nucleus (Fig. 7I), the median preoptic nucleus, the medial preoptic area, which mainly contains the medial preoptic nucleus (Fig. 7H), the preoptic periventricular hypothalamic nucleus, the ventral premammillary nucleus and the posterior periventricular nucleus. Neurons of several nuclei belonging to the extended amygdala do express the tub gene. Significant levels of tub transcripts are detected in the medial habenula (Fig. 7D) and the interpeduncular nucleus. The dopaminergic neurons of the ventral tegmental area and of the substantia nigra pars compacta exhibit a high level of tub mRNA transcription. The serotoninergic neurons of the dorsal raphe nucleus, of the caudal linear raphe nucleus and of the midbrain median raphe nucleus express the tub gene at high levels. The subfornical organ (Fig. 7E) and the area postrema, which are circum ventricular organs, show neuron specific tub hybridization signals.


Figure 7. Dark field aspects of (A) primary olfactory cortex (pocx), (B) cingular cortex (cgcx), (C) subiculum (sub), (D) medial habenula (mhb), (E) subfornical organ (sfo), (F) Purkinje cells of the cerebellum (pk), (G) arcuate nucleus (an), (H) medial preoptic nucleus (mpo) and (I) dorso-medial hypothalamic nucleus (dm), paraventricular nucleus (pmv) and arcuate nucleus. Bar represents 100 µm.

DISCUSSION

This study demonstrates that in each developing neural or neuro-endocrine region that displays hybridization signals, the onset of tub gene expression coincides with neuronal differentiation. Our data show that the tub gene is expressed consistently in the expanding mantle layer of the developing CNS, while tub transcripts are never detected in the neuroblastic ventricular zones. Another important observation is that tub is transcribed during both embryogenesis and adulthood in neuronal structures containing potential cellular targets of the tubby phenotype, especially in critical hypothalamic nuclei and brain structures known for their role in the control of feeding behavior, in the spiral ganglion of the inner ear and in the retina. Extending previous reports of tub expression in the paraventricular, ventromedial and arcuate nuclei of the hypothalamus (5), we show that several other hypothalamic nuclei of periventricular and medial zones, such as the median preoptic nucleus and the ventral premammillary nucleus also transcribe the tub gene. From these nuclei originate the strongest inputs to the arcuate nucleus. The median preoptic nucleus receives strong inputs from the medial nucleus of the amygdala, the principal nucleus of the bed nuclei of the stria terminalis, the lateral septal nucleus and the ventral tegmental area, where the tub gene is also expressed. This may suggest that TUB functions in a neuronal network modulating the activity of crucial hypothalamic nuclei involved in the control of energy balance. Nevertheless, the lateral hypothalamic area, which is classically considered as a `feeding center' and where orexins and MCH-expressing neurons recently have been localized (8), does not express tub mRNAs.

tub is indeed expressed in several brain regions expressing neuropeptides and known for their role in the control of feeding behavior. Body weight homeostasis is under the tight control of numerous neuropeptides (8,9). The present study supports the hypothesis of a certain degree of co-localization of pre-proopiomelanocortin (pre-POMC) (10), neuropeptide Y (NP-Y) (11), cholecystokinin (CCK) (12) and galanin (13) with tub mRNAs in the adult rodent brain. Nevertheless, although the tub gene expression pattern overlaps those reported for these neuropeptides, it differs in some neuronal structures, indicating the distinct and specific nature of tub neuronal distribution. Although at the present time there is no evidence available supporting the hypothesis of any enzymatic processing of the TUB protein, our data are not incompatible with a putative role for TUB as a new neuropeptide belonging to a novel family of molecules fulfilling special neuromodulatory functions in feeding behavior. The tubby phenotype is characterized by a late-onset, moderate obesity (1). This phenotype shares similarities with the fat/fat phenotype caused by null mutations in the mouse CPE gene (7). Along with endoproteases such as proconvertases PC1 and PC2, this exopeptidase is involved in the proteolytic cleavage of precursors of several neuropeptides (14). Secretory proteins are released from cells via a non-regulated constitutive pathway. However, in neuroendocrine cells of the nervous and endocrine systems, there is also a regulated secretory pathway, specifically dedicated to the secretion of neuropeptides. PC1, PC2 and CPE are key processing enzymes of this highly conserved pathway (15). In the fat/fat mice characterized by the absence of functional CPE, the pre-POMC is missorted to the constitutive default pathway and is secreted abnormally. Interestingly, PC1 null mutations cause autosomal recessive obesity in humans (16). Similarly to the fat/fat phenotype, a patient with compound heterozygous mutations of the PC1 gene displays multiple endocrine abnormalities. It is possible that misprocessing of neuropeptides related to ingestive behavior and energy expenditure underlies the development of obesity in this patient and in the fat/fat mice. This hypothesis is strengthened further by the recent discovery of mutations disrupting the pre-POMC gene structure and leading to obesity (17). As the obese phenotype of tubby mice resembles that observed in fat/fat mice, it is tempting to speculate that the tub-encoded protein may fulfill functions similar to CPE and/or PC1 in the regulatory secretory pathway. Overlapping distributions of proconvertases, CPE and tub mRNAs in neuroendocrine cells of the developing CNS (18) also support this hypothesis. CPE gene expression in the embryo proper is first detected at 10 d.p.c. and is restricted mainly to the mantle layer of the neuroepithelium, a pattern which is strongly reminiscent of tub gene expression. Furthermore, like the tub gene, CPE is expressed throughout the peripheral nervous system during mouse development. Additionally, both in developing and adult retina, several pre-proneuropeptides (19,20) are expressed and require specific enzymatic cleavages. Interestingly, CPE, like the tub gene, is expressed in the adult rat retina, predominantly in the photoreceptor cells (21).

The tub gene expression in the sensory structures that degenerate as part of the tubby phenotype suggests that TUB is essential for continued normal function of eye and inner ear function. Whether TUB plays a major role in the development of these structures remains to be investigated. Interestingly, recessive mutations in the human gene encoding the tubby-like protein TULP1 recently have been demonstrated to cause non-syndromic retinitis pigmentosa (22,23), indicating that other proteins in the tub family may have crucial roles in the physiology of photoreceptors.

In adult rodent brain, the CPE, PC1 and PC2 gene expression patterns (24,25), although not identical, overlap tub mRNA neuronal distribution very closely. Indeed, tub, CPE, PC1 and PC2 are strongly transcribed in many common brain areas including several hypothalamic nuclei and the pituitary. It is noteworthy that neither the PC1 mutated patient nor fat/fat and tubby mice display any obvious neurological abnormalities, although PC1, CPE and tub genes are selectively expressed in the developing and adult CNS. This suggests that minor neurological defects might be observed after closer behavioral examination. Alternatively, the proteins encoded by these genes might fulfill redundant functions in many areas of the CNS, thus avoiding the emergence of major neurological manifestations in the case of deficiency of one of them.

Like tub, CPE as well as several neuropeptide mRNAs are expressed in neuroenteric cells during mouse development (18,26). It is worth emphasizing the co-localization and the similar temporal kinetics of expression of tub, CPE and neuropeptides not only in the CNS but also at distant sites of the peripheral nervous system. The temporal and spatial features of these gene expression patterns extend to neuroendocrine tissues such as the pituitary, the adrenal glands and testes. If we assume that the TUB protein represents a new processing enzyme, its action may result in the differential production of distinct neuropeptides in these tissues. Further experiments relying on high performance liquid chromatography and mass spectrometry are obviously needed in order to try to detect putative abnormal misprocessed neuropeptides in endocrine tissues of tubby mice, including in adipose tissues.

Spatial and temporal coincidences of gene expression patterns, although not a direct proof, suggest a similarity of function for TUB as a processing enzyme, whose specificity might differ from those already determined for other pro-proteases. However, our data are also compatible with alternative hypotheses suggesting that TUB might belong to a new family of neuropeptides. Other possibilities cannot be discounted, such as those including TUB as a member of a new transcription factor family, a new RNA-binding protein family or a signaling molecule involved in biochemical pathways yet to be discovered. This study emphasizes the potential roles of tub expression in neuronal networks involved in numerous neurophysiological and endocrine functions regulating feeding behavior and sensory perception. It provides neuroanatomical and molecular basis underlying the tubby phenotype.

MATERIALS AND METHODS

Tissue preparation

Morphologically normal mouse embryos and fetuses (n = 20) ranging from 9.5 to 18.5 d.p.c. were collected from NMRI pregnant mice. Two embryos were processed for each stage. The embryos were microdissected under the microscope, frozen in dry ice and stored at -80°C. Cryostat serial sections (15 µm) were mounted on slides previously coated with 2% 3-aminopropyltriethoxysilane solution in acetone. Sections were fixed for 30 min in 2% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4), dehydrated with a graded ethanol series (50, 75 and 95%), air-dried and stored at -80°C. Six murine developing testis and six murine developing ovaries ranging from 13.5 to 18.5 d.p.c. were microdissected and processed similarly. Six brains from adult mice and nine eyes, collected from neonate mice (n = 3), from 10-day-old mice (n = 3) and from 8-week-old mice (n = 3) were submitted to the same procedure. In addition, adult pituitary tissue sections from three adult rats and three adult mice were also prepared for in situ hybridization.

DNA probes for in situ hybridization

Oligonucleotide probes (60mers) were synthesized and purified by Genset (Les Ulis, France). They were 3[prime] end-labeled with [[alpha]-35S]dATP (NEN) using terminal deoxyribonucleotidyl transferase (Gibco BRL) at a specific activity of ~7 × 108 c.p.m./mg. The probes were purified on biospin P 30 columns (Bio-Rad). Four sense and four antisense oligonucleotides were chosen according to the mouse tub cDNA sequence (GenBank accession no. U52433), using the OLIGO software with the following parameters: 55% GC content and [Delta]G > -4 kcal/mol for hairpins and self-pairing. All sequences were compared with the GenBank and EMBL nucleotide sequence databases using the FASTA and BLAST procedures, to ensure that they were specific to the tubby gene.

The sequences of the oligomers were: probe 1 sense, CAG AAG CAG AAG AAG AAG CGC CAA GAG CCC TTG ATG GTA CAG GCC AAT GCA GAT GGA CGG (position 315-374); probe 1 antisense, CCG TCC ATC TGC ATT GGC CTG TAC CAT CAA GGG CTC TTG GCG CTT CTT CTT CTG CTT CTG; probe 2 sense, AAA ACA GCT CCA GCT CCT CCC AGC TAA ACA GCA ACA CCC GCC CTA GTT CTG CCA CTA GCA (position 820-879); probe 2 antisense, TGC TAG TGG CAG AAC TAG GGC GGG TGT TGC TGT TTA GCT GGG AGG AGC TGG TGC TGT TTT; probe 3 sense, GTG GAC CCA ACA GAC TTG TCT CGG GGA GGC GAT AGC TAT ATC GGG AAA TTG CGG TCC AAC (position 1152-1211); probe 3 antisense, GTT GGA CCG CAA TTT CCC GAT ATA GCT ATC GCC TCC CCG AGA CAA GTC TGT TGG GTC CAC; probe 4 sense, GCA CGC TGG CAG AAC AAG AAC ACG GAG AGC ATC ATT GAG CTG CAG AAC AAG ACG CCA GTC (position 1440-1499); and probe 4 antisense: GAC TGG CGT CTT GTT CTG CAG CTC AAT GAT GCT CTC CGT GTT CTT GTT CTG CCA GCG TGA. The four antisense tub oligonucleotidic probes gave the same hybridization pattern on several adjacent adult brain, embryonic and fetal serial tissue sections. The sense tub oligonucleotidic probes did not detect any hybridization signal either at the autoradiographic or cellular levels.

A rodent antisense arrestin oligonucleotide was used as a negative control probe: GTCTCTCTTCCCCAGGTAGATGGTCACCGACTTGTCCCGGGAGACCTTCTTGAAGATGAC. Hybridization of mouse brain tissue sections with this probe does not produce any signal either at the autoradiographic and cellular levels (27).

In situ hybridization procedure (28)

The hybridization cocktail contained: 50% formamide, 4× SSC (standard saline citrate), 1× Denhardt's solution, 0.25 mg/ml yeast tRNA, 0.25 mg/ml sheared herring sperm DNA, 0.25 mg/ml poly(A), 10% dextran sulfate, 100 mM dithiothreitol (DTT) and [[alpha]-35S]dATP-labeled probe at a concentration of 6 × 105 c.p.m./100 µl of final hybridization solution; 100 µl of hybridization solution was put on each section. The sections were then covered with a parafilm coverslip and incubated in a humidified chamber at 43°C for 20 h. After hybridization, the slides were washed twice in 1× SSC containing 10 mM DTT for 15 min each at 55°C, twice in 0.5× SSC containing 10 mM DTT for 15 min each at 55°C, and once in 0.5× SSC containing 10 mM DTT for 15 min at room temperature. The sections were then dipped in water, dehydrated with a series of graded concentrations of ethanol and exposed to Amersham Betamax X-ray films for 4 days and then to Kodak NTB2 photographic emulsion for 2 months at 4°C.

Northern blot hybridization

Tissue-specific expression of tub was assessed by hybridization of the same four oligonucleotidic antisense probes labeled with T4 polynucleotide kinase (Life Technologies). Northern blot filters containing poly(A)+ RNAs (2 µg for each lane) from mouse embryos and fetuses (# 7763-1) and various adult tissues (# 7762-1) (Clontech, Palo Alto, CA) were used. Hybridization and washing of the filters were performed according to the following conditions: each blot was incubated overnight (20 h) in 5 ml of pre-hybridization buffer containing 50% formamide, 5× SSC, 50 mM Na2HPO4 (pH 6.5), 1× dextran solution, 250 mg/ml salmon sperm DNA and 10 mg/ml poly(A). Hybridization was performed for 20 h at 42°C in the same solution except that 50 mg/ml salmon sperm DNA and 105 c.p.m./cm2 of labeled probe were included. Each membrane was washed twice with 100 ml of 2× SSC/0.1% SDS for 30 min, once with 0.3× SSC/0.1% SDS, and once with 0.1× SSC/0.1% SDS for 30 min, at 65°C. Membranes were then subjected to autoradiography with X-OMAT X-ray film (KODAK) with an intensifying screen at -70°C.

ACKNOWLEDGEMENTS

We thank Professor Gérard Couly for helping us to ascertain the nature of several embryonic structures, Karin Trocmé and Christian Menini for excellent scientific and technical support, Professor Thaddeus Dryja for critical reading of the manuscript, Président Jean-Jacques Frayssinet for his personal involvement in our efforts, and Professor Philippe Even, Dean of Faculté NECKER, for his permanent support to our laboratory. We thank Retina France-AFRP for continuous financial support, Association Valentin Haüy pour le bien des aveugles for its generous help, Association Française contre les Myopathies (AFM) for a joint grant to Jacky Beckmann and M.M.A., Association Nationale pour l'amélioration de la vue (ASNAV) and ESSILOR for a grant to J.-L.D., INSERM for the PROGRES grant to M.G.-M. and collaborating teams, including CERTO, Assistance Publique-Hôpitaux de Paris for the grant AOM 95005 to J.-L.D., Université René Descartes-Paris V and Faculté de Médecine Necker for the grant `Legs Poix' to M.M.A., Fondation pour la Recherche Médicale for a grant to M.M.A., and Ministère de la Recherche et de l'Enseignement Supérieur (MNSER) for the fellowship allocated to I.S.

REFERENCES

1. Coleman, D.L. and Eicher, E.M. (1990) Fat (fat) and Tubby (tub): two autosomal recessive mutations causing obesity syndromes in the mouse. J. Hered., 81, 424-427. MEDLINE Abstract

2. Ohlemiller, K.K., Hughes, R.M., Mosinger-Ogilvie, J., Speck, J.D., Grosof, D.H. and Silverman, M.S. (1995) Cochlear and retinal degeneration in the tubby mouse. NeuroReport, 6, 845-849. MEDLINE Abstract

3. Heckenlively, J.R., Chang, B., Erway, L.C., Peng, C., Hawes, N.L., Hageman, G.S. and Roderick, T.H. (1995) Mouse model for Usher syndrome: linkage mapping suggests homology to Usher type 1 reported at human chromosome 11p15. Proc. Natl Acad. Sci. USA, 92, 11100-11104. MEDLINE Abstract

4. Noben-Trauch, K., Naggert, J.K., North, M.A. and Nishina, P.M. (1996) A candidate gene for the mouse mutation tubby. Nature, 380, 534-538.

5. Kleyn, P.W., Fan, W., Kovats, S.G., Lee, J.J., Pulido, J.C., Wu, Y., Berkemeier, L.R., Misumi, D.J., Holmgren, L., Charlat, O., Woolf, E.A., Tayber, O., Brody, T., Shu, P., Hawkins, F., Kennedy, B., Baldini L., Ebeling, C., Alperin, G.D., Deeds, J., Lakey, N.D., Culpepper, J., Chen, H., Glücksmann-Kuis, A.M., Carlson, G.A., Duyk, G.M. and Moore, K.J. (1996) Identification and characterisation of the mouse obesity gene tubby: a member of a novel gene familly. Cell, 85, 281-290. MEDLINE Abstract

6. North, M.A., Naggert, J.K., Yan, Y., Noben-Trauth, K. and Nishina, P.M. (1997) Molecular characterization of TUB, TULP1, and TULP2, members of the novel tubby gene family and their possible relation to ocular diseases. Proc. Natl Acad. Sci. USA, 94, 3128-3133. MEDLINE Abstract

7. Naggert, J.K., Fricker, L.D., Varlamov, O., Nishina, P.M., Rouille, Y., Steiner, D.F., Carroll, R.J., Paigen, B.J. and Leiter, E.H. (1995) Hyperproinsulinemia in obese fat/fat mice associated with a carboxypeptidase E mutation which reduces enzyme activity. Nature Genet., 10, 135-142. MEDLINE Abstract

8. Sakurai, T., Amemiya, A., Ishii, M., Matsuzaki, I., Chemelli, R.M., Tanaka, H., Williams, S.C., Richardson, J.A., Kozlowski, G.P., Wilson, S., Arch, J.R.S., Buckingham, R.E., Haynes, A.C., Carr, S.A., Annan, R.S., McNulty, D.E., Liu, W.-S., Terrett, J.A., Elshourbagy N.A., Bergsma D.J. and Yanagisawa, M. (1998) Orexins and orexin receptors: a family of hypothalamic neuropetides and G protein-coupled receptors that regulate feeding behavior. Cell, 92, 573-585. MEDLINE Abstract

9. Flier, J.S. and Maratos-Fliers, E. (1998) Obesity and the hypothalamus: novel peptides for new pathways. Cell, 92, 437-440. MEDLINE Abstract

10. Gee, C.E., Chen, C.L., Roberts, J.L., Thompson, R. and Watson, S.J. (1983) Identification of proopiomelanocortin neurones in rat hypothalamus by in situ cDNA-mRNA hybridization. Nature, 306, 374-376. MEDLINE Abstract

11. Morris, B.J. (1989) Neuronal localisation of neuropeptide Y gene expression in rat brain. J. Comp. Neurol., 290, 358-368. MEDLINE Abstract

12. Ingram, S.M., Krause, R.G., Baldino, F. Jr, Skeen, L.C. and Lewis, M.E. (1989) Neuronal localization of cholecystokinin mRNA in the rat brain by using in situ hybridization histochemistry. J. Comp. Neurol., 287, 260-272. MEDLINE Abstract

13. Melander, T., Hokfelt, T. and Rokaeus, A. (1986) Distribution of galanin-like immunoreactivity in the rat central nervous system. J. Comp. Neurol., 248, 475-517. MEDLINE Abstract

14. Halban, P.H. and Irminger, J.-C. (1994) Sorting and processing of secretory proteins. Biochem. J., 299, 1-18. MEDLINE Abstract

15. Cool, D.R., Normant, E., Shen, F.-S., Chen, H.-C., Pannell, L., Zhang, Y. and Peng Loh, Y. (1997) Carboxypeptidase E is a regulated secretory pathway sorting receptor: genetic obliteration leads to endocrine disorders in Cpefat mice. Cell, 88, 73-83. MEDLINE Abstract

16. Jackson, R.S., Creemers, J.W.M., Ohagi, S., Raffin-Sanson, M.-L., Sanders, L., Montague, C.T., Hutton, J.C. and O'Rahilly, S. (1997) Obesity and impaired prohormone processing associated with mutations in the human prohormone convertase 1 gene. Nature Genet., 16, 303-306. MEDLINE Abstract

17. Krude, H., Biebermann, H., Luck, W., Horn, R., Brabant, G. and Grüters, A. (1998) Severe early-onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans. Nature Genet., 19, 155-157 MEDLINE Abstract

18. Zheng, M., Streck, R.D., Scott, R.E., Seidah, N.G. and Pintar, J.E. (1994) The developmental expression in rat of proteases furin, PC1, PC2, and carboxypeptidase E: implications for early maturation of proteolytic processing capacity. J. Neurosci., 14, 4656-4673. MEDLINE Abstract

19. Isayama, T., McLaughlin, P.J. and Zagon, I.S. (1996) Ontogeny of preproenkephalin mRNA expression in the rat retina. Vis. Neurosci., 13, 695-704. MEDLINE Abstract

20. Shughrue, P.J., Lane, M.V. and Merchenthaler, I. (1996) In situ hybridization analysis of the distribution of neurokinin-3 mRNA in the rat central nervous system. J. Comp. Neurol., 372, 395-414. MEDLINE Abstract

21. Schlamp, C.L. and Nickells, R.W. (1996) Light and dark cause a shift in the spatial expression of a neuropeptide-processing enzyme in the rat retina. J. Neurosci., 16, 2164-2171. MEDLINE Abstract

22. Hagstrom, S.A., North, M.A., Nishina, P.M., Berson, E.L. and Dryja, T.P. (1998) Recessive mutations in the gene encoding the tubby-like protein TULP1 in patient with retinitis pigmentosa. Nature Genet., 18, 174-176. MEDLINE Abstract

23. Banergee, P., Kleyn, P.W., Knowles, J.A., Lewis, C.A., Ross, B.M., Parano, E., Kovats, S.G., Lee, J.J., Penchaszadeh, G.K., Ott, J., Jacobson, S.J. and Gilliam, T.C. (1998) TULP1 mutations in two extended Dominican kindreds with autosomal recessive retinitis pigmentosa. Nature Genet., 18, 177-179.

24. MacCumber, M.W., Snyder, S.H. and Ross, C.A. (1990) Carboxypeptidase E (enkephalin convertase) mRNA distribution in rat brain by in situ hybridization. J. Neurosci., 10, 2850-2860. MEDLINE Abstract

25. Schäfer, M.K.-H., Day, R., Cullinan, W.E., Chrétien, M., Seidah, N.G. and Waston, S.J. (1993) Gene expression of prohormone and proprotein convertases in the rat CNS: a comparative in situ hybridization analysis. J. Neurosci., 13, 1258-1279. MEDLINE Abstract

26. Tharakan, T., Kirchgessner, A.L., Baxi, L.V. and Gershon, M.D. (1995) Appearance of neuropeptides and NADPH-diaphorase during development of the enteropancreatic innervation. Dev. Brain Res., 84, 26-38.

27. Roustan, P., Abitbol, M., Menini, C., Ribeaudeau, F., Gérard, M., Vekemans, M., Mallet, J. and Dufier, J.-L. (1995) The rat phospholipase C [beta] 4 gene is expressed at high abundance in cerebellar Purkinje cells. NeuroReport, 6, 1837-1841. MEDLINE Abstract

28. Abitbol, M., Menini, C., Delezoide, A.L., Rhyner, T., Vekemans, M. and Mallet, J. (1993) Nucleus basalis magnocellularis and hippocampus are the major sites of FMR-1 expression in the human fetal brain. Nature Genet., 4, 147-153. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +33 1 40 61 56 56; Fax: +33 1 40 61 54 74; Email: abitbol@necker.fr
+Present address: Laboratoire de Génétique Moléculaire Humaine, Institut Pasteur, 25/28 rue du Docteur Roux, 75015 Paris, France


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 12 Aug 1998
Copyright©Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
IOVSHome page
G. H. Grossman, G. J. T. Pauer, U. Narendra, N. S. Peachey, and S. A. Hagstrom
Early Synaptic Defects in tulp1-/- Mice
Invest. Ophthalmol. Vis. Sci., July 1, 2009; 50(7): 3074 - 3083.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Q. Xi, G. J. T. Pauer, S. L. Ball, M. Rayborn, J. G. Hollyfield, N. S. Peachey, J. W. Crabb, and S. A. Hagstrom
Interaction between the Photoreceptor-Specific Tubby-like Protein 1 and the Neuronal-Specific GTPase Dynamin-1
Invest. Ophthalmol. Vis. Sci., June 1, 2007; 48(6): 2837 - 2844.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
S. A. Shore
Obesity and asthma: lessons from animal models
J Appl Physiol, February 1, 2007; 102(2): 516 - 528.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Q. Xi, G. J. T. Pauer, A. D. Marmorstein, J. W. Crabb, and S. A. Hagstrom
Tubby-like Protein 1 (TULP1) Interacts with F-actin in Photoreceptor Cells
Invest. Ophthalmol. Vis. Sci., December 1, 2005; 46(12): 4754 - 4761.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
D. P. Figlewicz, A. Zavosh, T. Sexton, and J. F. Neumaier
Catabolic action of insulin in rat arcuate nucleus is not enhanced by exogenous "tub" expression
Am J Physiol Endocrinol Metab, June 1, 2004; 286(6): E1004 - E1010.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Ikeda, P. M. Nishina, and J. K. Naggert
The tubby-like proteins, a family with roles in neuronal development and function
J. Cell Sci., January 1, 2002; 115(1): 9 - 14.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. L. Michaud, F. Boucher, A. Melnyk, F. Gauthier, E. Goshu, E. Levy, G. A. Mitchell, J. Himms-Hagen, and C.-M. Fan
Sim1 haploinsufficiency causes hyperphagia, obesity and reduction of the paraventricular nucleus of the hypothalamus
Hum. Mol. Genet., July 1, 2001; 10(14): 1465 - 1473.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. H. Milam, A. E. Hendrickson, M. Xiao, J. E. Smith, D. E. Possin, S. K. John, and P. M. Nishina
Localization of Tubby-like Protein 1 in Developing and Adult Human Retinas
Invest. Ophthalmol. Vis. Sci., July 1, 2000; 41(8): 2352 - 2356.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
H. Stubdal, C. A. Lynch, A. Moriarty, Q. Fang, T. Chickering, J. D. Deeds, V. Fairchild-Huntress, O. Charlat, J. H. Dunmore, P. Kleyn, et al.
Targeted Deletion of the tub Mouse Obesity Gene Reveals that tubby Is a Loss-of-Function Mutation
Mol. Cell. Biol., February 1, 2000; 20(3): 878 - 882.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
R. Kapeller, A. Moriarty, A. Strauss, H. Stubdal, K. Theriault, E. Siebert, T. Chickering, J. P. Morgenstern, L. A. Tartaglia, and J. Lillie
Tyrosine Phosphorylation of Tub and Its Association with Src Homology 2 Domain-containing Proteins Implicate Tub in Intracellular Signaling by Insulin
J. Biol. Chem., August 27, 1999; 274(35): 24980 - 24986.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
C. A. Lewis, I. R. Batlle, K. G. R. Batlle, P. Banerjee, A. V. Cideciyan, J. Huang, T. S. Aleman, Y. Huang, J. Ott, T. C. Gilliam, et al.
Tubby-like Protein 1 Homozygous Splice-Site Mutation Causes Early-Onset Severe Retinal Degeneration
Invest. Ophthalmol. Vis. Sci., August 1, 1999; 40(9): 2106 - 2114.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sahly, I.
Right arrow Articles by Abitbol, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sahly, I.
Right arrow Articles by Abitbol, M. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?