| Human Molecular Genetics | Pages |
©1999 Oxford University Press |
Molecular phenotype of the np 7472 deafness-associated mitochondrial mutation in osteosarcoma cell cybrids
Introduction
Results
The np 7472 mutation acts synergistically with mtDNA copy number
The np 7472 mutation results in at most a mild impairment of mitochondrial protein synthesis
The np 7472 mutation affects tRNASer(UCN) abundance but not ND6 mRNA processing
Discussion
Interaction between mtDNA genotype and copy number
The pathogenic mechanism of action of the np 7472 mutation
Common features of the molecular phenotype of mitochondrial tRNASer deafness mutations
Materials And Methods
Cells and cell culture
Oligonucleotides and plasmids
DNA extraction
Southern blot hybridization
RNA analysis by northern blots and acidic polyacrylamide gel electrophoresis
Metabolic labelling of seryl-tRNA
Analysis of mitochondrial translation products by SDS-PAGE
Acknowledgements
References
Molecular phenotype of the np 7472 deafness-associated mitochondrial mutation in osteosarcoma cell cybrids
Received July 12, 1999; Revised and Accepted September 1, 1999
The nucleotide pair (np) 7472 insC mitochondrial DNA mutation in the tRNASer(UCN) gene is associated with sensorineural deafness, combined in some individuals with a wider syndrome including ataxia and myo-clonus. Previous studies in osteosarcoma cell cybrids revealed only a mild respiratory defect linked to the mutation. We have investigated the biochemical and molecular consequences of the mutation, using a panel of seven osteosarcoma cell cybrids containing 100% mutant mtDNA, plus two cybrids carrying 100% wild-type mtDNA from the same patient. The mutation is associated with a mild growth deficit in selective (galactose) medium that is only significant in com-bination with a reduced mtDNA copy number, suggesting a mechanism that might modulate clinical phenotype. The mutation results in a 65% drop in the steady-state level of tRNASer(UCN), but causes at most only a very mild and quantitative abnormality of mito-chondrial protein synthesis, associated with modest hypersensitivity to doxycyclin. No evidence for a specific defect in aminoacylation was obtained, and unlike the case with the np 7445 mutation, the pattern of RNA processing of light strand transcripts of the ND6 region was not systematically altered. Comparing the np 7472 and np 7445 mutant phenotypes in cultured cells suggests that sensorineural deafness can result from a functional insufficiency of mitochondrial tRNASer(UCN), to which some cells of the auditory system are especially vulnerable.
INTRODUCTION
Mitochondrial DNA mutations are associated with an increasing spectrum of human disorders, including both syndromic and non-syndromic forms of sensorineural deafness. Two different mutations affecting the gene for tRNASer(UCN) have been found in multiple families showing deafness as a primary pathological feature (1-7). The mutation at nucleotide pair (np) 7445, an A->G substitution on the heavy strand, maps 1 np beyond the 3[prime]-end of the tRNA (8,9) and is associated with a novel syndrome of sensorineural deafness and palmoplantar keratoderma (4). The latter feature was overlooked in original reports of the mutation (2,3), but is evident in most affected members of the two best-studied pedigrees, from New Zealand (4) and Scotland (G.A. Vernham and H.T. Jacobs, unpublished data), as well as in a Japanese family with the mutation (4). The np 7472 mutation, insertion of an extra C into a run of six C residues located within the T-arm of the tRNA (5), is associated with a syndromic disorder that includes hearing loss, ataxia and myoclonus. However, most individuals in np 7472 families, even with very high levels of mutant mtDNA, suffer only from deafness, with other neurological features appearing only with late onset (7), if at all (6). The np 7472 mutation has also been found in individuals with cytochrome c oxidase deficiency (10). One other mito-chondrial mutation in tRNASer(UCN), a T->C substitution at np 7512, has been reported in association with a rather similar syndromic disorder (10), and mutations in two adjacent nucleotides, np 7511 (11) and np 7510 (T.P. Hutchin, personal communication) are found in families with isolated hearing loss. A further tRNASer(UCN) point mutation at np 7419 is associated with mitochondrial myopathy and combined complex I/complex IV deficiency (10), but myopathy has been reported only rarely in np 7472 patients (12). Many individuals with either the np 7445 or np 7472 mutations are homoplasmic, or nearly so, indicating a high threshold for pathogenicity in both cases (5,10,13), and this is also true for the mutation at np 7511 (11).
The clinical expression of both the np 7472 and np 7445 mutations seems to vary between families and individuals. For example, all but one out of 27 members of a Dutch family with the np 7472 mutation exhibit only deafness (10), whereas other neurological signs were detected in six out of nine affected individuals in the original Sicilian pedigree in which the mutation was described (5). Similarly, most members of the New Zealand np 7445 family have a moderate to severe hearing impairment, whereas in the Scottish family most affected individuals show only mild hearing loss and many are asymptomatic. The many other polymorphisms that distinguish the mtDNAs of these two families (1,3) may account for this phenotypic difference, although other explanations (nuclear genes, environmental factors or epigenetic effects) could also be invoked.
Understanding the molecular pathogenic mechanisms associated with mtDNA mutations is a vital step towards predicting the course of disease and designing eventual therapeutic or preventative strategies. Cells carrying either of the deafness-associated tRNASer(UCN) mutations (np 7445 or 7472) show only a mild biochemical phenotype that has not been easy to demonstrate. In the case of np 7445, lymphoblastoid cells homoplasmic for the mutation showed only a modest growth deficit on selective (galactose) medium (8,9) and mitochondrial respiratory enzyme activities were not significantly different from those in control cells (8,14). Osteosarcoma cell cybrids with 100% np 7472 mutant mtDNA showed only a small decrease in mitochondrial respiratory enzyme activities compared with control cybrids containing only wild-type mtDNA from the same patient (5).
Molecular genetic analysis of cells with the np 7445 mutation has proven more fruitful, revealing some interesting differences between cells from the more severely affected (New Zealand) and mildly affected (Scottish) pedigrees. [35S]methionine labelling in the presence of emetine showed a clear deficiency of mito-chondrial protein synthesis in mutant cells from the New Zealand family, with an abnormal ratio of translation products and specific depletion of ND6 (9). Mitochondrial protein synthesis in mutant cells from the Scottish family, assayed by the same method, was normal (8). In both cases, a drop of 60-70% in the steady-state level of tRNASer(UCN) was detected, but the structure of the tRNA was unaffected. This implies a drop in the efficiency of light (L)-strand RNA processing consequent upon the mutation, which is supported by studies in the New Zealand family-derived cells that showed a concomitant drop in the level of ND6 mRNA (9), which is also encoded on the light strand. The difference in phenotypic severity (clinical, biochemical and biosynthetic) suggests that other factors, whether nuclear background or mtDNA haplotype or both, affect the ability of the mitochondrial translation system to tolerate a drop in tRNASer(UCN) and ND6 mRNA levels. What remains unknown is the relative contribution to the clinical phenotype of the drop in the levels of these two RNAs.
In an attempt to answer this question, we have carried out a detailed molecular analysis of the np 7472 phenotype in osteosarcoma cell cybrids. This reveals a similar drop in tRNASer(UCN) levels as was seen in np 7445 mutant cells, but only a marginal and quantitative impairment of mitochondrial protein synthesis and no evidence of any systematic change in the efficiency of processing of light strand transcripts from the ND6 region. The findings strongly suggest that the drop in tRNASer(UCN) abundance, common to the two mutations, is the primary determinant of the common clinical phenotype, sensorineural deafness. In addition, we found that the severity of the biochemical phenotype was subtly influenced by mtDNA copy number, indicating a mechanism that might potentially modulate expression of the clinical phenotype.
RESULTS
A panel of osteosarcoma cell cybrids containing 100% mutant mtDNA from a heteroplasmic np 7472 patient (5) were studied in comparison with two control cybrids containing only wild-type mtDNA from the same patient. The cell lines had previously been genotyped by a sensitive PCR method (5), but were re-checked by direct DNA sequencing. This revealed that one mutant clone (designated clone 38) was in fact heteroplasmic at the ~15% level for an additional 1 bp (C) insertion into the C tract at np 7472. This was confirmed by sequencing of cloned PCR products, four out of 19 clones showing eight consecutive GC pairs at np 7472. It is not clear when this additional mutation occurred, but most probably it arose in cell culture, since it was not detected in any other clone nor was it seen in DNA from the patient. Based on direct sequencing, the heteroplasmy level of a panel of 18 subclones of clone 38 was estimated to be narrowly distributed within the range 10-20%, apart from one subclone that did not contain detectable levels of the novel variant. The other mutant clones all appeared to be 100% mutant (clones 14, 30, 31, 32, 33 and 47) or 100% wild-type (clones 34 and 43), as expected.
The np 7472 mutation acts synergistically with mtDNA copy number
The cell clones were initially tested for growth in Gal medium, in which glucose is replaced by galactose. Cells that are severely crippled in respiratory metabolism are unable to grow on this medium or die. The mutant clones generally showed a mild growth impairment on this medium (Fig. 1), but this was not statistically significant for most of the clones, despite the fact that the assay was repeated many times. Small differences such as plating density or the state of the cells prior to passage can influence the overall growth rate and also the growth disadvantage (if any) on galactose, even for wild-type cells. However, one mutant clone, clone 47, was reproducibly growth retarded on galactose medium to a significant extent, and the result for clone 38 was also close to significance (Fig. 1a). The variation between clones could have many explanations, but we initially tested the simplest idea, that it was related to mtDNA copy number. Relative copy number was estimated by Southern co-hybridization to probes for (18S) rDNA and a portion of mtDNA (ND1), with data arbitrarily normalized to the signal ratio seen for one of the control cybrids, clone 34 (Fig. 1b and c). This confirmed that of the mutant clones, copy number was indeed lowest for clone 47. However, reduced copy number alone is unlikely to be the explanation for the growth impairment of clone 47 on galactose medium, since control cybrid clone 43, which grew well on galactose, also had a low mtDNA copy number. Note that there is no evidence for any effect on copy number of the mutation itself: the range of relative copy number values seen in the mutant cybrids was similar to that of controls.
Figure 1. Growth of np 7472 cybrid clones on galactose medium and mtDNA copy number. (a) Doubling times were calculated on glucose- and galactose-containing medium for each cell clone (at least four replicate measurements for each clone, 9 or 10 measurements for clones 34, 14 and 47). The ratio of relative growth rates is plotted as a bar chart, shaded bars indicating data for the control cybrid clones 34 and 43. For mutant cybrid clone 33 insufficient data were obtained during parallel growth experiments on the two media to warrant inclusion in the chart. However, in separate experiments its growth impairment on galactose appeared to be in the same range as the other mutant cybrids tested. (b) Relative copy numbers of mitochondrial and nuclear DNA, plotted for each clone relative to control clone 34, which was included as a standard in every measurement. Measurements were made on replicate DNA samples and a minimum of three Southern blots for each cell clone. (c) Southern blot data for clones 34 (control), 14 (highest copy number) and 47 (lowest copy number) in a representative experiment.
The above result suggests that clone 47 has a mild defect in respiratory metabolism. We investigated whether we could detect any abnormality in the assembly state or activity of the mito-chondrial respiratory enzyme complexes that correlated with the growth defect on galactose medium. Two-dimensional (BNE-SDS) polyacrylamide gel electrophoresis revealed no consistent abnormality in clone 47 nor in any other of the mutant cybrid clones (data not shown).
The np 7472 mutation results in at most a mild impairment of mitochondrial protein synthesis
The above results suggest that mitochondrial protein synthesis may be impaired by a combination of low mtDNA copy number and the np 7472 mutation. We studied the pattern of mitochondrial translation products synthesized when cells were pulse labelled with [35S]methionine in the presence of emetine to suppress cytosolic protein synthesis. All mutant cybrid clones showed a pattern of mitochondrial translation products indistinguishable from that synthesized by control cybrids (Fig. 2a). In general, mitochondrial translation was very slightly decreased compared with control clones, except in the case of clones 14 and 32, which were also clones with high relative mtDNA copy numbers (Fig. 1b). The quantitative decrease in mitochondrial protein synthesis, although very small, was reproducible. The effect was revealed more strongly in the presence of doxycyclin, an inhibitor of mitochondrial translational elongation. At doses that had only a mild effect on control cybrid clone 34, doxycyclin treatment caused a more marked reduction in mitochondrial translation in clone 47 (Fig. 2b). However, this effect may be due in part to lower copy number.
Figure 2. Mitochondrial translation products in np 7472 cybrid clones. (a) [35S]methionine-labelled translation products synthesized in the presence of emetine in the various cybrid clones. Synthesis in mutant cybrids was marginally but reproducibly lower than for control cybrids 34 and 43 (underlined), although the patterns of products were indistinguishable. (b) Clone 47 also shows a slightly increased sensitivity to doxycyclin at 200 µg/ml. This high concentration was required to show any effect in control cybrids, probably reflecting multidrug resistance in this cell background. The quantitative reduction in mutant clone 47 compared with control clone 34 was reproducible. Parallel tracks from the same gel, incubated without emetine but with or without doxycyclin (data not shown), were indistinguishable for the two clones, indicating that the mutant clone is specifically impaired in mitochondrial protein synthesis.
The np 7472 mutation affects tRNASer(UCN) abundance but not ND6 mRNA processing
The effects of the np 7445 mutation on mitochondrial protein synthesis are associated with a drop in the steady-state level of tRNASer(UCN). We therefore investigated whether the np 7472 mutation also promotes a drop in the level of this tRNA compared with mitochondrial and non-mitochondrial reference transcripts. As shown in Figure 3, this is indeed the case. Two different oligonucleotides designed to detect tRNASer(UCN) gave identical results (Fig. 3b). The steady-state level of tRNASer(UCN) in all but one of the mutant cybrid clones was ~35% of that in control cybrids. The single exception was clone 14, where the decrease in tRNASer(UCN) was consistently more modest (~55% of control cybrid level). The quantitative depletion of tRNASer(UCN) was highly reproducible and also similar whether judged against a cytosolic mRNA (G3PDH), a mitochondrial mRNA (ND1) or another mitochondrial tRNA, tRNALeu(UUR). ND1 mRNA was only ~10% elevated in the clone with highest relative mtDNA copy number (clone 14) and 10% decreased in the clone with the lowest copy number, clone 47 (Fig. 3d), hence normalization to either gave essentially similar results.
Figure 3. Northern blot analysis of tRNASer(UCN) representation in np 7472 cybrids. (a) A representative northern blot for clones 34 (control), 14 (highest copy number) and 47 (lowest copy number), probed with oligonucleotide ser-12 (bottom), then stripped and rehybridized with a PCR-derived probe for ND1 and the adjacent tRNALeu(UUR) (top). (b) Northern blot probed consecutively with two different oligonucleotides for tRNASer(UCN). (c) Northern blot signals, normalized to that for control clone 34, which was included as a standard in every gel. Control cybrids 34 and 43 are shown as shaded bars. For clones 34, 14 and 47, the signals for tRNASer(UCN) were first normalized to those for ND1 mRNA, based on a minimum of three experiments. For the remaining clones, averaged data from only two experiments are plotted (hence without error bars). To improve accuracy for these data points, the values are the means of those normalized against ND1 and G3PDH mRNAs for each clone. (d) Ratio of northern blot signals for mitochondrial ND1 mRNA and nuclear coded G3PDH mRNA, normalized to the value for control clone 34 and for mutant clones 14 (highest mtDNA copy number) and 47 (lowest mtDNA copy number). Values plotted are averages of two different experiments.
The effect of the np 7445 mutation on tRNASer(UCN) is associated with a drop in the level of ND6 mRNA that has been suggested to result from a common RNA processing defect, consequent on the mutation. We therefore investigated whether the structure or abundance of light strand transcripts from the ND6 region were abnormal in np 7472 mutant cybrid clones. No such systematic effect was detected (Fig. 4), although clone 14, which had a relatively high level of tRNASer(UCN) compared with other mutant cybrid clones, also showed an altered pattern of transcripts from the ND6 region, with the 1.3 kb transcript proposed elsewhere (9,15) to be the ND6 mRNA strongly induced in this cell clone. Relative to the ND1 mRNA loading control, the other major ND6 transcript of ~2 kb was at similar abundance in all mutant and wild-type cybrid clones, except perhaps for clone 14, where it seemed slightly reduced in level.
Figure 4. Transcripts of the ND6 region, in np 7472 cybrid clones. The northern blot was probed exactly as described previously for np 7445 mutant cells (9), using a strand-specific riboprobe for ND6 (top). The pattern in mutant cybrids was not systematically different from that in control cybrids 34 and 43 (underlined). The position of the putative ND6 mRNA and of the prominent transcripts of 2 and ~4 kb (RNA 3) are arrowed. Sizes were estimated, based on reprobing for ND1 (1.1 kb, also revealing the precursor transcript RNA 19, of 2.6 kb) and G3PDH (1.4 kb). The lower panels show the same blot reprobed for ND1, as a loading control. The right-hand panels show a longer but comparable exposure for clones 38 and 43, which were underloaded relative to the other samples.
In the case of two other pathological mtDNA mutations in tRNA genes, at np 3243 and 8344, a specific interference with tRNA aminoacylation has been found, and this is correlated with reduced steady-state levels of the affected tRNA. Whilst this cannot apply in the case of the np 7445 mutation, the np 7472 mutation might act in this manner. We attempted to analyse this question by means of acidic polyacrylamide gel electrophoresis, a method that resolves aminoacylated and non-acylated tRNAs. Under conditions where the aminoacylated and deacylated forms of mitochondrial tRNALys and even tRNALeu(UUR) were well separated, we could not reliably separate the aminoacylated and deacylated forms of mitochondrial tRNASer(UCN). Many different gel systems were tested, with acrylamide concentrations ranging from 6.5 to 20% and urea varied from 0 to 7 M (Fig. 5a and data not shown). After northern hybridization to oligo-nucleotide probes for mitochondrial tRNASer(UCN) no reliable separation was observed in any case nor was any difference seen in the migration properties of the tRNA from control or mutant cybrid clones (Fig. 5b).
Figure 5. Analysis of tRNASer(UCN) aminoacylation in np 7472 cybrids by acidic polyacrylamide gel electrophoresis. (a) Representative northern blots of RNA from control clone 34, using various gel conditions, probed successively with oligonucleotides for mitochondrial tRNASer(UCN) and tRNALeu(UUR). Many different permutations of acrylamide and urea concentration were tested, including 12% acrylamide-no urea and 8% acrylamide-7 M urea (not shown), in addition to those shown. No gel system tested gave a reliable separation between the acylated (denoted a) and deacylated (denoted d) forms of tRNASer(UCN), although separation was clearly seen in the same RNA samples for acylated and deacylated tRNALeu(UUR). (b) Representative northern blot of RNA from control cybrid clone 34 and mutant cybrid clones 14 and 47, run on an acidic 12% polyacrylamide gel without urea and probed for tRNASer(UCN). No differences were seen in the mobility of the tRNA in these or any other cybrids (all were tested; not shown). (c) Acidic 12% polyacrylamide gel (no urea) of RNA from control cybrid 43 and mutant cybrid 47, labelled with [14C]serine, dried and autoradiographed. As expected, deacylation (denoted d) completely eliminated the signal seen in the acylated RNA (denoted a). In other, similar gels (not shown), parallel gel strips of unlabelled RNA were probed with oligonucleotides for mitochondrial tRNASer(UCN) and tRNASer(AGY) and cytosolic tRNASer(UCH), the product of the HSTRNS1 gene (16). These co-migrated, as shown, with the 14C-labelled bands.
To circumvent this problem, we pulse-labelled cells with [14C]serine and used acidic polyacrylamide gel electrophoresis to fractionate the products. This revealed several bands representing acylated tRNASer, one of which was clearly at lower relative abundance in clone 47 than in control cybrid clone 43 (Fig. 5c). This was expected for tRNASer(UCN), given the previous northern hybridization data (Fig. 4). Careful alignment of dried gels and parallel northern blots (data not shown) confirmed that this band co-migrated with mitochondrial tRNASer(UCN). However, at least one cytosolic seryl-tRNA (encoded by the gene HSTRNS1 and predicted to read codon group UCH; 16) also co-migrated on this gel system with this band. Hence it is not possible to conclude definitively that the mutant tRNA is efficiently aminoacylated. However, from the relative northern hybridization signals seen with each of two oligonucleotide probes for mitochondrial tRNASer(UCN) and with two others for cytosolic tRNASer(UCH) we infer that the two tRNAs are at roughly comparable abundance in total RNA and hence probably contribute equally to the most prominent band labelled by [14C]serine in Figure 5c. This would mean that at least some, and probably all, of the mitochondrial tRNASer(UCN) is amino-acylated in the mutant cells. We cannot, however, exclude the possibility that yet another cytosolic tRNASer might also co-migrate with this band. Other gel systems (e.g. 20% poly-acrylamide without urea) improved the separation between the mitochondrial and cytosolic tRNAs, but the resulting signal for [14C]serine-labelled mitochondrial tRNASer(UCN) was too weak to permit a meaningful quantitation.
DISCUSSION
Interaction between mtDNA genotype and copy number
The biochemical phenotype of the np 7472 mutation in osteosarcoma cell cybrids was already known to be very mild (5). In support of this, we found that the mutation has little effect on cell growth in galactose medium, which should be a sensitive test of mitochondrial impairment. The only mutant clone that was significantly growth impaired on galactose (clone 47) was also the cybrid with the lowest relative mtDNA copy number. The cybrid clone with the next lowest mtDNA copy number (clone 38) was also growth impaired on galactose medium, but at the limit of significance. Clone 38 was additionally heteroplasmic for an additional C insertion at np 7472, complicating the interpretation. It seems reasonable to conclude that mtDNA copy number is a probable determinant of np 7472 mutant `penetrance' at the cellular level. In support of this, clone 14 also showed the least effect on tRNASer(UCN) levels. However, this finding is also open to interpretation, since clone 14 was also the only mutant cybrid that showed any alteration in the processing of ND6-containing transcripts. It is therefore possible that the unusually high level of tRNASer(UCN) represents increased efficiency of RNA processing in this cell clone.
An interaction between mutant mitochondrial genotype and mtDNA copy number has also been noted in the case of osteosarcoma cell cybrids carrying the np 3243 mutation, in which oxygen consumption rates were found to increase in proportion to copy number in cybrids carrying a given proportion of mutant mtDNA (17). Almost nothing is known about the control of mtDNA copy number in vivo, apart from the fact that it is developmentally regulated and that this probably influences respiratory phenotype (18). Genetically programmed tissue differences in copy number are a plausible mechanism contributing to the tissue specificity of mtDNA mutant phenotypes and these may in turn be influenced by various factors (nuclear, mitochondrial, environmental or epigenetic).
One mutant cell clone, clone 38, was heteroplasmic at a low level (~15%) for an additional C insertion at np 7472. However, this was not associated with any significant phenotypic difference compared with the other mutant cybrids. It remains possible that the additional insertion could have phenotypic significance if present at a higher level, but we were unable to isolate any such subclone, possibly indicating that it had been counter-selected. The fact that the novel mutation almost certainly arose in cell culture signals the relative instability of such homopolymeric tracts. Conceivably, such instability, combined with mitotic segregation, could have a bearing on phenotypic progression or severity in np 7472 disease.
The pathogenic mechanism of action of the np 7472 mutation
Our experiments indicate that the np 7472 mutation acts to reduce the steady-state level of tRNASer(UCN), at least in osteosarcoma cell cybrids. Plausibly this could represent an interference with pre-tRNA processing, as in the case of the np 7445 mutation (8,9), in the efficiency of tRNA aminoacylation, as in the case of the np 8344 or 3243 mutations (19,20), or in tRNA stability per se. An interference with RNA processing seems the least likely explanation, since we did not find any systematic change in mutant versus control cybrids in the pattern of light strand transcripts of the ND6 region nor in their overall abundance relative to the ND1 or G3PDH loading controls. The pattern of ND6 region transcripts we detected differs somewhat from that shown by Guan et al. (9) for lymphoblastoid cells from controls and np 7445 patients. There is a greater diversity of transcripts visible and the most prominent transcripts are of ~2 and ~4 kb, not 1.3 kb. The ~4 kb transcript probably corresponds to the precursor-like transcript RNA 3, as also found in HeLa cells (15; J.A. Enriquez, personal communication). The 2 kb transcript should not be from the opposite strand, since we used an identical procedure as Guan et al. (9) for preparing and hybridizing a strand-specific riboprobe for ND6, using a clone supplied by the same laboratory. The transcript pattern we observed was unaffected by re-washing at higher stringency, confirming that all transcripts detected are bona fide transcripts from mtDNA. Most likely there are differences in mitochondrial RNA processing between cell types, as observed elsewhere (21). None of these transcripts has been definitively assigned a function.
Three other observations are noteworthy. Firstly, although the amount of precursor-like RNA 3 varies between cell clones, it is not systematically elevated in mutant cybrids. Secondly, the 1.3 kb transcript previously proposed to be ND6 mRNA (9,15) is strikingly more abundant in just one mutant cybrid clone, clone 14. This is also the clone in which the steady-state level of tRNASer(UCN), although still significantly below that of control cybrids, is elevated considerably above the range seen in the other mutant cybrids (55% as compared with 35% of control levels). This may reflect an improved capacity for processing of light strand transcripts in this clone, perhaps as a result of a second site mutation in mtDNA or, alternatively, a nuclear genetic or epi-genetic change. Finally, the abundance of the 1.3 kb transcript in the other mutant cybrids follows no consistent pattern, being slightly elevated in some (clones 38 and 47) and perhaps slightly decreased in others (clone 32). Interference with RNA processing seems an unlikely mechanism of action of the np 7472 mutation, suggesting that the mutation rather results in reduced tRNA stability, although this might be by an indirect mechanism.
Our studies of aminoacylation were not conclusive, but do suggest that the mutant tRNA is capable of being aminoacylated with serine. This does not rule out the possibility that it is also misacylated with another amino acid. However, this is also unlikely, given that we observed no difference in the mobility of acylated tRNASer(UCN) between mutant and control cybrids (Fig. 5). The decreased serine labelling in vivo of the band corresponding to mitochondrial tRNASer(UCN) in mutant cells reflects the decreased steady-state level of this tRNA, assuming that ~50% of the signal is contributed by the co-migrating cytosolic tRNASer(UCH). This implies that the mutant tRNA is capable of being aminoacylated, but does not exclude the possibility that it may be aminoacylated inefficiently, and that this causes the drop in steady-state level, as also seen in the case of the np 8344 mutation for tRNALys (20). Because of the evident difficulties in resolving aminoacylated and non-acylated mitochondrial tRNASer(UCN), plus the problem of separating the different seryl-tRNAs from human cells, further analysis of this question must await isolation of the human mitochondrial seryl-tRNA synthetase, which will enable a direct approach to the question.
Common features of the molecular phenotype of mitochondrial tRNASer deafness mutations
Two different deafness-associated mtDNA mutations (np 7445 and np 7472) are now demonstrated to affect the steady-state level of tRNASer(UCN), with only a minimal effect on mitochondrial protein synthesis in cultured cells. In the case of np 7445 the mechanism of action is clearly at the level of RNA processing, but in the case of np 7472 the primary effect is inferred to be on tRNA stability or else the efficiency of aminoacylation. The availability of tRNASer(UCN) for mitochondrial translation is clearly the common feature, although why this would specifically affect cells of the auditory system is unclear. The two mutations do not, however, result in identical disorders. The np 7472 mutation is associated with a wider neurological syndrome, whereas palmoplantar keratoderma plus deafness is a specific feature of np 7445 families. The latter might plausibly result from the RNA processing defect that affects ND6. However, the unique features of np 7472 disease remain unexplained. Either some aspects of the np 7472 molecular phenotype remain undiscovered by the assays we have used or else might manifest only in a neuronal cell background. The mutation lies in the T-stem of the tRNA, which is known to be involved in interactions with the ribosome. It may also affect RNA base modification in a way that does not affect tRNA mobility on the gel systems we employed. Such an effect might also be tissue-specific. One other possibility is that the marginally greater effect of the np 7472 mutation on the steady-state level of tRNASer(UCN), as compared with the np 7445 mutation, underlies the tendency for a minority of patients to develop overt neurological symptoms.
The reason why a deficiency of tRNASer(UCN) would result in a phenotype of hearing loss remains unexplained. Mitochondrial protein synthesis is affected to only a minimal degree in the osteosarcoma cell background and an effect on cell growth is revealed only under conditions of respiratory stress. Assembly of mitochondrial membrane complexes appeared normal in the osteosarcoma cybrids, although in-gel histochemistry in BNE gels (L.G.J. Nijtmans and I.J. Holt, personal communication) does reveal a greater proportion of ATPase activity in incompletely assembled complex V in mutant as compared with control cybrids, as well as a slightly reduced activity of complex I. The mild phenotype in osteosarcoma cell cybrids is perhaps not surprising, given the fact that the mutation is tolerated in the homoplasmic or near-homoplasmic state without widespread physiological or developmental effects. However, it is striking that other pathological mutations in this tRNA gene (10,11; T.P. Hutchin, personal communication) also result in the same tissue-restricted phenotype of hearing impairment. One possibility would be that the mitochondrial seryl-tRNA synthetase, as yet uncharacterized, may be limiting in one or more critical cell types of the auditory system, such that in combination with the reduced level of tRNASer(UCN) caused by a mitochondrial mutation it provokes an overt deficit of mitochondrial translation only in that cell type.
MATERIALS AND METHODS
Cells and cell culture
143B osteosarcoma cell cybrid clones resulting from a rho-0 fusion to heteroplasmic cells from a patient with the np 7472 mutation have been described previously (5). Cells were maintained in Dulbecco's modified Eagle's medium containing 2 mM L-glutamine, 1 mM sodium pyruvate, 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin, plus either 4.5 g/l glucose and 50 µg/ml uridine (glucose medium) or 0.9 g/l galactose (galactose medium). Cells were passaged weekly by trypsinization. For growth curves, confluent cells were trypsinized and seeded at 1/50 dilution in either glucose- or galactose-containing medium, in 96-well plates. Growth was monitored using the vital dye MTT, essentially as described by Wilson (22), with MTT at 2 mg/ml.
Oligonucleotides and plasmids
Oligonucleotides used as northern blot probes were as follows. For tRNASer(UCN), ser-11 (AAGGAAGGAATCGAACCCC-CCAAAGCTG) and ser-12 (CCAACCCCATGGCCTCCATGACTTTTTC); for tRNALeu(UUR), leu-21 (GTTTTATGC-GATTACCGGGC); for cytosolic tRNASer(UCH), i.e. the product of the HSTRNS1 gene (16), ser-31 (TAGTCGGCAGGATTCGAACCTGCGTGG) and ser-32 (CATGCCTTAACCACTCGGCCACGACTAC). For analysis of mtDNA by direct sequencing, PCR primers FR31 and FR32 (2) were used as previously (2,8) to amplify the tRNASer(UCN) region of mtDNA, which was sequenced on a Perkin Elmer 310 Genetic Analyzer (Perkin Elmer, Norwalk, CT) using primers MT11 (GAACCCTCCATAAACCTGGAG, np 7362-7382 of human mtDNA) and MT12 (TGCGCTGCATGTGCCATTAAG, np 7602-7582 of human mtDNA). Clone pND6, used for synthesis of an ND6-specific riboprobe (9), was the kind gift of Dr G. Attardi.
DNA extraction
For PCR-based direct sequencing DNA was extracted from cultured cells as described previously (2,8). For Southern analysis of relative mtDNA copy number, HindIII-digested genomic DNA was prepared from cells as follows. One confluent 10 ml plate (~5 × 106 cells) was trypsinized and cells recovered by centri-fugation for 3 min at 2000 gmax. Cell pellets were resuspended in 50 µl of water, 5 µl of 10 mg/ml boiled RNase A were added and samples were incubated for 30 min at 37°C. After addition of 10 µl of proteinase K solution (18 mg/ml) and 350 µl of 6 M guanidine hydrochloride, 0.5 M sodium acetate, pH 5.5, incubation was continued overnight at 56°C. Crude DNA was precipitated by the addition of 800 µl of ice-cold isopropanol and samples were stored at 4°C before further processing. Crude DNA was recovered by centrifugation for 30 min at 7000 gmax and pellets, washed twice with 70% ethanol, were digested three times successively with HindIII as follows. Pellets were resuspended by the successive addition of 89 µl of water, 10 µl of 10× NEB2 digestion buffer (New England Biolabs, Beverly, MA) and 1 µl of HindIII (20 U/µl; New England Biolabs) and were incubated overnight at 37°C. Samples were then phenol/chloroform extracted without vortexing, centrifuged at 7000 gmax to separate phases and ethanol precipitated. The thrice-digested DNA was finally resuspended in 30 µl of water.
Southern blot hybridization
To estimate relative mtDNA copy number, DNA prepared as above was fractionated on a 0.7% agarose gel, capillary blotted under standard conditions to MagnaCharge nylon membrane (Micron Separation, Westborough, MA) and UV linked. Blots were successively hybridized, overnight at 65°C in 1 mM EDTA, 7% SDS, 0.5 M sodium phosphate buffer, pH 7.2 (23), with radiolabelled probes for human mtDNA and 18S rDNA, essentially as described by Spelbrink et al. (24). The mtDNA probe was generated from a 460 bp fragment containing sequences from the ND1 and tRNALeu(UUR) genes. This fragment was derived by ApaI digestion of a PCR product of this region, synthesized using primers FR6 and FR7 (25) on template DNA from a cell line containing the np 3243 mutation that creates the ApaI site. The rDNA probe was a PCR product for the first 500 bp of the 18S rRNA gene, obtained by amplification from genomic DNA of a control A549 lung carcinoma cybrid (line B; 25) using primers 18S-F (TACCTGGTTGAT-CCTGCCAG) and 18S-R (TCGGGAGTGGGTAATTTGC). Amplification conditions were as used by El Meziane et al. (25) and probe fragments were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany), before labelling using an Oligolabelling kit (Amersham Life Science, Little Chalfont, UK) in the presence of [[alpha]-32P]dCTP (3000 Ci/mmol; Amersham Life Science). After hybridization, filters were washed successively for 20 min each at 65°C, twice in 3× SSC, 0.1% SDS and once in 0.3× SSC, 0.1% SDS, then analysed by autoradiography and quantitated by phosphorimaging and densitometry.
RNA analysis by northern blots and acidic polyacrylamide gel electrophoresis
RNA was isolated as previously (2), using the Trizol method. Agarose-formaldehyde and acidic polyacrylamide gel electrophoresis, plus hybridization regimes for northern blots, were as described previously (19,25), except that various different gel compositions were used for acidic PAGE (6.5 up to 20% acrylamide, 0 up to 7 M urea). Deacylation of tRNA was carried out essentially as described by Enriquez and Attardi (26), by the addition to RNA resuspended in 100 mM sodium acetate, pH 5.2, of 1.5 vol of 0.5 M Tris-HCl, pH 9.0, and heating for 10 min at 75°C. To detect ND1 mRNA and tRNALeu(UUR), a random primer-labelled DNA probe was generated as described above. As probe for G3PDH mRNA we used a 983 bp PCR product generated by the human G3PDH control amplimer set (Clontech, Palo Alto, CA). For ND6 hybridization, a strand-specific riboprobe was synthesized from pND6 using SP6 RNA polymerase (Fermentas, Vilnius, Lithuania), using the manufacturer's buffer and protocol, involving digestion of residual template DNA by DNase. Northern hybridization to the ND6 riboprobe was carried out overnight at 48°C, under identical conditions to those used by Guan et al. (9; J.A. Enriquez, personal communication), in a buffer containing 50% formamide, 5× SSC, 1× Denhardt's solution, 20 mM sodium phosphate, 0.5% SDS and 100 µg/ml salmon sperm DNA. Prehybridization at 48°C was carried out for 3 h in 20 ml of the same buffer, but containing 0.2% SDS and 500 µg/ml salmon sperm DNA. The filter was successively washed at 55°C in 2× SSC, 0.1% SDS for 1 h, 2× SSC, 0.2% SDS for 30 min, 50% formamide, 5× SSC, 0.2% SDS twice for 1 h, again in 2× SSC, 0.2% SDS for 30 min, then finally in 0.1× SSC, 0.2% SDS twice for 30 min.
Metabolic labelling of seryl-tRNA
For analysis of aminoacylation by metabolic labelling with [14C]serine, cells were seeded on 6 cm plates and grown to 80-90% confluence. After two washes with phosphate-buffered saline (PBS), cells were incubated for 10 min at 37°C in serine-free medium, prepared using the MEM Select-Amine kit (Life Technologies, Paisley, UK). Cells were washed once in serine-free medium, then incubated for 1 h at 37°C in 2 ml of this medium containing 25 µCi of [14C]serine (151 Ci/mmol; Amersham Life Science). After three washes in PBS, RNA was prepared from the labelled cells by the Trizol method and finally dissolved in 15 µl of 100 mM sodium acetate, pH 5.2. Deacylation was carried out as above.
Analysis of mitochondrial translation products by SDS-PAGE
[35S]methionine labelling of mitochondrial translation products in vivo in the presence of emetine, followed by SDS-PAGE, as well as two dimensional (BNE-SDS) polyacryl-amide gel electrophoretic analysis of mitochondrial membrane complexes, was carried out as described previously (25). For in vivo labelling with [35S]methionine in the presence of doxy-cyclin, cells were preincubated with the drug along with emetine prior to addition of the label.
ACKNOWLEDGEMENTS
We thank Anja Rovio, Sanna Lehtinen, Hans Spelbrink and Abdellatif El Meziane for advice and technical assistance, and our many colleagues within the EU MBDD and NMI Networks, notably Toño Enriquez and Ian Holt, for useful discussions. This work was supported by funding from the Academy of Finland, Tampere University Hospital Medical Research Fund, the Juselius Foundation and the European Union.
REFERENCES
+To whom correspondence should be addressed. Tel/Fax: +358 3 215 7731; Email: howy.jacobs{at}uta.fi
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Mollers, K. Maniura-Weber, E. Kiseljakovic, M. Bust, A. Hayrapetyan, M. Jaksch, M. Helm, R. J. Wiesner, and J.-C. von Kleist-Retzow A new mechanism for mtDNA pathogenesis: impairment of post-transcriptional maturation leads to severe depletion of mitochondrial tRNASer(UCN) caused by T7512C and G7497A point mutations Nucleic Acids Res., September 30, 2005; 33(17): 5647 - 5658. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Li, N. Fischel-Ghodsian, F. Schwartz, Q. Yan, R. A. Friedman, and M.-X. Guan Biochemical characterization of the mitochondrial tRNASer(UCN) T7511C mutation associated with nonsyndromic deafness Nucleic Acids Res., February 11, 2004; 32(3): 867 - 877. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. T. Jacobs Disorders of mitochondrial protein synthesis Hum. Mol. Genet., October 15, 2003; 12(90002): R293 - 301. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Toompuu, T. Yasukawa, T. Suzuki, T. Hakkinen, J. N. Spelbrink, K. Watanabe, and H. T. Jacobs The 7472insC Mitochondrial DNA Mutation Impairs the Synthesis and Extent of Aminoacylation of tRNASer(UCN) but Not Its Structure or Rate of Turnover J. Biol. Chem., June 14, 2002; 277(25): 22240 - 22250. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. P Hutchin, M. J Parker, I. D Young, A. C Davis, L. J Pulleyn, J. Deeble, N. J Lench, A. F Markham, and R. F Mueller A novel mutation in the mitochondrial tRNASer(UCN) gene in a family with non-syndromic sensorineural hearing impairment J. Med. Genet., September 1, 2000; 37(9): 692 - 694. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||