| Human Molecular Genetics | Pages |
©1999 Oxford University Press |
A missense mutation in the desmin rod domain is associated with autosomal dominant distal myopathy, and exerts a dominant negative effect on filament formation
Introduction
Results
Clinical description of a patient with desmin-related myopathy
Muscle pathology of index case
A desmin mutation in myopathic family members
The L345P mutation affects IF assembly
Discussion
Materials And Methods
Muscle biopsy analysis
DNA analysis
Site-directed mutagenesis
Cell culture and DNA transfection
Immunofluorescent staining
Acknowledgements
Note Added In Proof
References
A missense mutation in the desmin rod domain is associated with autosomal dominant distal myopathy, and exerts a dominant negative effect on filament formation
Received June 7, 1999; Revised and Accepted September 2, 1999
DDBJ/EMBL/GenBank accession no. AJ132926
In some myopathies of distal onset, the intermediate filament desmin is abnormally accumulated in skeletal and cardiac muscle. We report the first point mutation in desmin cosegregating with an autosomal dominant form of desmin-related myopathy. The L345P desmin missense mutation occurs in a large, six generation Ashkenazi Jewish family. The mutation is located in an evolutionarily highly conserved position of the desmin coiled-coil rod domain important for dimer formation. L345P desmin is incapable of forming filamentous networks in transfected HeLa and SW13 cells. We conclude that the L345P desmin missense mutation causes myopathy by interfering in a dominant-negative manner with the dimerization-polymerization process of intermediate filament assembly.
INTRODUCTION
Primary muscle disorders of distal onset are a rare and unusual collection of inherited myopathies. These disorders, commonly known as the `hereditary distal myopathies' (HDMs) (1,2), are typically first evident in muscles of the feet or hands. HDMs are heterogeneous and have been grouped according to clinical presentation, pathology and mode of inheritance (2).
One type of HDM is characterized by a pathological accumulation of the muscle-specific intermediate filament (IF) protein, desmin (OMIM 610419).Similar to the >60 other members of the IF family, desmin (53 kDa) consists of a central [alpha]-helical coiled-coil rod domain flanked by non-helical head and tail domains (3,4). The rod domain is highly conserved among the various IFs, and is the subdomain important for dimer formation, an essential first step in filament formation (3). In normal muscle, desmin forms the IF cytoskeleton of mature skeletal and cardiac muscle fibers (5-7). During myogenic differentiation, the intracellular localization of desmin changes from the IF network typical of most mononucleate cells to a muscle-specific localization to the subsarcolemma and to the Z-band region, where it is linked to plectin (4). Immunohistochemical staining of muscle biopsies of patients affected by some forms of HDM reveals accumulation of desmin as granulofilamentous material in the subsarcolemmal spaces.Since the first description in 1978 of a hereditary distal myopathy with inclusions of desmin in skeletal muscle (8), a number ofcases of hereditary myopathies with desmin accumulation have been reported (9). Most of these are inherited as autosomal dominant traits (8,10-13), and many include cardiac involvement (8,10-12,14-22). Hereditary distal myopathies associated with desmin accumulation have been collectively dubbed `desminopathies' (23,24).
Despite the consistent finding that desmin is accumulated in desmin-related myopathies, a primary role for desmin in these disorders has been questioned. First, deposits of other proteins, including [alpha]B-crystallin (19), [alpha]-actinin (25,26), nebulin (25,26) and dystrophin (26) have been reported. Second, three families with autosomal dominant desminopathies were excluded from linkage to the desmin gene on human chromosome 2q (27). Finally, a missense mutation in the [alpha]B-crystallin gene at 11q21-q23 was identified in a large French family with a desmin-related myopathy (28). Taken together, these results implied that desmin accumulation may be a secondary, rather than a primary, feature of these myopathies.
Recently, mutations in the desmin gene have been reported to be associated with myopathy in three small families (29,30). A familial desmin mutation encoding a 7 amino acid (R173-E179) deletion (30) has recently been shown to interfere with IF formation. However, in this case, a clinical myopathy was not evident in family members who retained the wild-type desmin allele, but only in one family member with a loss of the wild-type allele concomitant with the presence of the mutated allele.Separately, myopathy-associated mutations in desmin were reported in single, small families exhibiting autosomal recessive and autosomal dominant inheritance (29). The recessive patients were demonstrated to be compound heterozygotes for two different desmin point mutations (A360P and N393I). In the family with apparent autosomal dominant inheritance, two siblings with the mutation were affected with myopathy, and shared a desmin mutation (A337P). However, co-transmission of the myopathy along with the mutation could not be demonstrated because of small family size.
We report here an L345P desmin missense mutation in affected members of a large, six generation Ashkenazi Jewish family with a myopathy mapped by genetic linkage to human chromosome 2q33 (12,31). The symptomatic members of this family were affected in early to middle adulthood with distal leg weakness, progressing over 5-10 years to involve proximal, bulbar and facial muscles (12). Frequent cardiac involvement was present in the form of arrhythmias, conduction blocks and congestive failure. Histopathological findings included granulofilamentous deposits of desmin and the presence of autophagic vacuoles in skeletal muscle. Frequent signs of end-stage myopathic changes with fibrosis and replacement by fat cells were also observed. The L345P mutation occurs in segment 2B of the rod domain of desmin, where proline substitution would be predicted to disrupt helical packing essential for dimer formation. Further, in vitro transfection experiments demonstrated that this mutationdisrupts cytoskeletal formation in living cells, suggesting a dominant-negative mechanism as the basis of this HDM.
RESULTS
Clinical description of a patient with desmin-related myopathy
Detailed clinical descriptions of the desmin-related myopathy affecting members of this large, six generation Ashkenazi Jewish family have been previously reported (12). At present, 28 members over six generations have been affected by this myopathy. For this report, the index case is a 49-year-old female with an autosomal dominant distal myopathy with desmin inclusions and cardiac involvement. Her father was affected. She presents with a 15 year history of slowly progressive muscle weakness beginning in the lower extremities. Weakness in the left foot gradually spread to the right foot and to more proximal muscles resulting in frequent falls. Clinical examination revealed a waddling and steppage gait. There was decreased strength in the more proximal leg muscles and severe atrophy, more pronounced distally. In the upper extremities a slight muscle weakness and muscular atrophy was observed distally. Tendon reflexes were normal in the arms and absent in the legs. The sensory functions were normal and there was no myotonia. CK was mildly elevated, 350 IU/l (normal <150 IU/l). There were no cardiac symptoms and heart rate was normal.
Electrophysiological examination showed normal motor and sensory conduction velocities. On electromyography, fibrillations and short duration, low amplitude, motor unit potentials, compatible with a myopathic process, were evident in multiple muscles of upper and lower extremities. ECG was abnormal showing a first degree AV block, a right bundle branch block, ST segment elevations and inversion of T waves. Echocardiography was normal.
Muscle pathology of index case
A muscle biopsy of the left vastus lateralis muscle showed fibrosis and fatty interstitial infiltration (Fig. 1a and b). There was variation of muscle fiber sizes with hypertrophic and highly atrophic muscle fibers found scattered or in groups. There was an increased number of fibers with internal nuclei which were numerous in some hypertrophic fibers. Occasional fibers with rimmed vacuoles were seen (Fig. 1b). The fiber type differentiation and composition were normal according to myosin-ATPase staining. Immunohistochemical staining for the muscle IF proteins desmin, vimentin and nestin showed an excess of all three, with abnormal intracellular localization (Fig. 1c-e). Anti-desmin reactivity was intense in aggregates with a subsarcolemmal location, but was also seen as spotty inclusions throughout the sarcoplasm (Fig. 1c). Vimentin immunoreactivity was detected in some, but not all, of the desmin-containing inclusions (Fig. 1d). Nestin, more abundant than vimentin, also displayed a similar pattern as desmin (Fig. 1e). A normal subsarcolemmal staining of dystrophin was seen in most cells. However, in a few fibers there was an accumulation of dystrophin seen in the sarcoplasm (Fig. 1f).
Figure 1. Muscle biopsy from the index case. (a and b) Staining with H&E. Note the variation of fiber sizes, hypertrophic and atrophic muscle fibers, internal nuclei and an increased amount of fat and connective tissue (fibrosis). (b) In the centre there is a muscle fibre with a rimmed vacuole. Immunohistochemical stainings with (c) anti-desmin antibodies, (d) anti-vimentin antibodies and (e) anti-nestin antibodies demonstrating sarcoplasmic aggregates and spotty inclusions of IF proteins. (f) Immunohistochemical staining for dystrophin (NCL-Dys 2) shows a normal subsarcolemmal distribution. In addition, a sarcoplasmic dystrophin staining is present in some muscle fibers.
A desmin mutation in myopathic family members
Prompted by previous findings of mutations within the coiled-coil rod domain of keratins in epidermolysis bullosa simplex, exhibiting cytoplasmic accumulations of intermediate filaments similar to those found in desmin-related myopathies (32), we sequenced the region encoding the desmin rod domain of the index patient and patients V-24 and V-25. In all patients, DNA sequencing of the rod domain showed a previously unreported T->C transition at nucleotide 1034 (Fig. 2a; data not shown). This missense mutation leads to a leu->pro (L345P) amino acid exchange. To verify the mutation, and for further screening of family members, we constructed a mismatch primer that introduces a BclI restriction enzyme site in the PCR product of the wild-type allele. When this assay was performed on genomic DNA of the index patient, the restriction enzyme cleavage showed a pattern consistent with one mutated and one wild-type allele. Twenty-seven members of the family with myopathy were analyzed using the PCR-based method of introducing a restriction enzyme site in the wild-type allele. We found that all seven affected family members had a cleavage pattern consistent with a heterozygosity at the site of mutation (Fig. 2c). No mutations were found when evaluating 40 healthy unrelated Caucasians (80 chromosomes; 0.04 upper 95% confidence limit). The presence of a mutated allele in affected family members was further confirmed by SSCP analysis (Fig. 2d). The L345P mutation resides in the [alpha]-helical coiled-coil segment 2B of the central rod domain of desmin (Fig. 3).
Figure 2. Mutations in the desmin rod domain in patients with desmin-related myopathy. (a) DNA sequence (reverse strand) of the region of desmin exon 6 containing the codon 345 T->C mutation. Direct DNA sequencing of PCR-amplified genomic DNA from individuals IV-7 (W, wild-type) and V-25 (M, myopathy-affected). (b) Pedigree representing part of a large family with desmin-related myopathy. Affected members are represented by filled symbols, and unaffected by open symbols. (c) Detection of desmin mutation in affected family members. BclI restriction enzyme cleavage pattern of PCR products partially covering intron 5 and exon 6 of desmin. BclI identifies two alleles: wild-type (60 bp fragment) and mutant (70 bp fragment). All affected individuals (IV-2, V-20, V-23, V-24, V-25, V-28, IV-8) possess normal and mutated alleles. Sample numbers are identical to the positions in the pedigree. (d) SSCP analysis of desmin exon 6 for seven myopathy-affected (first 7 lanes) and seven control individuals. Sample numbers are identical to the positions in the pedigree. N, spouse of V-17 (not shown in pedigree). The top band (arrow) present in DNA samples from myopathy-affected individuals represents the band shift caused by the T->C mutation present in codon 345 of desmin. Alterations in the positions of other bands in affected person IV-8 and in unaffected control individuals result from an 1181A ->G polymorphism in codon 368 of desmin, previously reported by Vicart et al. (46). This polymorphism is silent for the amino acid alanine, and has been confirmed by direct DNA sequencing of PCR product (data not shown).
Figure 3. Location of the L345P mutation in relation to the secondary structure of the desmin rod domain. The segments 1A, 1B, 2A and 2B, constituting the [alpha]-helical rod domain, are boxed. Locations of mutations found in other desmin-related myopathies are denoted with arrows.
The L345P mutation affects IF assembly
The central rod domain of IFs consists of four [alpha]-helical segments, 1A, 1B, 2A and 2B, separated by three linkers, L1, L12 and L2. The [alpha]-helical domains are composed of heptad repeats of amino acids (`a-b-c-d-e-f-g'), where the `a' and `d' positions generally are apolar and conserved through evolution (33,34). Leu345 is located in a `d' position, and is extremely well conserved when different groups of cytoplasmic IFs are compared (Fig. 4). To analyze the functional significance of the L345P mutation we introduced a mutation causing this amino acid exchange in an eukaryotic expression vector containing the complete mouse desmin cDNA. Over the 2B segment 120 of 121 amino acids are identical between the human and mouse species. SW13 clone 2 cells contain no IFs and are therefore suitable for studies on IF assembly. When these cells were transiently transfected with the mutated desmin, no filaments were formed and immunofluorescent staining showed a speckled pattern (Fig. 5a). This pattern contrasts sharply to the filamentous pattern in SW13 cells transiently transfected with wild-type mouse desmin (Fig. 5b). In HeLa cells, which contain separate vimentin and keratin networks (35), transiently transfected wild-type desmin is incorporated into the vimentin IF network (Fig. 5c and d). The mutated desmin construct, however, does not incorporate into the pre-existing vimentin network, but in fact disrupts this network into speckles or tonofilaments (Fig. 5e and f).
Figure 4. Leu345 in desmin is well conserved through evolution. Comparison of amino acid composition of human desmin with consensus sequences of types I-VI IF proteins. The amino acid in all types of cytoplasmic IF protein is leucine at the position corresponding to leu345 in human desmin (boxed). This leucine occurs at position `d' in the heptad repeat, where `a' and `d' are generally apolar residues.
Figure 5. IF protein aggregates are formed in SW13 and HeLa cells transfected with L345P mutated desmin. SW13 cells (a and b) and HeLa cells (c-f) were transfected with L345PDes (a, e, f) or wtDes (b, c, d). Transiently expressing cells were fixed and stained with antibodies against desmin (a, b, d, f) or vimentin (c, e). Wild-type desmin forms filaments in SW13 cells (b) and co-assemble with vimentin in HeLa cells (c, d). Mutated desmin, however, is incapable of forming filaments in SW13 cells (a) and HeLa cells (f), and has a dominant-negative effect on the vimentin network in HeLa cells (e).
DISCUSSION
The desmin L345 missense mutation reported here occurs in affected members of a large, six generation Ashkenazi Jewish family with autosomal dominant inheritance of a myopathy characterized by granulofilamentous desmin inclusions and myopathic changes (12). Genetic linkage of this family to the segment of chromosome 2q containing the desmin gene has been reported (31). The L345P mutation occurs in all myopathy-affected family members while being absent in the 20 healthy family members included in this study and in 40 unrelated Caucasian individuals (80 chromosomes), strongly implicating the L345P desmin mutation as the etiological basis of this myopathy. This family is the first example in which genetic transmission of a desmin mutation is intimately associated with occurrence of an autosomal dominant desmin-related myopathy.
A total of five desmin mutations have now been detected in four different families, all with desmin-related myopathy and cardiac involvement (29,30; this report). Further, all these desmin mutations occur in the rod domain: one in segment 1B and the others in segment 2B (Fig. 3). Both dominant desmin mutations (A337P and L345P), as well as one of the recessive mutations (A360P), involve substitutions to proline. Proline is rarely found within the heptad core of the coiled-coil rod domain of IF proteins (33). It is a known disruptor of [alpha]-helical structure because it imposes severe stearic and hydrogen bonding constraints on [alpha]-helix formation, and in vitro mutagenesis has demonstrated a helix-perturbing effect of proline, resulting in aberrant filament formation (36,37). Proline normally never occurs in `a' and `d' positions in desmin or other type III IFs, whereas leucine is present in 70% of these positions (33). The L345P mutation occurs at a `d' position of the heptad substructure (`a-b-c-d-e-f-g') of the rod domain, where `a' and `d' usually are apolar residues forming an internal hydrophobic core of the coiled-coil structure (33). Leu345 of desmin is more highly conserved than `d' positions in general, and is found in the consensus sequence of all five types of cytoplasmic IF (Fig. 4), suggesting a functional significance for this particular leucine.
The specific type (conserved leucine to helix-breaking proline) and position (`d' of the heptad repeat, within the rod domain) of the L345P mutation suggested that the mutation might interfere with dimerization, thus affecting desmin filament formation. Our transfection data using L345P mutated desmin confirm that the mutation interferes with filament formation both in IF-free SW13 cells and in HeLa cells with a pre-existing vimentin IF network. In HeLa cells, expression of the L345P mutated desmin resulted in disruption of the vimentin IF network, suggesting a dominant-negative effect of L345P desmin on filament formation. The dominant-negative mechanism proposed here is consistent with the autosomal dominant inheritance pattern observed for this family'sdesmin-related myopathy. It is interesting that both dominant desmin mutations (L345P and A337P) in rod segment 2B are associated with similar clinical pictures, with onset of skeletal and cardiac myopathy in young adulthood.
Interesting parallels exist between the myopathies with desmin mutations, and the hereditary skin disorder epidermolysis bullosa simplex (EBS) caused by mutations in another IF protein, keratin (32). Both disorders are characterized by abnormal intracellular accumulation of IFs, and the mutations in the respective IF protein primarily affect the rod domain. In EBS, mutations within the highly conserved rod ends are associated with the most severe clinical phenotype (32), and with a more pronounced inhibitory effect on filament formation than mutations located more centrally in the rod domain (38). Mutations within segment 2B are instead correlated with an intermediate clinical phenotype, Köbner EBS, and with a retained ability to produce aberrant, short IF rod structures (32,36,38). The severe effect of the L345P mutation in our transfection experiments compared with those performed with mutations in similar regions in keratins (36,38), may be due to the fact that desmin forms homodimers while keratins are obligate heterodimers and therefore always have one non-mutated IF protein partner in the initiation of filament formation.
Until recently, there was doubt regarding the significance of desmin as a cause of the desmin-related myopathies, despite prominent subsarcolemmal deposits of desmin within muscle. For a span of almost 20 years, since the time of description of the first case of desmin-related myopathy in 1978 (8), no mutations in desmin were reported. Further, the observed alteration in levels of other cytoskeletal proteins in affected muscle added to the uncertainty regarding whether mutated desmin was the primary defect in these myopathies. Finally, three families with clinically identical autosomal dominant desminopathy were recently excluded from linkage to the desmin gene on chromosome 2q (27), indicating that genes other than desmin were the cause of these myopathies, perhaps in a majority of families. It was only with the report of the first desmin mutations associated with desmin-related myopathy (29,30) that a central involvement of desmin in the myopathies was newly appreciated. Indeed, the discovery of a mutation in the [alpha]B-crystallin gene (28), whose product is a molecular chaperone orchestrating the proper folding of desmin, underscores the central importance of desmin as the basis underlying most desmin-related myopathies. The results presented here are the first thorough demonstration of the hereditary nature of a desmin mutation in a large family segregating a desmin-related myopathy, and serve to confirm and extend the primary nature of desmin defects as a basis of these myopathies.
MATERIALS AND METHODS
Muscle biopsy analysis
A skeletal muscle biopsy was obtained from the vastus lateralis muscle with a percutaneous conchotome method (39). The biopsy was allowed to relax, and was after a few minutes frozen in liquid Freon13, kept at its melting point (-190°C) by liquid nitrogen. Biopsy material was stored at -75°C until further processed. Sections of the muscle biopsy were cut in a cryostat operating at -25°C and dessicated for 1-2 h followed by a 30 min incubation with 3% bovine serum albumin in phosphate-buffered saline (PBS) and stained with hematoxylin and eosin (H&E). Adjacent sections were stained with mouse monoclonal anti-desmin antibodies (DE-B-5; Roche Diagnostics, Bromma, Sweden) diluted 1:200 in PBS, mouse monoclonal anti-vimentin antibodies (Vim 3B4; Roche Diagnostics) diluted 1:50 in PBS, or rabbit anti-nestin antiserum no. 130 diluted 1:1000 in PBS. Separate sections were also stained with antibodies against dystrophin (NCL-Dys 2 and NCL-Dys 3; Novacastra Laboratories, Newcastle, UK), diluted 1:200 and 1:20, respectively, in PBS. The immunostainings were visualized by use of avidin and horseradish peroxidase (Dako, Glostrup, Denmark).
DNA analysis
For sequence analysis total RNA was extracted from a muscle biopsy specimen from the index patient and converted to DNA using reverse transcriptase. PCR was performed using the primers HDesL1 (TGGACTTCTCACTGGCCGAC) and HDesR1 (GGAAGTTGAGGGCAGAGTAGGTCT) which cover the com-plete rod domain of the desmin cDNA. The PCR product was inserted into a TA-vector (Invitrogen, Leek, The Netherlands) and sequenced using M13 primers and five desmin-specific primers. Analyses of genomic DNA from the patient and normal controls were performed on whole blood. DNA was extracted from the blood cells using the QiAmp kit (Qiagen, Hilden, Germany) and 60-300 ng were used as templates in the following PCR reaction. To detect the mutation, a part of intron 5 and exon 6 was amplified using as forward primer 5[prime]-CTGCTAGTGTCCTCTTCCCTT-3[prime] and as reverse primer 5[prime]-AATTCCCGCATCTGCCTGATC-3[prime] that includes a mis-match nucleotide (shown in bold). By making this base alteration, an artificial BclI restriction enzyme site (TGATCA) is introduced in the PCR product of wild-type desmin, but not in the mutated desmin. The restriction enzyme fragments were analyzed on a 4% agarose gel (NuSieve; FMC, Rockland, ME). Sequence analysis of the nucleotide sequence encoding the rod domain of wild-type desmin revealed an additional alanine residue between ala134 and leu135 compared with the first reported sequence in GenBank (accession no. M58168). We have therefore in this report used the numbering of the corrected amino acid sequence recently reported by Goldfarb et al. (29) (GenBank accession no. AF055081).
Site-directed mutagenesis
To make a leu->pro codon change in the desmin gene for the transfection studies, we used a mutated oligonucleotide for site-directed mutagenesis into a pBK-RSV vector (Stratagene, La Jolla, CA) containing the mouse desmin cDNA (kindly provided by Dr Wallace Ip, University of Cincinnati, OH). The oligonucleotide 3[prime]-CCAACGACTCCCCCATGAGGCAG-5[prime] both introduces the trinucleotide codon for proline (underlined) and a new NlaIII site (CATG) for selection (mismatches in bold). The inserted mutation was verified by DNA sequence analysis.
Cell culture and DNA transfection
The SW13 cell line is derived from a human adrenal cortex carcinoma. SW13 clone 2, a kind gift of Robert M. Evans (University of Colorado, CO), is subcloned to contain essentially no cytoplasmic IFs (40). Cells were grown in a medium containing equal volumes of Dulbecco's modified Eagle's medium (DMEM) and Ham's F12 supplemented with 5% fetal calf serum (Gibco BRL, Paisley, UK) and 50 µg/ml of Gentamicin (Gibco BRL). For transfection 0.5 × 106 cells were plated in a 63 cm2 dish and grown overnight. DNA transfection was carried out using the calcium phosphate co-precipitation method (41). The expression vector (10 µg) was added to each cell dish and incubated overnight.
Immunofluorescent staining
The cells grown on coverslips were fixed for 10 min with 4% paraformaldehyde in PBS, permeabilized with 0.5% Triton X-100 in PBS for 5 min, rinsed three times in PBS and incubated for 30 min with 3% bovine serum albumin in PBS, and subsequently incubated for 2 h at room temperature with a mouse monoclonal anti-desmin antibody D33 (Dako) diluted 1:200. For the double staining the cells were incubated for 2 h with polyclonal anti-desmin (Dako) followed by 2 h incubation with mouse monoclonal anti-vimentin Vim3B4 (Roche Diagnostics) diluted 1:20. TRITC-rabbit anti-mouse antibodies were used as secondary antibodies for the single stainings and TRITC-swine anti-rabbit and FITC-rabbit anti-mouse (Dako) antibodies, all diluted 1:50, were used for the double stainings (incubation time 1 h). To block `sticky ends' of the conjugated anti-rabbit antibody in the double immunofluorescence studies, the cells were incubated in rabbit sera diluted 1:10 for 1 h before applying the second primary antibody. Coverslips were mounted in fluorescent mounting medium (Dako). The specificity of the double immune staining has been described previously (42).
ACKNOWLEDGEMENTS
We thank the family members for their help with this study, Mrs Gabriella Dombos for excellent technical assistance, and Martin Werme for initial work on this project. We also thank Drs Urban Lendahl and Lennart Philipsson for critical reading of our manuscript. This work was supported by the Swedish Medical Research Council, Ronald McDonald Barnfond, the Swedish Society of Medicine, Clas Groschinskys minnesfond, Wera Ekströms Stiftelse and Stiftelsen Samariten, and by a grant from the Muscular Dystrophy Association (MDA), USA (D.R.R., S.H.H. and C.S.-M.).
NOTE ADDED IN PROOF
While the present manuscript was in proof, an I451M desmin mutation was reported by Li et al. in a family with dilated cardiomyopathy without skeletal muscle abnormalities (Circulation, 100, 461-464).
REFERENCES
+To whom correspondence should be addressed. Tel: +46 8 7287328; Fax: +46 8 348135; Email: thomas.sejersen{at}cmb.ki.se
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  J. Davis, M. V. Westfall, D. Townsend, M. Blankinship, T. J. Herron, G. Guerrero-Serna, W. Wang, E. Devaney, and J. M. Metzger Designing Heart Performance by Gene Transfer Physiol Rev, October 1, 2008; 88(4): 1567 - 1651. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. N. Dahl, A. J.S. Ribeiro, and J. Lammerding Nuclear Shape, Mechanics, and Mechanotransduction Circ. Res., June 6, 2008; 102(11): 1307 - 1318. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. Kley, Y. Hellenbroich, P. F. M. van der Ven, D. O. Furst, A. Huebner, V. Bruchertseifer, S. A. Peters, C. M. Heyer, J. Kirschner, R. Schroder, et al. Clinical and morphological phenotype of the filamin myopathy: a study of 31 German patients Brain, December 1, 2007; 130(12): 3250 - 3264. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Stone, A. O'Neill, R. M. Lovering, J. Strong, W. G. Resneck, P. W. Reed, D. M. Toivola, J. A. Ursitti, M. B. Omary, and R. J. Bloch Absence of keratin 19 in mice causes skeletal myopathy with mitochondrial and sarcolemmal reorganization J. Cell Sci., November 15, 2007; 120(22): 3999 - 4008. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Wallgren-Pettersson, V.-L. Lehtokari, H. Kalimo, A. Paetau, E. Nuutinen, P. Hackman, C. Sewry, K. Pelin, and B. Udd Distal myopathy caused by homozygous missense mutations in the nebulin gene Brain, June 1, 2007; 130(6): 1465 - 1476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Walter, P. Reilich, A. Huebner, D. Fischer, R. Schroder, M. Vorgerd, W. Kress, C. Born, B. G. Schoser, K. H. Krause, et al. Scapuloperoneal syndrome type Kaeser and a wide phenotypic spectrum of adult-onset, dominant myopathies are associated with the desmin mutation R350P Brain, June 1, 2007; 130(6): 1485 - 1496. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R.G. Taylor, D. Slavov, L. Ku, A. Di Lenarda, G. Sinagra, E. Carniel, K. Haubold, M. M. Boucek, D. Ferguson, S. L. Graw, et al. Prevalence of Desmin Mutations in Dilated Cardiomyopathy Circulation, March 13, 2007; 115(10): 1244 - 1251. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Arbustini, M. Pasotti, A. Pilotto, C. Pellegrini, M. Grasso, S. Previtali, A. Repetto, O. Bellini, G. Azan, M. Scaffino, et al. Desmin accumulation restrictive cardiomyopathy and atrioventricular block associated with desmin gene defects Eur J Heart Fail, August 1, 2006; 8(5): 477 - 483. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Gard, K. Yamada, K. G. Green, B. C. Eloff, D. S. Rosenbaum, X. Wang, J. Robbins, R. B. Schuessler, K. A. Yamada, and J. E. Saffitz Remodeling of gap junctions and slow conduction in a mouse model of desmin-related cardiomyopathy Cardiovasc Res, August 15, 2005; 67(3): 539 - 547. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Bar, D. Fischer, B. Goudeau, R. A. Kley, C. S. Clemen, P. Vicart, H. Herrmann, M. Vorgerd, and R. Schroder Pathogenic effects of a novel heterozygous R350P desmin mutation on the assembly of desmin intermediate filaments in vivo and in vitro Hum. Mol. Genet., May 15, 2005; 14(10): 1251 - 1260. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Sanbe, H. Osinska, J. E. Saffitz, C. G. Glabe, R. Kayed, A. Maloyan, and J. Robbins Desmin-related cardiomyopathy in transgenic mice: A cardiac amyloidosis PNAS, July 6, 2004; 101(27): 10132 - 10136. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Vattemi, P. Tonin, M. Mora, M. Filosto, L. Morandi, C. Savio, I. Dal Pra, N. Rizzuto, and G. Tomelleri Expression of protein kinase C isoforms and interleukin-1{beta} in myofibrillar myopathy Neurology, May 25, 2004; 62(10): 1778 - 1782. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Selcen and A. G. Engel Mutations in myotilin cause myofibrillar myopathy Neurology, April 27, 2004; 62(8): 1363 - 1371. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. G. Goldfarb, P. Vicart, H. H. Goebel, and M. C. Dalakas Desmin myopathy Brain, April 1, 2004; 127(4): 723 - 734. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Selcen, K. Ohno, and A. G. Engel Myofibrillar myopathy: clinical, morphological and genetic studies in 63 patients Brain, February 1, 2004; 127(2): 439 - 451. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Schroder, B. Goudeau, M. C. Simon, D. Fischer, T. Eggermann, C. S. Clemen, Z. Li, J. Reimann, Z. Xue, S. Rudnik-Schoneborn, et al. On noxious desmin: functional effects of a novel heterozygous desmin insertion mutation on the extrasarcomeric desmin cytoskeleton and mitochondria Hum. Mol. Genet., March 15, 2003; 12(6): 657 - 669. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Mavroidis and Y. Capetanaki Extensive Induction of Important Mediators of Fibrosis and Dystrophic Calcification in Desmin-Deficient Cardiomyopathy Am. J. Pathol., March 1, 2002; 160(3): 943 - 952. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Blair, C. Redwood, M. de Jesus Oliveira, J.C. Moolman-Smook, P. Brink, V.A. Corfield, I. Ostman-Smith, and H. Watkins Mutations of the Light Meromyosin Domain of the {beta}-Myosin Heavy Chain Rod in Hypertrophic Cardiomyopathy Circ. Res., February 22, 2002; 90(3): 263 - 269. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Miyamoto, H. Akita, N. Shiga, E. Takai, C. Iwai, K. Mizutani, H. Kawai, A. Takarada, and M. Yokoyama Frequency and clinical characteristics of dilated cardiomyopathy caused by desmin gene mutation in a Japanese population Eur. Heart J., December 2, 2001; 22(24): 2284 - 2289. [Abstract] [PDF]
|
|
|
|
|
|
X. Wang, H. Osinska, G. W. Dorn II, M. Nieman, J. N. Lorenz, A. M. Gerdes, S. Witt, T. Kimball, J. Gulick, and J. Robbins Mouse Model of Desmin-Related Cardiomyopathy Circulation, May 15, 2001; 103(19): 2402 - 2407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Schweitzer, M. Klymkowsky, R. Bellin, R. Robson, Y Capetanaki, and R. Evans Paranemin and the organization of desmin filament networks J. Cell Sci., January 3, 2001; 114(6): 1079 - 1089. [Abstract] [PDF]
|
|
|
|
 |
|
 K.-Y. Park, M. C Dalakas, H. H Goebel, V. J Ferrans, C. Semino-Mora, S. Litvak, K. Takeda, and L. G Goldfarb Desmin splice variants causing cardiac and skeletal myopathy J. Med. Genet., November 1, 2000; 37(11): 851 - 857. [Abstract] [Full Text]
|
|
|
|
|
|
M. Sugawara, K. Kato, M. Komatsu, C. Wada, K. Kawamura, S. Shindo, N. Yoshioka, K. Tanaka, S. Watanabe, and I. Toyoshima A novel de novo mutation in the desmin gene causes desmin myopathy with toxic aggregates Neurology, October 10, 2000; 55(7): 986 - 990. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Dalakas, K.-Y. Park, C. Semino-Mora, H. S. Lee, K. Sivakumar, and L. G. Goldfarb Desmin Myopathy, a Skeletal Myopathy with Cardiomyopathy Caused by Mutations in the Desmin Gene N. Engl. J. Med., March 16, 2000; 342(11): 770 - 780. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Blair, C. Redwood, M. de Jesus Oliveira, J.C. Moolman-Smook, P. Brink, V.A. Corfield, I. Ostman-Smith, and H. Watkins Mutations of the Light Meromyosin Domain of the {beta}-Myosin Heavy Chain Rod in Hypertrophic Cardiomyopathy Circ. Res., February 22, 2002; 90(3): 263 - 269. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||