| Human Molecular Genetics | Pages |
©1999 Oxford University Press |
The Old World monkey DAZ (Deleted in AZoospermia) gene yields insights into the evolution of the DAZ gene cluster on the human Y chromosome
Introduction
Results
The autosomal cynDAZL1 cDNA
The Y-chromosomal cynDAZ cDNA
Analysis of the genomic repeat structure
Nucleotide and amino acid sequence comparisons
Expression of cynDAZ and cynDAZL1
Discussion
Materials And Methods
Animals
cDNA library screening
5[prime]-RACE of cynDAZ
Northern blot hybridization
Genomic DNA isolation
Sequence analysis
Immunohistochemistry
Acknowledgements
References
The Old World monkey DAZ (Deleted in AZoospermia) gene yields insights into the evolution of the DAZ gene cluster on the human Y chromosome
Received April 22, 1999; Revised and Accepted August 3, 1999
The DAZ gene cluster on the human Y chromosome is a candidate for the Azoospermia Factor (AZFc). According to the current evolutionary model, the DAZ cluster derived from the autosomal homolog DAZL1 through duplications and rearrangements and is confined to Old World monkeys, apes and humans. To study functional and evolutionary aspects of this gene family we have isolated from a cynomolgus (Old World) monkey testis cDNA library the Y chromosomal cynDAZ and the autosomal cynDAZL1 cDNA. cynDAZL1 contains one DAZ repeat and displays high homology to human DAZL1. cynDAZ comprises 11 repeats, each consisting of exons 7 and 8, whereas the human DAZ cDNA repeat units contain predominantly exon 7. Genomic studies revealed the same amplific- ation events of a 2.4 kb genomic unit encompassing exons 7 and 8 in both species, indicating that after splitting of the two lineages, in the human mainly exon 8 was converted to a pseudoexon by splice site mutations. The structural features of cynDAZ reveal a more detailed model for the sequence of events leading to the present form of human DAZ. Thus, in a monkey species DAZ is present in a form more ancestral than that of the human. Studies on the immunolocalization of cynDAZ/DAZL1 in cynomolgus monkey testis revealed a biphasic expression pattern with proteins being detectable in A-pale to B-spermatogonia, late spermatocytes and spermatids, but not in early spermatocytes and late spermatids. In contrast, in the marmoset monkey, an animal lacking DAZ, DAZL1 protein was only expressed in late spermatocytes and early spermatids. These findings point to an additional function of cynDAZ/cynDAZL1 during spermato- genesis in the Old World monkey not needed in the New World monkey.
INTRODUCTION
The existence of an Azoospermia Factor located in the distal part of the Y chromosome, bearing genes crucial for spermatogenesis, was first postulated by Tiepolo and Zuffardi (1) and was further supported by the identification of microdeletions in the Yq11 region of oligo- and azoospermic men (2). Multicenter studies of infertile men (3) led to the identification of three different AZF loci (AZFa, -b and -c). Microdeletions of AZFa-c could be detected in 5-15% of the infertile men, suggesting that the deleted regions of the Y chromosome contain genes essential for spermatogenesis (4,5).
One candidate gene in the AZFc region is the recently described DAZ gene (Deleted in AZoospermia) which can be mapped to Yq11.23 (2). It encodes a putative RNA-binding protein with one RNA-binding domain and a characteristic 24 amino acid DAZ repeat unit. DAZ was acquired by the Y chromosome from an autosomal homolog DAZL1 located on chromosome 3p24 (6-9). DAZ shares high homology with DAZL1, but unlike DAZL1, which is a single copy gene, it has undergone a complex series of duplications and rearrangements resulting in a polymorphic gene family (10). According to the current hypothesis for the evolution of DAZ: (i) a complete copy of autosomal DAZL1 was transposed to the Y chromosome; (ii) within the newly transposed gene a 2.4 kb genomic segment encompassing exons 7 and 8 was tandemly repeated and in most of the amplified units exon 8 degenerated, resulting in mainly exon 7 repeat units transcribed as the functional derivative of these amplifications; and (iii) the whole transcription unit was amplified, giving rise to a multicopy gene familiy (6,10).
The acquisition of DAZL1 by the Y chromosome must have been a recent event in evolution, since Southern blot analysis (2,7,9) and PCR experiments (11,12) demonstrated that DAZ is present on the Y chromosome of Catarrhini (Old World monkeys, apes and humans), but not in Platyrrhini (New World monkeys) and other mammals. Since the two monkey lineages split ~40 million years ago (13), the translocation of DAZ to the Y chromosome must have taken place thereafter.
DAZL1 or its homologs is expressed exclusively in the germ cells of female and male gonads of various species (11,14-16), whereas DAZ is most highly expressed in human spermatogonia (17). In mice expression of the autosomal DAZL1 gene is confined to B-spermatogonia, early spermatocytes, and highest expression can be observed in pachytene spermatocytes (18). Elimination of the DAZL1 gene in knock-out mice resulted in the complete absence of germ cells beyond the spermatogonial stage, indicating a crucial function of DAZL1 before or during the onset of meiotic cell divisions (18). Similarly, in the fruitfly, the loss of boule, a DAZL1 homolog, caused a meiotic arrest of germ cells (19).
Old World monkeys represent important and valuable animal models for the study of many aspects of human reproduction. Among the various species in use, the cynomolgus monkey (Macaca fascicularis) is particularly well characterized with regard to testicular physiology and gametogenesis (20-22). The fact that Old World monkeys possess a Y-chromosomal DAZ, which is absent in other animal models, renders them an exceptional animal suitable for the functional analyis of DAZ and its importance for human spermatogenesis. Accordingly, we have cloned the autosomal and Y-chromosomal DAZ homologs of the cynomolgus monkey M.fascicularis and characterized their expression.
RESULTS
The autosomal cynDAZL1 cDNA
On screening the monkey testis cDNA library using a human DAZL1 cDNA probe, five positive clones were identified. Four of the cDNA clones turned out to be identical on restriction site and sequence analysis. The cDNA consists of 3016 nucleotides encoding 295 amino acids (Fig. 1). The open reading frame (ORF) matches the partial sequence of cynDAZL1A cDNA obtained by RT-PCR and was previously published by us (11). Therefore, the full-length cDNA sequence isolated here, including the 3[prime]- and 5[prime]-untranslated region (UTR), was designated as the autosomal cynomolgus cynDAZL1 cDNA. The deduced protein consists of 295 amino acids with an estimated molecular mass of 33.1 kDa. In the N-terminal part one RNA-binding domain bearing the RNP-2 (VFVGGI) and RNP-1 (KGYGFVSF) motifs can be allocated. The ORF is preceded by a 210 nucleotide 5[prime]-UTR, and after the stop codon is followed by a 3[prime]-UTR with 1918 nucleotides.
Figure 1. Schematic graphic representation of cynDAZL1 and cynDAZ. The boxes indicate the ORF starting with +1. Numbering of the different exons and their corresponding sizes was done in homology with human DAZL1 and DAZ (6). Untranslated regions are shown by a line and the location of the RNA-binding domain by brackets. The putative glycosylation sites are marked by circles and the putative phosphorylation sites by asterisks. Within the UTR of cynDAZL1 and cynDAZ one polyadenylation signal (AATAAA) for each cDNA can be identified. The sequences have been deposited in the EMBL database under accession nos X99971 for cynDAZL1 and AJ012216 for cynDAZ.
The Y-chromosomal cynDAZ cDNA
The cynDAZ cDNA sequence (Fig. 1) is a composite of the partial cDNA of the remaining fifth clone and a 5[prime]-RACE product using adult monkey testis mRNA as a template. The 5[prime]-RACE products overlapped the cDNA insert by 50 nucleotides and extended 471 nucleotides further to the 5[prime] end.
The cynDAZ cDNA shares high homology with the cynDAZL1 cDNA, but is much larger and has a more complex structure. It covers 4490 nucleotides with 13 nucleotides for the 5[prime]-UTR and 2032 nucleotides forming the 3[prime]-UTR. Inspection of the ORF, extending from +1 to 2454, revealed the presence of a structure consisting of exons 1-6 (since no data on the genomic organization of the cynDAZ gene are available, exon numbering followed the human DAZ and DAZL1 gene structure) followed by exon 7, with the 72 bp repeat unit, and exon 8. However, after exon 8 a truncated 57 nucleotide copy of exon 7 is present, directly followed by another exon 2. The cDNA continues with a stretch of nucleotides corresponding to exons 2-6 and a repeat unit structure of 123 nucleotides consisting of exon 7 (72 nucleotides) and exon 8 (51 nucleotides). In total, 11 such exon 7 and 8 repeat units can be identified. After the fifth repeat, the motif is interrupted by the lack of one exon 7 copy, resulting in two adjacent exons 8. Within the eighth repeat exon 7 possesses 75 instead of 72 nucleotides. In the 11th repeat unit, exon 8 is truncated (35 nucleotides) and the nucleotide sequence proceeds with a single exon 7 followed by exons 10 and 11. Exon 9 is lacking within the cDNA. Experiments in which cynDAZ specific primer sequences from exon 11 were used for PCR from male or female monkey genomic DNA gave rise to an amplicon only in the male, suggesting a Y-chromosomal localization of cynDAZ cDNA (data not shown).
To exclude the possibility that the cynDAZ cDNA structure obtained is due to a failure during the generation of the cDNA library, we performed additional RT-PCR experiments using monkey testis total RNA. cDNA synthesis using a primer located in the second exon 2 followed by subsequent PCR using primer pairs located in the first exons 2 and 6 (Fig. 1), gave rise to an amplicon identical to the cDNA clone. Similar to this, we also confirmed the presence of the different repeats within the cDNA using primer pairs located in the second RNA-binding domain and exon 11. Both products were sequenced and confirmed the observed cDNA structure of cynDAZ (data not shown). However, by using this approach, we cannot exclude the existence of other cynDAZ isoforms being expressed in the monkey testis.
The ORF consists of 2454 nucleotides encoding 816 amino acids with a calculated molecular mass of 93.2 kDa and an isoelectric point (pI) of 9.24. Two RNA-binding domains, interrupted by a partial repeat structure, are present in the N-terminal part. The second domain is followed by several repeat units encoded by exons 7 and 8 with 41 amino acids (123 nucleotides) each. Further characteristic features of the putative protein structure include an adjacent exon 8/exon 8 after the fifth repeat unit and a truncated last exon 8 preceding a singular exon 7, which leads to a shift in the ORF terminating translation within exon 10 (Fig. 1)
Comparison of cynDAZL1 and cynDAZ with respect to specific amino acid motifs revealed four putative N-linked glycosylation sites in cynDAZ cDNA (Fig. 1) and one in cynDAZL1 cDNA. The most striking difference is the number of putative PKC phosphorylation sites, where (ST)-x-(RK) is the consensus motif. Two such sites are present in cynDAZL1, whereas 12 can be identified in cynDAZ, mainly located in exon 7 copies.
Analysis of the genomic repeat structure
In the human, the DAZ repeat structure has evolved by tandem amplification of a 2.4 kb genomic segment encompassing exons 7 and 8 (6). The junction sequence between two such repeats consists of a poly(C) sequence, which is present in all human repeats. To investigate whether a similar repeat unit is present on the Y chromosome of the monkey, sequences 5[prime] or 3[prime] of the human repeat unit junction were used for primer selection. Following PCR with genomic DNA obtained from male or female monkeys, an amplification product was obtained only in the male monkey. A junction sequence (CCCCT) similar to that in the human was identified (Fig. 2). The homology of the monkey and human Y region shown in Figure 3 reaches 81%.
Figure 2. Nucleotide sequence comparison of the junctions between the different 2.4 kb repeats encompassing exons 7 and 8 of monkey and human. The overall homology is 82% and the junction consensus sequence (CCCCCCT) is boxed. The primer sequences used to amplify the 262 bp fragment from genomic DNA from male humans and monkeys are underlined. The human sequences are taken from a DAZ cosmid (AC0000021).
Figure 3. Northern blot hybridization of poly(A)-RNA obtained from different monkey testes (testis-1-3) and from different tissues (kidney, brain, adrenal). The positions of the 18 S and 28 S rRNA bands, which were still visible after mRNA isolation, are indicated. The blot was first hybridized to a specific cynDAZ cRNA probe, comprising four exon 7/exon 8 repeats (left side; exposure time 7 days) and, after stripping, reprobed to a cRNA, comprising the whole ORF of cynDAZL1 (11) (right side; exposure time 2 days).
Nucleotide and amino acid sequence comparisons
A detailed comparison of the nucleotide and amino acid sequences of monkey cynDAZ and cynDAZL1 and the corresponding human DAZ/DAZL1 is presented in Table 1. Within the ORF the overall nucleotide sequence homology of the monkey cynDAZL1 and human DAZL1 cDNA reaches ~98%. When the 3[prime]-UTRs from the human and monkey autosomal DAZL1 are compared, a similar homology (94%) is attained.
Table 1. Nucleotide and amino acid sequence comparison of human and monkey DAZL1 and DAZ cDNA
| % Homology | ||||||
| cynDAZ/DAZ | cynDAZ/cynDAZL | cynDAZ/DAZL | DAZ/cynDAZL | DAZ/DAZL | DAZL/cynDAZL | |
| Transcribed sequences | 90 | 91.6 | 91.7 | 92.6 | 92.2 | 98.5 |
| 5[prime]-UTR | - | - | - | 84.5 | 85 | 93.4 |
| 3[prime]-UTR | 90.5 | 89.6 | 88.5 | 89.6 | 89.1 | 94.2 |
| Amino acid sequences | 82.6 | 87.1 | 87.1 | 85.1 | 87.1 | 98 |
| RNA-binding domain amino acid sequence | 85.7 | 89.3 | 89.2 | 89.3 | 89.3 | 100 |
Similarity drops to 87% (amino acid) and 91% (nucleotide) when autosomal DAZL1 and Y-chromosomal DAZ from the monkey are compared. The predicted overall amino acid sequence is characterized by a high percentage of proline (14%) and tyrosine (9.8%) residues, mainly located in the repeat units. The abundance of these two amino acids are markedly lower in cynDAZL1 with proline representing 10% and tyrosine 5%, respectively.
Expression of cynDAZ and cynDAZL1
Northern blot hybridization.
Northern blot hybridization of different monkey tissues performed under stringent conditions with a cRNA probe obtained from cynDAZ encompassing four exon 7/exon 8 repeats, yielded three testis-specific transcripts, of 1.6, 3.5 and 5.8 kb, respectively (Fig. 3). Reprobing the same northern blot with a cRNA probe covering the ORF of cynDAZL1 led to the identification of two testis-specific transcripts with 1.6 and 3.5 kb, respectively. Identical transcripts are present in the testes of three different monkeys. No signals could be observed in other monkey tissues.
Differential expression pattern of DAZ/DAZL1 protein in Old World and New World monkeys.
In the cynomolgus monkey, belonging to the Old World monkeys, a biphasic testicular expression pattern of cynDAZ/cynDAZL1 was seen (Figs 4 and 5). The first wave of expression extends from A-pale-type spermatogonia to B-type spermatogonia (Fig. 4a and c) and vanishes in cells just prior to initiation of meiosis (preleptotene spermatocytes). cynDAZ/cynDAZL1 protein expression could not be detected in leptotene, zygotene and early pachytene stages of the primary spermatocytes (Fig. 4a). The second wave of expression starts with advanced pachytene spermatocytes and is highest in spermatocytes just before germ cell divisions. The protein is still detectable in early spermatid stages (Fig. 4c) but staining diminishes thereafter. Staining was confined to germ cells. Since an antibody directed to a part of the RNA-binding domain common to cynDAZ and cynDAZL1 was used, specific discrimination between the two protein expression patterns is not possible.
Figure 4. Micrographs from cynomolgus monkey (a-c) and marmoset (d-f) testis stained for DAZ/DAZL1 using a polyclonal antiserum and APAAP/Neufuchsin (red) for antigen detection and visualization. Sections are counterstained with hematoxylin. (a) Pachytene spermatocytes are stained intensely (white asterisks), whereas early spermatocyte clusters (black asterisks) and spermatids in various phases of elongation (black arrows) are negative. Some spermatogonia are positive (white arrows). (b and e) Preincubation of primary antibody with antigen abolished the stain. (c) High power magnification showing signals in B-type spermatogonia (short white arrows). Round spermatids (long white arrows) are weakly positive whereas elongated spermatids (black arrows) are negative. White asterisks denote clusters of positive pachytene spermatocytes. (d) In the marmoset, pachytene spermatocytes display signal (white asterisks) whereas earlier spermatocytes (black arrows) are negative. White arrows exemplify round spermatids with intense staining of cytoplasmatic structures. (f) High power magnification showing that A- and B-type spermatogonia (black arrows) are negative. White asterisks indicate areas with intensely stained pachytene spermatocytes. Round spermatids (long white arrows) are also positive.
Figure 5. Schematic representation of the DAZ/DAZL1 protein expression pattern during spermatogenesis in an Old World (M.fascicularis) and a New World (C.jacchus) monkey. Arrows indicate germ cell types where expression was observed.
In testicular tissue of the marmoset (Callithrix jacchus), belonging to the New World monkeys and lacking the Y-chromosomal DAZ, specific staining was obtained in advanced primary spermatocytes starting with prophasic stages after the zygotene stage (Figs 4 and 5). Expression was pronounced in late pachytene spermatocytes (Fig. 4d and f) prior to the second meiotic cell division. Expression was also detected in early spermatid stages (Fig. 4d and f). In spermatogonial stages no staining was observed (Fig. 4f). Staining specificity was demonstrated in both species by the lack of signals following omission of the primary antibody (data not shown) or preincubation of the primary antibody with the antigen (Fig. 4b and e).
DISCUSSION
We have cloned the autosomal cynDAZL1 and the Y- chromosomal cynDAZ cDNA of the Old World monkey M.fascicularis and investigated the testicular expression pattern. Comparison with the human DAZ genes yielded interesting insights into the evolution of the DAZ gene cluster and its role in spermatogenesis.
One of the remarkable features of cynDAZ cDNA is the presence of repeat units consisting of exons 7 and 8, whereas in the human DAZ cDNA repeat units are mainly formed by exon 7. At the genomic level both exons are present in either species, but transcription of exon 8 in the human is prohibited by mutations affecting the splice sites of exon 8 (6). Taking into account the observed cDNA structures of cynDAZ and cynDAZL1, sequence homologies between the different repeats of cynDAZ and DAZ and the information on the genomic organization of DAZ and DAZL1, we suggest a revised sequence of evolutionary events leading from a hitherto unknown ancestral DAZ gene to the DAZ genes present today in the human and the cynomolgus monkey (Fig. 6).
Figure 6. Proposed model for the evolution of DAZ in the human and in the cynomolgus monkey. For the evolution of the repeat units a phylogenetic tree was built based on the sequence differences within the different repeat units. Sequence data from monkey and the human were used. The RNA-binding domain of the ancestral Y-chromosomal DAZ is indicated by the black box and the remaining ORF, except exons 7 and 8, by the light grey boxes. The different repeats and their origins are given by letters A-D. Mutations affecting the splice sites or truncations of the different exons within a specific repeat are indicated by ° for repeat A, * for repeat B, [prime] for repeat C and a black square for repeat D. A detailed nucleotide sequence map of the model proposed can be obtained from the authors on request.
A complete copy of the DAZL1 transcription unit was transposed from an autosome to the Y chromosome. This translocation must have occurred after the splitting of the Old World and New World monkeys ~40 million years ago (13).
Within the newly transposed gene a 2.4 kb genomic segment encompassing exons 7 and 8 was repeated. The assumption that the same amplification event must have taken place in one lineage is based on the high homology between the junction sequences of the 2.4 kb unit in the human and Old World monkey lineages (Fig. 3). Since the different repeats are not identical in the nucleotide sequences, a pedigree of the origins of the different repeats can be deduced. Amplification of the genomic segment resulted in the hypothetical repeats A and B. A then duplicated again, resulting in A and C, followed by splitting of C, creating D. Four repeats consisting of exons 7 and 8 are now present in the DAZ gene.
A deletion in B destroyed the right splice site of exon 8 and a nucleotide substitution in C created a new splice donor site, resulting in a truncated copy of exon 8 (6). These events must have taken place before splitting of species since in both monkey cynDAZ and human DAZ cDNA the last copy of exon 8 is truncated (35 nucleotides). Repeats A and D remained unaltered.
Splitting of the human and monkey lineages occurred ~20 million years ago. Thereafter a mutation in the left splice site of exon 8 in repeat A disabled this exon in humans and a mutation changed the right splice site of exon 8 in repeat D (6). It appears that most repeats present today in humans are derivatives of repeat D and therefore have the same mutation leading to lack of transcription of exon 8. This deduction is not possible for the monkey since the genomic sequences of the monkey DAZ gene are not yet known. In the monkey the last truncated exon 8 is followed by a singular exon 7 (Figs 1 and 6), whereas in the human truncated exon 8 is followed by exon 10. This points to an event disabling also the last copy of exon 8 in the human after the species split. Since these events are presumably specific for the lineage of humans and apes, the cynomolgus monkey still possesses a DAZ in which most of the transcribed repeat units consist of exons 7 and 8.
The resulting complete DAZ transcript unit then was amplified, giving rise to a multicopy gene family in the human. In Old World monkeys the presence of Y-chromosomal DAZ genes has been proven by comparative mapping studies (23) and Southern blot experiments (7), but the exact determination of DAZ copy number is presumably only possible using Fibre-FISH techniques (24). In the cynomolgus monkey at least two copies must have existed, one copy except exon 1 was translocated and inserted into exon 7 of the other gene copy, resulting in the generation of a cynDAZ gene as described here.
Northern blot experiments revealed two cynDAZL1 transcripts with a size of 3.5 and 1.6 kb, respectively. Although the cDNA displays only one typical polyadenylation signal, it is likely that a shorter transcript is generated by alternative polyadenylation. Several DAZL1 transcripts have also been described in the human and mouse (2,8). The signal obtained for the 5.8 kb cynDAZ transcript is clearly lower when compared with cynDAZL1 mRNA; however, this does not necessarily reflect an overall decreased level of cynDAZ mRNA, since expression could be high in certain germ cells, e.g. spermatogonia, presenting only a minor fraction of the testis homogenates being used for mRNA isolation. The same transcript size is present in three animals, indicating the lack of gross alternative splicing events of cynDAZ mRNA.
Since the first description of DAZ, the question of whether it is functional or just a vestigial gene cluster on the Y chromosome has been discussed. Along this line substitution rates in the first five exons and four introns of DAZ from several species, including humans, were investigated and found not to be significantly different, implying a neutral genetic drift and the absence of functional selective pressures on DAZ (25). However, from recent studies (10,24) it is evident that the DAZ gene cluster consists of more than two gene copies, as was assumed by Agulnik et al. (25), leaving open the possibility that distinct copies of the DAZ gene are beneficial for spermatogenesis. For cynDAZ it is noteworthy that despite several duplications and rearrangements the ORF is preserved, indicating a selective pressure at the translational level. The view in favor of a function is further strengthened by experiments in which the capacity of DAZ to complement the sterile phenotype of the Dazl1 null mouse was investigated. Heterologous expression of DAZ in these mice increases the number of germ cells and leads to a survival into pachytene stages of meiosis (26). The partial recovery of spermatogenesis in mice by using human DAZ also suggests that the target mRNA for DAZL1 and DAZ during spermatogenesis is either similar or identical. Studies in Xenopus have shown that the DAZL1 homolog interacts with G- and U-rich RNAs in vivo (16). In Drosophila Boule, a ortholog of DAZL1, interacts with the translational regulation of twine, encoding a Cdc25-type phosphatase, which is crucial for the transition from G2 to M phase during meiosis (27). In this regard the presence of 12 phosphorylation motifs is an interesting feature of cynDAZ. If these sites undergo phosphorylation it could have an impact on the activity of cynDAZ. Studies in yeast indicated that RNA-binding proteins control the cell cycle switch from mitotic to meiotic cell divisions (28). The protein is phosphorylated by protein kinases, thereby promoting the mitotic cycle or triggering the meiotic cycle by dephosphorylation. This model would in part resemble the expression pattern of DAZ/DAZL1 that is present in mitotic (29) and meiotic (17,18,30) cells.
The protein expression of DAZL1 and DAZ is confined to certain germ cell types, but seems to vary between species. In rodents, a large expression window for DAZL1, ranging from intermediate spermatogonia to round spermatids, exists (18). This window is much narrower in New World monkeys, where expression is restricted to late spermatocytes and early spermatids. In Old World monkeys cynDAZ/DAZL1 protein could be detected during spermatogonial stages and advanced pachytene spermatocytes (Fig. 5). Although in our immunohistochemical approach it was not possible to distinguish between cynDAZ and cynDAZL1, it is tempting to speculate that the expression pattern obtained in spermatogonia might represent cynDAZ. These findings point to an additional function of cynDAZ/cynDAZL1 during early stages of spermatogenesis in the Old World monkey not needed in the New World monkey. Interestingly, DAZ expression is highest in human spermatogonia (17) and deletions of DAZ in infertile men frequently cause a Sertoli-cell-only syndrome or oligozoospermia, strongly indicating that DAZ is an essential factor for the generation and maintenance of spermatogonial stem cell population.
Finally, the fact that cynDAZ possesses two RNA recognition motifs (RRMs) might point to a function different from DAZ or DAZL1 homologs. The presence of two RRMs can either affect binding affinities to target mRNAs or change the type of target mRNA. Similar to cynDAZ, a number of RNA-binding proteins have been described bearing two or more RRMs, all being essential for spermatogenesis (31). In nearly all cases the target mRNA is not known, and further research is needed to identify target mRNAs for cynDAZ and DAZ, and gain insights into the functional role of the DAZ gene family during spermatogenesis.
MATERIALS AND METHODS
Animals
Testes from adult cynomolgus monkeys (M.fascicularis) and common marmosets (C.jacchus) were collected at autopsy and partly snap-frozen or fixed in Bouin's fluid for subsequent analysis.
cDNA library screening
The monkey testis cDNA library was constructed using the oligo-dT primed cDNA synthesis kit (Stratagene, Heidelberg, Germany) employing the Uni-ZAPXR unidirectional phagemid vector. Plating of recombinant phages, generation of replica filters and hybridization were performed according to the standard protocols. Hybridization was performed at 60°C for 16-18 h. Filters were washed at a final stringency of 1× SSC/0.1% SDS at 60°C and exposed for 1-2 days at -80°C using intensifying screens. Positive clones were purified by plaque isolation and two additional screening procedures. Phagemids were excised according to the manufacturer's protocol and the corresponding cDNAs sequenced from both directions.
5[prime]-RACE of cynDAZ
Based on the partial cDNA sequence a specific cynDAZ reverse primer (GCGCGACTCGGGGCTGAAGATATG; position 449-472) was used for cDNA synthesis from monkey testis RNA. Subsequent PCR was performed using a forward primer (GCCTGCCACCACCATGTCTGC, position -13 to 8 based on the human DAZ sequence (2). The PCR fragments obtained were cloned into the TA cloning vector (Invitrogen, Heidelberg, Germany) and sequenced.
Northern blot hybridization
mRNA was isolated from different tissues of cynomolgus monkeys using the Fast Track kit (Invitrogen, Heidelberg, Germany). Electrophoresis of mRNA was performed in 1% denaturing agarose gels, the mRNA was blotted onto nylon membranes (Amersham, Freiburg, Germany) and fixed by crosslinking through UV irradiation. Filters were prehybridized at 58°C in 5× SSPE (1× SSPE: 15 M NaCl, 10 mM NaH2PO4, 1 mM EDTA), 50% formamide, 2× Denhardt's solution and 1% SDS with 0.1 mg/ml denatured salmon sperm DNA. Hybridization conditions were identical to those for prehybridization but with the addition of a [32P]CTP-labelled cRNA probe with a final concentration of 0.5 × 106 c.p.m./ml. As probe either a cDNA cloned in pGEM-T (Promega, Madison, WI) containing the ORF of cynDAZL1, linearized by SacII digestion and transcribed by T7-RNA polymerase or a cDNA containing four exon 7 and 8 repeat units from cynDAZ, linearized by SalI digestion and transcribed by T3-RNA polymerase, were used. Hybridization was performed overnight for 16-18 h followed by washing at a final stringency of 0.1 SSC/0.1 SDS at 68°C. The blots were exposed to X-ray films (Amersham) for 2-7 days using intensifying screens at -80°C.
Genomic DNA isolation
Genomic DNA was isolated from blood samples of women, men and cynomolgus monkeys using the nucleon extraction and purification kit (Amersham). In the different PCR experiments 100-300 ng DNA were used (PCR-cycling conditions: 35× 40 s at 94°C, 30 s at 58°C, 1.5 min at 72°C). For the amplification of the 2.4 kb genomic unit junctions in the monkey and human two primers based on the human sequence were used: forward, CTCTGCCTCTGGCTTTACCA; reverse, gaggaggcatctggaaatcatt.
Sequence analysis
For sequence analysis the FASTA (version 3) program was used. The phylogenetic studies were performed with the PHYLIP (Phylogeny Inference Package, version 3.5c) program.
Immunohistochemistry
Bouin's fixed specimens were dehydrated, embedded in paraffin, and sectioned at 5 µm. After deparaffinization, rehydration and blocking of unspecific binding using 5% normal porcine serum, the sections were incubated with a rabbit polyclonal antibody (antiserum 149) directed to a peptide (HGKKLKLGPAIRKQKL) common in human DAZ and DAZL1 (R. Reijo et al., unpublished data) at 1:400-1:1000 dilutions overnight at 4°C. Following washing steps [3× TBS (0.05 M Tris, 0.15 M NaCl, pH 7.6), 5 min each], sections were incubated with a second antibody (monoclonal mouse anti-rabbit Ig, 1:50 dilution; Dako, Hamburg, Germany) for 30 min at room temperature. After a second washing step an antibody-enzyme complex (porcine APAAP; Sigma, Deisenhofen, Germany) was added and incubated for 30 min at room temperature. After a final washing step the sections were incubated for 15 min with Newfuchsin. The reaction was stopped, sections were counterstained with haematoxylin, dehydrated and mounted. For assessment of method specificity the primary antibody was omitted. Antibody specificity was evaluated by pre-incubation of the primary antibody overnight at 4°C using the synthetic antigenic peptide. For the experiments, antibody dilution was kept constant at 1:400 and a 0.1% peptide (1 mg/ml) solution was added at volumes ranging from 1:1, 2:1, 5:1 and 8:1 (peptide:antibody). On the next day, following washing steps, the immunohistochemical protocol was applied as described above, using the peptide/antibody mixture as primary antibody solution.
ACKNOWLEDGEMENTS
The authors would like to thank Dr Renee A. Reijo for characterizing the antiserum used in this study (Howard Hughes Medical Institute, Whitehead Institute, and Department of Biology, Massachusetts Institute of Technology, Cambridge, MA). The authors also would like to thank L. Pekel, R. Sandhowe-Klaverkamp and B. Schuhmann for their technical assistance, and S. Nieschlag MA for language editing. Covance Laboratories, Münster, Germany, is acknowledged for donating female monkey blood samples. Testis tissue from common marmosets was kindly provided by the German Primate Center, Göttingen. The cDNA library was generated in collaboration with Prof. Richard Ivell (Institute of Hormone and Fertility Research, Hamburg, Germany). The study was supported by grants from the Deutsche Forschungsgemeinschaft, the Confocal Research Group `The Male Gamete: Production, Maturation and Function' (Ni-130/15), the Fritz-Thyssen Foundation (1078) and the National Institutes of Health.
REFERENCES
+To whom correspondence should be addressed. Tel: +49 251 8366097; Fax: +49 251 8356093;Email: nieschl{at}uni-muenster.de
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  T. Muller, G. Fleischmann, K. Eildermann, K. Matz-Rensing, P. A. Horn, E. Sasaki, and R. Behr A novel embryonic stem cell line derived from the common marmoset monkey (Callithrix jacchus) exhibiting germ cell-like characteristics Hum. Reprod., June 1, 2009; 24(6): 1359 - 1372. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. J. Huang, Y.-W. Lin, K.-N. Hsiao, K. S. Eilber, E. C. Salido, and P. H. Yen Restricted expression of the human DAZ protein in premeiotic germ cells Hum. Reprod., June 1, 2008; 23(6): 1280 - 1289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. K. Bhowmick, Y. Satta, and N. Takahata The origin and evolution of human ampliconic gene families and ampliconic structure Genome Res., April 1, 2007; 17(4): 441 - 450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Jovelin, S. Berthaud, and G. Lucotte Molecular basis of the TaqI p49a,f polymorphism in the DYS1 locus containing DAZ genes Mol. Hum. Reprod., September 1, 2003; 9(9): 509 - 516. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Maduro, K. C. Lo, W. W. Chuang, and D. J. Lamb Genes and Male Infertility: What Can Go Wrong? J Androl, July 1, 2003; 24(4): 485 - 493. [Full Text] [PDF]
|
|
|
|
 |
|
 U. Zuhlke and G. Weinbauer The Common Marmoset (Callithrix jacchus) as a Model in Toxicology Toxicol Pathol, January 1, 2003; 31(1_suppl): 123 - 127. [Abstract] [PDF]
|
|
|
|
 |
|
 Y.-N. Teng, Y.-M. Lin, Y.-H. Lin, S.-Y. Tsao, C.-C. Hsu, S.-J. Lin, W.-C. Tsai, and P.-L. Kuo Association of a Single-Nucleotide Polymorphism of the Deleted-in-Azoospermia-Like Gene with Susceptibility to Spermatogenic Failure J. Clin. Endocrinol. Metab., November 1, 2002; 87(11): 5258 - 5264. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. S. Haag Rolling back to BOULE PNAS, June 19, 2001; 98(13): 6983 - 6985. [Full Text] [PDF]
|
|
|
|
|
|
E. Y. Xu, F. L. Moore, and R. A. R. Pera A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in metazoans PNAS, May 30, 2001; (2001) 131090498. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Foresta, E. Moro, and A. Ferlin Y Chromosome Microdeletions and Alterations of Spermatogenesis Endocr. Rev., April 1, 2001; 22(2): 226 - 239. [Abstract] [Full Text]
|
|
|
|
|
|
E. Y. Xu, F. L. Moore, and R. A. R. Pera From the Cover: A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in metazoans PNAS, June 19, 2001; 98(13): 7414 - 7419. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||