| Human Molecular Genetics | Pages |
©1999 Oxford University Press |
Instability of the EPM1 minisatellite
Introduction
Results
Discussion
Materials And Methods
EPM1 clinical material
Genotyping
Acknowledgements
References
Instability of the EPM1 minisatellite
Received January 6, 1999; Revised and Accepted July 30, 1999
Inherited mutations in the cystatin B gene (CSTB) are responsible for progressive myoclonus epilepsy type 1 (EPM1; MIM 254800). This autosomal recessive disease is characterized by variable progression to mental retardation, dementia and ataxia. The majority of EPM1 alleles identified to date contain expansions of a dodecamer repeat located upstream of the transcription start site of the CSTB gene. Normal alleles contain two or three copies of the repeat, whereas pathogenic alleles contain >40 repeats. We examined the meiotic stability of pathogenic, expanded EPM1 alleles from 17 EPM1 families by employing a fluorescence-based PCR-based genotyping assay capable of detecting single dodecamer repeat unit differences on an automated DNA sequencer. We followed 74 expanded allele transmissions to 30 affected individuals and 22 carriers. Thirty-five of 74 expanded allele transmissions demonstrated either contraction or expansion of the minisatellite, typically by a single repeat unit. Thus expanded alleles of the EPM1 minisatellite demonstrate a mutation rate of 47%, the highest yet observed for pathogenetic alleles of a human minisatellite.
INTRODUCTION
Variations in short tandem repeat sequences such as micro- and minisatellites are responsible for a variety of human diseases. In the autosomal recessive disease progressive myoclonus epilepsy of Unverricht-Lundborg type (EPM1) expansions of a dodecamer minisatellite (CCCCGCCCCGCG) present in the 5[prime] flanking region of the cysteine proteinase gene, CSTB, are responsible for nearly 80% of disease alleles (1). Wild-type alleles contain two to three repeats, while expanded pathogenic alleles contain roughly 45-70 repeats. Precise characterization of allele expansions has not previously been possible because the highly GC-rich minisatellite has been refractory to PCR-based genotyping analysis and high-resolution electrophoresis. Instability has been reported in premutation alleles (13-17 repeats) in two CEPH pedigrees, although none of the individuals concerned was clinically observed with an EPM1 phenotype(2).
The instability observed in premutation alleles suggested that expanded disease alleles may be inherently unstable in EPM1 families and that this instability could be measured with a suitable assay. Previously, Lalioti et al. (3) described a PCR amplification and subsequent hybridization with an oligonucleotide containing the repeat to measure EPM1 repeat instability in a single extended family. To examine the generality of this instability we adapted a high-resolution, PCR-based, fluorescent genotyping assay (4,5) that utilized an automated DNA sequencer to measure the mutation rate of this minisatellite in a collection of EPM1 families. With the capability to measure single repeat unit changes in large disease alleles, we observed that pathogenic mutations of CSTB in parental carriers are transmitted to offspring as newly altered expansions or contractions in nearly 50% of informative cases.
RESULTS
We examined minisatellite stability in 17 EPM1 family pedigrees, 13 of which have been previously described (6). In these EPM1 families we followed 74 transmissions of expanded alleles from 32 parental carriers. We combined PCR-stutter artifacts with an internal size standard to determine exact variations in repeat copy number comprising the pathogenic expanded alleles (Fig. 1). PCR stutter was noticeable from the range of wild-type repeats (two to three copies) up to the full-length disease alleles (47-80 repeats) (Fig. 1B). A representative result from EPM1 family 5 is shown in Figure 1A. In this family each affected individual (EPL nos 56 and 57) is a compound heterozygote (74 and 78 repeat units), apparently having inherited a contracted maternal allele (75 to 74 repeats) and an expanded paternal allele (77 to 78 repeats). In both instances the allele expanded or contracted by a single 12 bp repeat. A summary of expanded EPM1 allele transmissions from 17 EPM1 families is shown in Table 1. In general, the predominant mutation pattern seen in our EPM1 families was expansion or contraction by a single 12 bp repeat; however, there were six gametes containing mutations of greater than one repeat, ranging from three repeats gained to two repeats lost. Fifty-two expanded alleles were transmitted to affected individuals while 22 alleles were transmitted to carriers. Of the thirty-five unstable expanded allele transmissions, 20 were contractions and 15 were expansions (Table 2). We observed no significant difference in the mutation rate per generation when expanded alleles were transmitted to either EPM1 patients (24 mutated versus 26 non-mutated) or to carriers (12 mutated versus 10 non-mutated). In contrast, we observed no mutations of wild-type alleles (two to three repeats) in 30 transmissions from carriers. Thus, the striking mutability observed at the EPM1 minisatellite was confined to expanded alleles. Thirty-three expanded alleles were transmitted maternally; of these, seven were mutated. Thirty-five expanded alleles were transmitted paternally; of these, 22 were mutated (P = 0.01). These data suggest greater instability with male transmissions, which is similar to that observed in CAG tract transmission. The mode of inheritance could not be determined for six expanded alleles.
Figure 1. PCR genotyping of the EPM1 minisatellite. (A) EPM1 family no. 5 (see ref. 6). GeneScan electropherogram of expanded EPM1 alleles (left) and pedigree showing EPM1 genotypes, indicating genotypes for each individual (right). Numbers at the top of each peak indicate the number of repeats in the expanded allele. Asterisks (*) denote de novo mutations and vertical dotted lines facilitate repeat number comparison. (B) PCR cross-over contamination is not responsible for instability seen in EPM1 families. DNAs from family no. 2, II, AA (69, 78) and family no. 3, II, AA (60, 73) as described (6) were PCR-amplified individually (top, middle) or as a mixture (bottom), and genotypes determined. Stutter artifact is denoted by the double-headed arrow indicating 10 repeat units (top).
Table 1. Transmission of EPM1 chromosomes to carriers and affected family members
| EPM1 family | Family member (EPL no.) | EPM1 genotype | |||
| Parental | Family member | ||||
| Maternal | Paternal | Carrier | Affected | ||
| 1 | 2 | 3/76 | ND | 3/76 | |
| 3 | 3/76 | ND | 75/76 | ||
| 5 | 3/76 | ND | 76/77 | ||
| 6 | 3/76 | ND | 3/76 | ||
| 9 | 3/76 | ND | 3/76 | ||
| 2 | 12 | 3/69 | 2/78 | 3/78 | |
| 13 | 3/69 | 2/78 | 69/78 | ||
| 14 | 3/69 | 2/78 | 69/77 | ||
| 16 | 3/69 | 2/78 | 2/68 | ||
| 3 | 19 | 3/73 | 3/57 | 58/71 | |
| 20 | 3/73 | 3/57 | 3/73 | ||
| 23 | 3/73 | 3/57 | 60/73 | ||
| 4 | 32 | 2/75 | 2/3 | 3/75 | |
| 34 | 2/75 | 2/74 | 75/75 | ||
| 35 | 2/75 | 2/74 | 73/75 | ||
| 5 | 56 | 3/75 | 3/77 | 74/78 | |
| 57 | 3/75 | 3/77 | 74/78 | ||
| 6 | 41 | 2/3 | 2/76 | 2/75 | |
| 43 | 2/3 | 2/76 | 2/75 | ||
| 42 | 2/78 | 2/2 | 2/78 | ||
| 70 | 2/78 | 2/2 | 2/78 | ||
| 44 | 2/78 | 2/75 | 75/78 | ||
| 45 | 2/78 | 2/75 | 2/74 | ||
| 7a | 48 | 3/66 | 2/57 | 3/60 | |
| 50 | 3/66 | 2/57 | 3/59 | ||
| 51 | 3/66 | 2/57 | 56/66 | ||
| 52 | 3/66 | 2/57 | 58/65 | ||
| 53 | 3/66 | 2/57 | 3/55 | ||
| 158 | 2/3 | 3/59 | 2/60 | ||
| 8 | 91 | 3/66 | 3/66 | 66/67 | |
| 92 | 3/66 | 3/66 | 3/65 | ||
| 9 | 97 | 2/57 | 2/3b | 3b/57 | |
| 10 | 111 | 3/3b | 3/66 | 3b/68 | |
| 112 | 3/3b | 3/66 | 3b/66 | ||
| 11 | 115 | 3/71 | 3/71 | 71/71 | |
| 116 | 3/71 | 3/71 | 3/71 | ||
| 117 | 3/71 | 3/71 | 71/71 | ||
| 118 | 3/71 | 3/71 | 3/72 | ||
| 128 | 3/71 | 3/71 | 71/71 | ||
| 129 | 3/71 | 3/71 | 70/71 | ||
| 12 | 123 | 3/3b | 3/47 | 3b/48 | |
| 13 | 132 | 3/67 | 3/3b | 3b/66 | |
| 133 | 3/67 | 3/3b | 3b/67 | ||
| 134 | 3/67 | 3/3b | 3b/66 | ||
| 14 | 140 | 3/3b | 3/75 | 3b/74 | |
| 15a | 142 | 3/62 | ND | 62/65 | |
| 143 | 3/62 | ND | 62/66 | ||
| 16a | 27 | 2/80 | 2/72 | 71/80 | |
| 28 | 2/80 | 2/72 | 2/80 | ||
| 29 | 2/80 | 2/72 | 2/80 | ||
| 17a | 162 | 3/63 | 2/79 | 3/78 | |
| 163 | 3/63 | 2/79 | 63/78 | ||
ND, no data.
aFamilies not previously described by Lafrenière et al. (6).
bEPM1 patients who contain an unexpanded allele bearing a splicing mutation.
Table 2. Instability of expanded EPM1 alleles
| EPM1 | HRAS1 | |||||
| Expanded alleles | WT alleles | Alleles | ||||
| Unstable | Stable | Stable | Unstable | Unstable | Stable | |
| No. of meioses | 35 (0.47) | 39 (0.53) | 30 | 0 | 0 | 98 |
| Total | 74 (1.00) | 30 | ||||
| Total no. alleles transmitted | 104 | 98 | ||||
To eliminate PCR artifact as a possible explanation for these data, we retyped all samples on multiple occasions. In every instance the same genotype was obtained. To exclude PCR crossover artifact as a source of mutation, we mixed and PCR-amplified alleles from compound heterozygotes; these reconstructions gave the same results as the genotyping of individual samples. A representative example of a mixing experiment is shown in Figure 1B. A mixture of two EPM1 patients, EPL no. 13 (69/78; Fig. 1B, top) and EPL no. 23 (60/73; Fig. 1B, middle) resulted in amplified alleles identical to the individual genotypes (EPL nos 13 and 23; Fig. 1B, bottom). This result excluded PCR-related recombination or deletion as an artifactual basis for our mutations.
To determine whether the instability observed at EPM1 was locus-specific, we genotyped these same families at the GC-rich HRAS1 minisatellite with the same, PCR-based, fluorescent genotyping assay utilizing an automated DNA sequencer. The repeat unit of this minisatellite is 28 bp long, and single unit resolution is also possible. In individuals possessing expanded EPM1 alleles, an examination of 98 HRAS1 transmissions demonstrated no new mutations of this minisatellite (Table 2).
We also explored the possibility of mitotic instability by genotyping lymphoblastoid cell lines derived from six EPM1 patients heterozygous for expanded alleles (data not shown). Three lines contained genotypes identical to those determined from blood leukocyte DNAs; however, three cell lines showed genotypes that differed from the patient's blood. In one patient, a compound heterozygote (69/78), cell line DNA yielded a (69/76) genotype. In cell lines from two other patients, three or more alleles were detected in each case. Taken together, these data suggested the added potential for mitotic instability of expanded EPM1 alleles.
DISCUSSION
The mutation frequency for expanded EPM1 alleles we report here is the highest yet observed for any human minisatellite locus (0.47), exceeding those previously reported for non-pathogenic premutation alleles of EPM1 (0.29) (3) and the male germline instability measured for the CEB1 minisatellite (0.15) (7). Previous work within a single EPM1 pedigree demonstrated that pathogenic alleles sometimes expand or contract by more than one repeat, though single repeat expansions/contractions are the predominant mutations observed (2). We believe that this high mutation rate is mediated by replication errors in DNA containing a 100% GC content of considerable length (600-800 bp) in the expanded alleles. The slightly smaller mutation rate previously reported for premutation allelesmay reflect their diminished lengths. Although we cannot firmly exclude germline mosaicism in the parents, germline instability seems the likely source of this high mutation rate. In this regard, minor peaks representing contractions and potential mosaicism were sometimes observed in our PCR genotyping (see, for example, Fig. 1). Therefore, low-level mosaicism might be masked by our method. However, we never observed minor peaks larger than the main allele that could be considered mosaic expansions.
Finally, we have shown that the PCR-based genotyping method coupled to automated sequencers that we developed for the HRAS1 minisatellite (4,5) has general applicability to even the most intractable of GC-rich minisatellites. We have successfully applied the method to other loci previously considered to be difficult for PCR amplification, such as DRD4. Therefore, the automated genotyping of carriers and affected individuals for any of the growing list of minisatellite-associated human diseases is now both practical and cost-effective. Furthermore, informative variable number of tandem repeats (VNTRs) may be employed more efficiently in linkage analyses.
MATERIALS AND METHODS
EPM1 clinical material
Blood was collected from EPM1 patients and all available family members as described (1). Pedigrees included EPM1 families 1-6 and 8-14 as described by Lafrenière et al. (6) as well as four newly described families.
Genotyping
Patient DNAs (200 ng) were PCR amplified with the oligonuclotide primers EPM1-FT (TETGACCCAGCCTGCGGCGAGTGGTGGCCAGGCT) and EPM1-RT (TETGGGGTCG- CGGTGGCCCCGCAAGAAGGGACG) derived from CSTB (GenBank accession no. U46692). Reactions were performed in 1X Expand High Fidelity Buffer with 1.5 mM MgCl2, 10% DMSO, 1.1 M betaine, 0.2 mM dNTPs, 0.4 µM primers, 2.6 U Expand High Fidelity PCR enzyme mix (Boehringer Mannheim, Indianapolis, IN) and 0.2 µg patient genomic DNA. Thermal cycling conditions were: 96°C, 2 min, 5 cycles of 95°C, 1 min, 63°C, 30 s, 72°C, 4 min, followed by 25 cycles of 95°C, 1 min, 63°C, 30 s, and 72°C, 4 min with 20 s auto segment extension. PCR products (2 µl) were co-electrophoresed on 5% native Long Ranger gels in the presence of GS2500 (TAMRA; PE/ABI, Foster City, CA) molecular weight marker (PE/ABI) on an Applied Biosystems 377 DNA Sequencer. Gels were run for 15 h at 800 V. Data were analyzed by using GeneScan software (v.2.1; PE/ABI). Genotypes were determined by a comparison with the GS2500 molecular weight marker combined with counting stutter artifacts. Utilizing this methodology, single VNTR repeat resolution was achieved for all expanded alleles (Fig. 1B). HRAS1 genotyping was as previously described (3,4).
ACKNOWLEDGEMENTS
We thank the members of the EPM1 families and the following clinicians for their participation in this study: D. Rochefort, R. Kälviäinen, U. Nousiainen, G. Patry, K. Farrel, B. Söderfeldt, A. Federico, B. Hale, O. Cossio, T. Sørensen, M. Pouliot, T. Kmiec, P. Uldall, J. Janszky, M. Pransatelli and E. Andermann. G.A.R. is supported by the Medical Research Council of Canada. This work was supported by funds from the Beckman Research Institute of the City of Hope.
REFERENCES
+These authors contributed equally to this work
§To whom correspondence should be addressed. Tel: +1 626 359 8111 ext. 4297; Fax: +1 626 301 8862; Email: tkrontir{at}.coh.org
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
This article has been cited by other articles:
![]() |
J. A. Langdon and J. A.L. Armour Evolution and population genetics of the H-ras minisatellite and cancer predisposition Hum. Mol. Genet., April 15, 2003; 12(8): 891 - 900. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mazarib, L. Xiong, M.Y. Neufeld, M. Birnbaum, A.D. Korczyn, M. Pandolfo, and S.F. Berkovic Unverricht-Lundborg disease in a five-generation Arab family: Instability of dodecamer repeats Neurology, September 25, 2001; 57(6): 1050 - 1054. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Vergnaud and F. Denoeud Minisatellites: Mutability and Genome Architecture Genome Res., July 1, 2000; 10(7): 899 - 907. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



