Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (80)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Doray, B.
Right arrow Articles by Lyonnet, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doray, B.
Right arrow Articles by Lyonnet, S.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1449-1452  

Mutation of the RET ligand, neurturin, supports multigenic inheritance in Hirschsprung disease
Introduction
Results And Discussion
Materials And Methods
   Patients and families
   DNA analysis
Acknowledgements
References

Mutation of the RET ligand, neurturin, supports multigenic inheritance in Hirschsprung disease

Mutation of the RET ligand, neurturin, supports multigenic inheritance in Hirschsprung disease

Bérénice Doray, Rémi Salomon, Jeanne Amiel, Anna Pelet, Renaud Touraine, Marc Billaud1, Tania Attié, Bruno Bachy2, Arnold Munnich and Stanislas Lyonnet*

Unité de Recherches sur les Handicaps Génétiques de l'Enfant, INSERM U393 and Département de Génétique, Hôpital Necker-Enfants Malades, 149 rue de Sèvres, 75743 Paris Cedex 15, France,1Laboratoire de Génétique, UMR 5641 CNRS, 69373 Lyon Cedex 08, France and 2Service de Chirurgie Pédiatrique Centre Hospitalier Universitaire de Rouen, 76000 Rouen, France

Received May 9, 1998; Revised and Accepted July 8, 1998

Hirschsprung disease (HSCR) is a frequent neurocristopathy characterized by the absence of submucosal and myenteric plexuses in a variable length of the gastrointestinal tract. Pedigrees and segregation analyses suggested the involvement of one or several dominant genes with low penetrance in HSCR. Considering that RET and glial cell line-derived neurotrophic factor (GDNF) mutations have been reported in the disease, we regarded the other RET ligand, neurturin (NTN), as an attractive candidate gene, especially as it shares large homologies with GDNF. Here, we report on the finding of a heterozygous missense NTN mutation in a large non-consanguineous family including four children affected with a severe aganglionosis phenotype extending up to the small intestine. Interestingly, it appears that the NTN mutation reported here is not sufficient to cause HSCR, and this multiplex family also segregates a RET mutation. This cascade of independent and additive genetic events fits well with the multigenic pattern of inheritance expected in HSCR, and further support the role of RET ligands in development of the enteric nervous system.

INTRODUCTION

Hirschsprung disease (HSCR, aganglionic megacolon) (1) is a common malformation (1 in 5000 live births) resulting in intestinal obstruction in neonates and in severe constipation in infants and adults (2-4). Although 80% of cases are sporadic, pedigree and segregation analyses suggested involvement of several dominant genes with low penetrance in HSCR (5). A major HSCR gene has been mapped to chromosome 10q11.2 and the disease has been ascribed to mutations of the RET proto-oncogene (6-9), which encodes a receptor tyrosine kinase. However, the lack of genotype-phenotype correlations, the low penetrance and the sex-dependent effect of RET mutations supported the existence of one or more modifier gene(s) in familial HSCR (10-12). Recently, two RET ligands have been identified, namely the glial cell line-derived neurotrophic factor (GDNF) (13-16) and neurturin (NTN) (17). Both NTN and GDNF are members of a new family of neurotrophic factors, distantly related to transforming growth factor-[beta] (TGF-[beta]). The mature NTN protein shares a 42% homology with mature GDNF. Both peptides are synthesized as pre-propeptides further processed by cleavage and secreted as mature proteins of 88 and 134 amino acids, respectively. Their sequence similarities have suggested that NTN and GDNF may act through common signalling pathways. Actually, both NTN and GDNF have been shown to activate the RET tyrosine kinase receptor via at least two co-receptors (Fig. 1; 18-20): GFR[alpha]1 responding equally to GDNF and NTN, and GFR[alpha]2, that is 10- to 30-fold more sensitive to NTN than to GDNF. For this reason, the two RET ligands and their co-receptors have been regarded as attractive candidate genes in the disease. Indeed, GDNF mutations have been reported previously both in sporadic and familial HSCR (21-23). Here, we report on a heterozygous missense mutation of the NTN gene in a multiplex HSCR family also segregating a RET missense mutation. Taken together, these results support the role of RET ligands in development of the enteric nervous system and suggest that interactions between mutated partners of the RET signalling pathway could account for multigenic inheritance of HSCR.


Figure 1. Activation of RET receptor by NTN and GDNF. Bold arrows indicate preferential activation of GFR[alpha]1 and GFR[alpha]2 co-receptors by their respective ligands.

RESULTS AND DISCUSSION

The coding sequence of the NTN gene on chromosome 19p13.3 was examined in a large series of HSCR patients using a combination of single strand conformation polymorphism (SSCP) analysis and direct DNA sequencing. We found an abnormal pattern of migration in sibs, with very severe aganglionosis extending up to the small intestine. Sequence analysis revealed a G->T transversion in exon 2 at codon 96, changing an alanine into a serine in the protein (A96S; Fig. 2B). The mutation was located at position +1 of the propeptide cleavage site and led to substitution of the first amino acid in the mature peptide (Fig. 2A). The mutation was absent in 96 normal controls (192 chromosomes, P < 0.001). .

Figure 2. (A) Nucleotidic sequence of NTN exon 2 showing the A96S mutation. (B) Conservation of human and murine sequences at the cleavage site region of pre-proNTN. The G->T transversion at the first nucleotide of codon 96 is shown (A96S).

Each of the three affected children tested was heterozygous for the NTN mutation. Further analyses revealed that the mutation was inherited from the unaffected heterozygous father and was also found in two unaffected children (Fig. 3). Interestingly, a RET missense mutation (R231H) previously has been shown to segregate in this family (Fig. 3; 10,24). This mutation was detected in three affected sibs, the healthy father and an unaffected daughter. Moreover, the three affected children showed the same combination of haplotypes at the RET locus, while no mutation (or polymorphism) was found in the RET gene inherited from the unaffected mother (Fig. 3). Finally, screening for mutations in the GDNF gene and in the genes encoding the endothelin signalling pathway (EDN3, EDNRB) failed to detect any deleterious base changes in our patients.


Figure 3. Segregation of NTN and RET (R231H) mutations in severe HSCR. m, mutant allele; +, wild-type allele; Mat, maternal haplotype at the RET locus.

HSCR is characterized by absence of parasympathic intrinsic ganglion cells in the submucosal and myenteric plexuses of the gastrointestinal tract. Since enteric neurons are derived from the vagal neural crest, HSCR is regarded as a neurocristopathy (4). In the vast majority of cases (80%), the aganglionic tract involves the rectum and the sigmoid colon only (short segment HSCR), while in 20% of cases, it extends towards the proximal end of the colon (2). Considering that RET and GDNF mutations have been reported in HSCR (8-12,21-23), we regarded the other RET ligand, NTN, as an attractive candidate gene, especially as it shares homologies with GDNF. Here, we report on the finding of a heterozygous NTN mutation in a large non-consanguineous family including four affected children with aganglionosis extending up to the small intestine. Each of the three affected children tested was heterozygous for the NTN mutation that was inherited from the unaffected heterozygous father (Fig. 3). This mutation seemed to be significant in the pathogenesis in HSCR for several reasons: (i) the A96S mutation was absent in 96 normal controls making the hypothesis of a coincidental polymorphism very unlikely; (ii) it led to substitution of a neutral hydrophobic amino acid (alanine) by an acid hydrophilic amino acid (serine) in a basic region; (iii) this amino acid substitution is very likely to alter the cleavage of the pre-propeptide into mature NTN; and (iv) this region is highly conserved between species, which probably indicates an important functional role in RET signalling (Fig. 2B).

Interestingly, a RET proto-oncogene mutation has been identified previously in this family (R231H) (10). Indeed, the three affected sibs and an unaffected sister were heterozygous for the RET mutation, which is absent in three unaffected children (Fig. 3). This RET mutation previously has been shown to be significant in HSCR as it resulted in haploinsufficiency via a significant reduction of the RET protein at the cell surface demonstrated in vitro (24). Hence, our results suggest that the combination of NTN and RET mutations led to a very severe aganglionosis and support a digenic mode of inheritance of HSCR in this family. However, it is worth noting that the unaffected father was also heterozygous for both the RET and the NTN mutations. It is possible that penetrance of NTN and RET missense mutations may be incomplete, and that at least a third molecular event would be involved. Along these lines, it is worth remembering that the three affected children shared the same combination of haplotypes at the RET locus. We might therefore speculate, among other hypotheses, that only the allelic combination of the A96S NTN mutation with the R231H RET mutation and maternal RET haplotype caused HSCR in this family. Supporting this view, mutations of GDNF, the other RET ligand, were found in HSCR patients in the context of either heterozygosity for a neutral RET variant creating a cryptic splice site (21,22), or a specific maternal-paternal combination of haplotypes around the RET locus (22). A similar hypothesis was proposed to explain the heterozygosity for both a RET at-risk haplotype and an endothelin-B-receptor missense mutation in a large inbred Mennonite population segregating HSCR (25). Thus, while our data clearly show that a germline NTN mutation is not sufficient to cause HSCR, they tantalizingly suggest that it might modulate the expression and worsen the course of the disease, especially as the aganglionic phenotype in the family reported is extremely severe, involving the whole colon and the distal part of the small bowel in each of the affected individuals. This rare phenotype was not observed in any of the HSCR patients with a RET mutation in our series (8,10).

Therefore, it appears that the rare NTN mutation reported here is not sufficient to result in HSCR, unless it might interact with other susceptibility loci yet to be discovered. This cascade of independent and additive genetic events fits well with the multigenic pattern of inheritance expected in HSCR. Studying the effects of wild-type and mutant partners of the RET signalling pathway, alone or in combination, will hopefully help in understanding the functional consequences of each of these mutations.

MATERIALS AND METHODS

Patients and families

A total of 165 HSCR probands (105 sporadic, 60 familial) and 96 normal controls were tested for mutations in the coding sequence of the NTN gene. Histopathological criteria for HSCR were (i) absence of enteric plexuses with histological evaluation of the aganglionic tract, and (ii) increased acetylcholinesterase histochemical staining in nerve fibres (26).

DNA analysis

DNA was isolated from peripheral blood lymphocytes by standard methods. Genomic DNA (100 ng) was amplified in a buffer (25 µl) containing 20 pmol of each primer, 0.1 µM dNTP, 0.1 µl of [[alpha]-33P]CTP (1 µCi), 1 U of Taq DNA polymerase and 5% dimethyl sulfoxide (DMSO). The two exons of the NTN gene were amplified using the following primers: (forward/reverse, 5[prime]->3[prime]) exon 1, ATGCAGCGCTGGAAGCGGC/GGGGGTATCTGACCCCACAC (204 bp); exon 2, ACCGTGCACTCCTGCAGGGG/TCACACGCAGGCGCACTCG (425 bp); exon 2A, ACCGTGCACTCCTGCAGGGG/GCAGCCCGAGGTCGTAGACG (267 bp); exon 2B, GACGAGACGGTGCTGTTCCG/TCACACGCAGGCGCACTCG (231 bp; Fig. 2A). Amplification conditions consisted of 30 cycles of 40 s at 94°C, 40 s at 68°C, 40 s at 72°C, followed by one cycle of 7 min extension at 72°C in a Perkin-Elmer 9600 Thermocycler. For SSCP analysis, PCR products were heated (10 min at 95°C), loaded onto a Hydrolink MDE gel (Bioprobe) and electrophoresed for 18 h at 4 W. The gels were dried and autoradiographed for 24 h. When an abnormal SSCP pattern was observed, direct DNA sequencing of the PCR products was performed on both strands by the fluorometric method (DyeDeoxy-Terminator Cycle Sequencing Kit, Applied Biosystems). For DNA haplotype analysis at the RET locus, all family members were genotyped using microsatellite DNA markers within (RET-INT 5) and flanking the RET gene (D10S141 and D10S176).

ACKNOWLEDGEMENTS

We are grateful to Drs A. Vallois and M. Gamahut (CH de Rouen), Professor C. Stoll (CH de Strasbourg), the French Hirschsprung Disease Consortium, and Hirschsprung disease families for their help. This study was supported by the Projet Hospitalier de Recherche Clinique (grants AOA94060 and AOM95224), the Association Française contre les Myopathies and the Association pour la Recherche sur le Cancer.

REFERENCES

1. Hirschsprung, H. (1887) Stuhltragheit neugeborener infolge von dilatation und hypertrophic des colons. Jb. Kinderheit, 27, 1.

2. Whitehouse, F. and Kerohan, J. (1948) Myenteric plexuses in congenital megacolon; study of 11 cases. Arch. Intern. Med., 82, 75-111.

3. Polley, T.Z. and Coran, A.G. (1986) Hirschsprung's disease in the newborn. Pediatr. Surg. Int., 1, 80-83.

4. Bolande, R.P. (1973) The neurocristopathies; a unifying concept of disease arising in neural crest maldevelopment. Hum. Pathol., 5, 409-429.

5. Badner, J.A., Sieber, W.K., Garver, K.L. and Chakravarti, A. (1990) A genetic study of Hirschsprung disease. Am. J. Hum. Genet., 46, 568-580. MEDLINE Abstract

6. Angrist, M., Kauffman, E., Slaugenhaupt, S.A., Cox Matise, M., Puffenberger, E.G., Washington, S.S., Lipson, A., Cass, D.T., Reyna, T., Weeks, D.E., Sieber, W. and Chakravarti, A. (1993) Hirschsprung disease (megacolon) in the pericentromeric region of human chromosome 10. Nature Genet., 4, 351-356. MEDLINE Abstract

7. Lyonnet, S., Bolino, A., Pelet, A., Abel, L., Nihoul-Fékété, C., Briard, M.L., Mok-Siu, V., Kaariainen, H., Martucciello, G., Lerone, M., Puliti, A., Luo, Y., Weissenbach, J., Devoto, M., Munnich, A. and Romeo, G. (1993) A gene for Hirschsprung disease maps to the proximal long arm of chromosome 10. Nature Genet., 4, 346-350. MEDLINE Abstract

8. Edery, P., Lyonnet, S., Mulligan, L.M., Pelet, A., Dow, E., Abel, L., Holder, S., Nihoul-Fékété, C., Ponder, B.A.J. and Munnich, A. (1994) Mutations of the RET proto-oncogene in Hirschsprung's disease. Nature, 367, 378-380. MEDLINE Abstract

9. Romeo, G., Ronchetto, P., Luo, Y., Barone, V., Seri, M., Ceccherini, I., Pasini, B., Bocciardi, R., Lerone, M., Kaariainen, H. and Martucciello, G. (1994) Point mutations affecting the tyrosine kinase domain of the RET proto-oncogene in Hirschsprung's disease. Nature, 367, 377-378. MEDLINE Abstract

10. Attié, T., Pelet, A., Edery, P., Eng, C., Mulligan, L.M., Amiel, J., Beldjord, S., Nihoul-Fékété, C., Munnich, A., Ponder, B.A.J. and Lyonnet, S. (1995) Diversity of RET mutations in Hirschsprung disease. Hum. Mol. Genet., 4, 1381-1386. MEDLINE Abstract

11. Yin, L., Barone, V., Seri, M., Bolino, A., Bocciardi, R, Ceccherini, I., Pasini, B., Tocco, T., Lerone, M., Cywes, S., Moore, S., Vanerwinden, J.M., Abramowicz, M.J., Kristoffersson, U., Hamel, B.C.J., Silengo, M., Martucciello, G. and Romeo, G. (1994) Heterogeneity and low detection rate of RET mutations in Hirschsprung disease. Eur. J. Hum. Genet., 2, 272-280. MEDLINE Abstract

12. Angrist, M., Bolk, S., Thiel, B., Puffenberger, E., Hofstra, R., Buys, C. and Chakravarti, A. (1995) Mutation analysis of the RET receptor tyrosine kinase in Hirschsprung disease. Hum. Mol. Genet., 4, 821-830. MEDLINE Abstract

13. Pichel, J.G., Shen, L., Sheng, H.Z., Granholm, A.C., Drago, J., Grinberg, A., Lee, E.J., Huang, S.P., Saarma, M., Hoffer, B.J., Sariola, H. and Westphal, H. (1996) Defects in enteric innervation and kidney development in mice lacking GDNF. Nature, 382, 73-76. MEDLINE Abstract

14. Sanchez, M.P., Silos-Santiago, I., Frisen, J., He, B., Lira, S.A. and Barbacid, M. (1996) Renal agenesis and the absence of enteric neurons in mice lacking GDNF. Nature, 382, 70-73. MEDLINE Abstract

15. Moore, M., Klein, R.D., Farinas, I., Sauer, H., Armanini, M., Phillips, H., Reichardt, L.F., Ryan, A.M., Carver-Mooore, K. and Rosenthal, A. (1996) Renal and neuronal abnormalities in mice lacking GDNF. Nature, 382, 76-79. MEDLINE Abstract

16. Durbec, P., Marcos-Gutierrez, C., Kilkenny, C., Grigoriou, M., Wartiowaara, K., Suvanto, P., Smith, P., Ponder, B.A.J., Costantini, F., Saarma, M., Sariola, H. and Pachnis, V. (1996) Glial cell-line derived neurotrophic factor signalling through the RET receptor tyrosine kinase. Nature, 381, 789-793. MEDLINE Abstract

17. Kotzbauer, P.T., Lampe, P.A., Heuckeroth, R.O., Golden, J.P., Credon, D.J., Johnson, E.M. Jr and Milbrandt, J. (1996) Neurturin, a relative of glial-cell-line derived neurotrophic factor. Nature, 384, 467-470. MEDLINE Abstract

18. Jing, S., Jing, S., Wen, D., Yu, Y., Holst, P.L., Luo, Y., Fang, M., Tamir, R., Antonio, L., Hu, Z., Cupples, R., Louis, J.C., Hu, S., Altrock, B.W. and Fox, G.M. (1996) GDNF-induced activation of the RET protein tyrosine kinase is mediated by GDNFR-[alpha], a novel receptor for GDNF. Cell, 85, 1113-1124. MEDLINE Abstract

19. Treanor, J.J., Goodman, L., de Sauvage, F., Stone, D.M., Poulsen, K.T., Beck, C.D., Gray, C., Armanini, M.P., Pollock, R.A., Hefti, F., Phillips, H.S., Goddard, A., Moore, M.W., Buj-Bello, A., Davies, A.M., Asai, N., Takahashi, M., Vandlen, R., Henderson, C.E. and Rosenthal, A. (1996) Characterization of a multicomponent receptor for GDNF. Nature, 382, 80-83. MEDLINE Abstract

20. Baloh, R.H., Tansey, M.G., Golden, J.P., Credon, D.J., Heuckeroth, R.O., Keck, C.L., Zimonjic, D.B., Popescu, N.C., Johnson, E.M. Jr and Milbrandt, J. (1997) TrnR2, a novel receptor that mediates neurturin and GDNF signaling through RET. Neuron, 18, 793-802. MEDLINE Abstract

21. Angrist, M., Bolk, S., Halushka, M., Lapchak, P. and Chakravarti, A. (1996) Germline mutations in glial cell line-derived neurotrophic factor (GDNF) and RET in a Hirschsprung disease patient. Nature Genet., 14, 341-343. MEDLINE Abstract

22. Salomon, R., Attié, T., Pelet, A., Bidaud, C., Eng, C., Amiel, J., Sarnacki, S., Goulet, O., Ricour, C., Nihoul-Fékété, C., Munnich, A. and Lyonnet, S. (1996) Germline mutations of the RET ligand GDNF are not sufficient to cause Hirschsprung disease. Nature Genet., 14, 345-347. MEDLINE Abstract

23. Ivanchuk, S.M., Myers, S.M., Eng, C. and Mulligan, L.M. (1996) De novo mutation of GDNF, ligand for the RET/GDNFR-alpha receptor complex, in Hirschsprung disease. Hum. Mol. Genet., 5, 2023-2026. MEDLINE Abstract

24. Pelet, A., Geneste, O., Edery, P., Pasini, A., Chappuis, S., Attié, T., Munnich, A., Lenoir, G., Lyonnet, S. and Billaud, M. (1998) Various mechanisms cause RET-mediated signalling defects in Hirschsprung disease. J. Clin. Invest., 101, 1415-1423. MEDLINE Abstract

25. Puffenberger, E.G., Hosada, K., Washington, S.S., Nakao, K., de Wit, D., Yanangisawa, M. and Chakravarti, A. (1994) A missense mutation of the endothelin-B-receptor gene in multigenic Hirschsprung's disease. Cell, 79, 1257-1266. MEDLINE Abstract

26. Lake, B. (1978) Hirschsprung disease. An appraisal of histochemically demonstrated acetylcholinesterase activity in suction biopsy specimens as an aid to diagnosis. Arch. Pathol. Lab. Med., 102, 244-247. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +33 1 44 49 51 36; Fax: +33 1 44 49 51 50; Email: lyonnet@necker.fr

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 12 Aug 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Med. Genet.Home page
J Amiel, E Sproat-Emison, M Garcia-Barcelo, F Lantieri, G Burzynski, S Borrego, A Pelet, S Arnold, X Miao, P Griseri, et al.
Hirschsprung disease, associated syndromes and genetics: a review
J. Med. Genet., January 1, 2008; 45(1): 1 - 14.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
A S Brooks, P A Leegwater, G M Burzynski, P J Willems, B de Graaf, I van Langen, P Heutink, B A Oostra, R M W Hofstra, and A M Bertoli-Avella
A novel susceptibility locus for Hirschsprung's disease maps to 4q31.3-q32.3.
J. Med. Genet., July 1, 2006; 43(7): e35 - e35.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
V. A. Cantrell, S. E. Owens, R. L. Chandler, D. C. Airey, K. M. Bradley, J. R. Smith, and E. M. Southard-Smith
Interactions between Sox10 and EdnrB modulate penetrance and severity of aganglionosis in the Sox10Dom mouse model of Hirschsprung disease
Hum. Mol. Genet., October 1, 2004; 13(19): 2289 - 2301.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
G. Fitze, H. Appelt, I. R. Konig, H. Gorgens, U. Stein, W. Walther, M. Gossen, M. Schreiber, A. Ziegler, D. Roesner, et al.
Functional haplotypes of the RET proto-oncogene promoter are associated with Hirschsprung disease (HSCR)
Hum. Mol. Genet., December 15, 2003; 12(24): 3207 - 3214.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
H. Sariola and M. Saarma
Novel functions and signalling pathways for GDNF
J. Cell Sci., October 1, 2003; 116(19): 3855 - 3862.
[Abstract] [Full Text] [PDF]

Home page
 GutHome page
M Garcia-Barcelo, M H Sham, V C H Lui, B L S Chen, J Ott, and P K H Tam
Association study of PHOX2B as a candidate gene for Hirschsprung's disease
Gut, April 1, 2003; 52(4): 563 - 567.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
S Borrego, R M Fernandez, H Dziema, A Niess, M Lopez-Alonso, G Antinolo, and C Eng
Investigation of germline GFRA4 mutations and evaluation of the involvement of GFRA1, GFRA2, GFRA3, and GFRA4 sequence variants in Hirschsprung disease
J. Med. Genet., March 1, 2003; 40(3): e18 - 18.
[Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. S. McCallion, E. Stames, R. A. Conlon, and A. Chakravarti
Phenotype variation in two-locus mouse models of Hirschsprung disease: Tissue-specific interaction between Ret and Ednrb
PNAS, February 18, 2003; 100(4): 1826 - 1831.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
H. Chang, C. W. Brown, and M. M. Matzuk
Genetic Analysis of the Mammalian Transforming Growth Factor-{beta} Superfamily
Endocr. Rev., December 1, 2002; 23(6): 787 - 823.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
C. Paratore, C. Eichenberger, U. Suter, and L. Sommer
Sox10 haploinsufficiency affects maintenance of progenitor cells in a mouse model of Hirschsprung disease
Hum. Mol. Genet., November 15, 2002; 11(24): 3075 - 3085.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
R M W Hofstra, P Elfferich, J Osinga, E Verlind, E Fransen, J Lopez Pison, C E M de Die-Smulders, I Stolte-Dijkstra, and C H C M Buys
Hirschsprung disease and L1CAM: is the disturbed sex ratio caused by L1CAM mutations?
J. Med. Genet., March 1, 2002; 39(3): e11 - 11.
[Full Text]

Home page
 Hum Mol GenetHome page
S. Eketjall and C. F. Ibanez
Functional characterization of mutations in the GDNF gene of patients with Hirschsprung disease
Hum. Mol. Genet., February 1, 2002; 11(3): 325 - 329.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. Koziell, V. Grech, S. Hussain, G. Lee, U. Lenkkeri, K. Tryggvason, and P. Scambler
Genotype/phenotype correlations of NPHS1 and NPHS2 mutations in nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum. Mol. Genet., February 1, 2002; 11(4): 379 - 388.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
J. Amiel and S. Lyonnet
Hirschsprung disease, associated syndromes, and genetics: a review
J. Med. Genet., November 1, 2001; 38(11): 729 - 739.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
M. Bahuau, A. Pelet, D. Vidaud, T. Lamireau, B. Le Bail, A. Munnich, M. Vidaud, S. Lyonnet, and D. Lacombe
GDNF as a candidate modifier in a type 1 neurofibromatosis (NF1) enteric phenotype
J. Med. Genet., September 1, 2001; 38(9): 638 - 643.
[Full Text] [PDF]

Home page
 GutHome page
M H Sham, V C H Lui, M Fu, B Chen, and P K H Tam
SOX10 is abnormally expressed in aganglionic bowel of Hirschsprung's disease infants
Gut, August 1, 2001; 49(2): 220 - 226.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
V. Cacheux, F. Dastot-Le Moal, H. Kaariainen, N. Bondurand, R. Rintala, B. Boissier, M. Wilson, D. Mowat, and M. Goossens
Loss-of-function mutations in SIP1 Smad interacting protein 1 result in a syndromic Hirschsprung disease
Hum. Mol. Genet., July 1, 2001; 10(14): 1503 - 1510.
[Abstract] [Full Text] [PDF]

Home page
 GutHome page
R P Kapur
Developmental disorders of the enteric nervous system
Gut, December 1, 2000; 47(90004): iv81 - 83.
[Full Text] [PDF]

Home page
 J. Med. Genet.Home page
J. R Hansford and L. M Mulligan
Multiple endocrine neoplasia type 2 and RET: from neoplasia to neurogenesis
J. Med. Genet., November 1, 2000; 37(11): 817 - 827.
[Abstract] [Full Text]

Home page
 J. Med. Genet.Home page
C. Scharfe, M. Hauschild, T. Klopstock, A. J M Janssen, P. H Heidemann, T. Meitinger, and M. Jaksch
A novel mutation in the thiamine responsive megaloblastic anaemia gene SLC19A2 in a patient with deficiency of respiratory chain complex I.
J. Med. Genet., September 1, 2000; 37(9): 669 - 673.
[Abstract] [Full Text]

Home page
 J. Med. Genet.Home page
M. BAHUAU, I. LAURENDEAU, A. PELET, B. ASSOULINE, T. LAMIREAU, L. TAINE, B. LE BAIL, P. VERGNES, S. GALLET, M. VIDAUD, et al.
Tandem duplication within the neurofibromatosis type 1 gene (NF1) and reciprocal t(15;16)(q26.3;q12.1) translocation in familial association of NF1 with intestinal neuronal dysplasia type B (IND B)
J. Med. Genet., February 1, 2000; 37(2): 146 - 150.
[Full Text]

Home page
 DevelopmentHome page
S Taraviras, C. Marcos-Gutierrez, P Durbec, H Jani, M Grigoriou, M Sukumaran, L. Wang, M Hynes, G Raisman, and V Pachnis
Signalling by the RET receptor tyrosine kinase and its role in the development of the mammalian enteric nervous system
Development, January 6, 1999; 126(12): 2785 - 2797.
[Abstract] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (80)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Doray, B.
Right arrow Articles by Lyonnet, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doray, B.
Right arrow Articles by Lyonnet, S.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?