| Human Molecular Genetics | Pages |
©1999 Oxford University Press |
Functional analysis of cis-acting elements regulating the alternative splicing of human CFTR exon 9
Introduction
Results
Tn tract and alternative splicing of CFTR exon 9
T/TG repeats interplay and alternative splicing of CFTR exon 9
Secondary structure of human CFTR IVS8 3[prime] splice site
Cis-acting elements regulating mouse and human exon 9 definition
Discussion
Materials And Methods
Constructs
Transfections
Expression of the CFTR in the cell lines used for our study
RNA structural mapping
Acknowledgements
References
Functional analysis of cis-acting elements regulating the alternative splicing of human CFTR exon 9
Received August 6, 1999; Revised and Accepted September 30, 1999
The rate of exon 9 exclusion from the cystic fibrosis transmembrane conductance regulator (CFTR) mRNA is associated with monosymptomatic forms of cystic fibrosis. Exon 9 alternative splicing is modulated by a polymorphic polythymidine tract within its 3[prime] splice site. We have generated a minigene carrying human CFTR exon 9 with its flanking intronic sequences and set up an in vivo model to study the cis-acting DNA elements which modulate its splicing. Transfections into human cell lines showed that T5, but not T9 or T7 alleles, significantly increases the alternative splicing of exon 9. Moreover, we found that another polymorphic locus juxtaposed upstream of the T tract, and constituted by (TG)n repeats, can further modulate exon 9 skipping but only when activated by the T5 allele. Then, we extended our studies to the mouse CFTR exon 9 which does not show alternative splicing. Comparison of human and mouse introns 8 and 9 revealed a low homology between the two sequences and the absence of the human polymorphic loci within the mouse intron 3[prime] splice site. We have tested a series of constructs where the whole human exon 9 with its flanking intronic sequences was replaced partially or completely by the murine counterpart. The transfections of these constructs in human and murine cell lines reveal that also sequences of the downstream intron 9 affect exon 9 definition and co-modulate, with the UG/U 3[prime] splice site sequences, the extent of exon 9 skipping in CFTR mRNA.
INTRODUCTION
Mutations in cystic fibrosis transmembrane conductance regulator (CFTR) gene lead to dysfunction of lung, sweat glands, testis, ovary, intestine and pancreas (1). The clinical manifestations of the disease are widely variable, ranging from severe pulmonary disease with pancreatic insufficiency to mild pulmonary disease and pancreatic sufficiency (2). Moreover, mutations in the CFTR gene have also been found in patients that have normal lung function but show other clinical signs such as congenital absence of vas deferens (3), nasal polyposis (4), bronchiectasis (5,6) and bronchopulmonary allergic aspergillosis (7). Interestingly, genotype-phenotype correlations have shown that there is a strong association of the CFTR gene IVS8-T5 allele with male infertility caused by congenital bilateral absence of vas deferens (CBAVD) (8-11), and possibly with other monosymptomatic forms of CFTR, such as bronchiectasis (12) and chronic idiopathic pancreatitis (13).
Genetic studies have found that a polymorphic polypyrimidine (Tn) locus located within the 3[prime] splice site of IVS8 in the CFTR gene is associated with a variable efficiency of exon 9 splicing (14).
There are three alleles at this locus, with 5, 7 or 9 thymidines (T5, T7 and T9, respectively), that affect the efficiency of CFTR exon 9 inclusion in mRNA which is directly correlated with the length of the polypyrimidine tract (8).
Several studies performed on patient genotypes confirmed the association between CBAVD and IVS8 T5 allele, and found that both in nasal epithelium and in vas deferens the T5 allele is associated with a high proportion of alternatively spliced CFTR mRNA lacking exon 9 (11,15,16).
However, the fact that the T5 allele is not found exclusively in patients suffering from CBAVD but is also present in healthy subjects indicates that it is a mutation with partial penetrance (9). Therefore, it has been suggested that the simultaneous presence of other mutations and/or polymorphisms could explain the partial penetrance of the Tn allele. In particular, it was hypothesized that another polymorphic locus based on TG repeats (with alleles ranging from 9 to 13 repeats) placed immediately upstream of the polypyrimidine tract might affect the efficiency of exon 9 inclusion in the CFTR mRNA, in combination or independently from the Tn locus (10). The TG and T tracts are present in the pre-mRNA (as UG and U) within the 3[prime] splice site of exon 9 and hence could have a direct involvement in exon recognition. Although the association of the polymorphic Tn locus and the monosymptomatic forms of cystic fibrosis is quite clear, the exact molecular basis of the CFTR exon 9 alternative splicing is still unknown. In this paper we have used an in vivo model to investigate the cis-acting RNA elements which modulate the splicing efficiency of CFTR exon 9.
RESULTS
Tn tract and alternative splicing of CFTR exon 9
In order to explore which are the cis-elements that control the splicing of human exon 9 and modulate its splicing efficiency, we initially generated a plasmid containing a minigene with the human CFTR exon 9 and its intron boundaries (Fig. 1a). The human epithelial lung cell line NCI-H322 was chosen because of its tissue origin and because it has a reasonable level of endogeneous CFTR expression (data not shown).
Figure 1. Schematic representation of human and mouse minigenes. (a) Human exon 9 and its flanking intronic sequences cloned into the NdeI site of pSV-mEDA plasmid. (b) Mouse exon 9 and its flanking intronic sequences cloned into the NdeI site of pSV-mEDA plasmid. The sizes of CFTR exon 9, CFTR introns 8 and 9 and EDA introns are shown as well as the position of relevant restriction enzyme target sites. Dotted lines depict exon 9 alternative splicing. +1 EDA and -1 EDA, fibronectin EDA exons of the pSV-mEDA plasmid.
To analyse the effects of the polypyrimidine tract length on alternative splicing we designed three constructs where the number of TG dinucleotide repeats was fixed at 11, whereas the number of polypyrimidines was variable and included five (pTG11/T5), seven (pTG11/T7) or nine (pTG11/T9) thymidines (Fig. 2a).
Figure 2. Effect of the T tract on alternative splicing of human exon 9. (a) Sequence of intron 8 3[prime] end and exon 9 splice junction of constructs carrying 11 fixed TG repeats juxtaposed to nine, seven or five thymidines [p(TG)11/Tn]. In p(TG)11/A7 and p(TG)11/A5 constructs, seven or five adenines replaced seven or five thymidines, respectively. In p(TG)11/[Delta]T construct the T tract was completely deleted. (b) Analysis of pre-mRNA splicing of human constructs in NCI-H322 cells. The size of PCR products including (409 bp) and excluding (226 bp) exon 9 are indicated. Amplicons were separated on a 1.5% (w/v) agarose gel. The proportion of exon 9 exclusion was determined by densitometry using the total densitometric units of 9+ and 9- amplicons as 100%. p(TG)11/T5, 4%.
Transient transfections into the NCI-H322 cell line followed by RT-PCR using primers specific for our minigene showed that the constructs carrying T9 or T7 genotypes generate mRNA with 100% exon 9 inclusion, whereas only T5 genotype activates alternative splicing of exon 9 (Fig. 2b).
To investigate whether the activation of alternative splicing observed with the T5 allele is regulated through a sequence- or spacing-specific effect we generated mutants in which the T tract was completely deleted, leaving the (TG)11 repeats adjacent to the 3[prime] splice site of exon 9 (p[Delta]T), or replaced by unrelated sequences, i.e. a non-polypyrimidine A tract, creating two constructs carrying five adenines (pTG11/A5) or seven adenines (pTG11/A7) (Fig. 2a). Figure 2b shows that all these constructs transfected into the NCI-H322 cell line lead to expression of mRNA excluding exon 9, demonstrating that the presence of a polythymidine tract in CFTR IVS 8 is essential for the utilization of the exon 9 3[prime] splice site. Secondly, it is also shown that a stretch of polypyrimidines alternating with purines (within the TG tract) is not equivalent to a functional continuous polypyrimidine tract, contrary to what has been observed for the apolipoprotein AII gene (17).
T/TG repeats interplay and alternative splicing of CFTR exon 9
Previous observations in human subjects by Cuppens et al. (10) suggested that the TG dinucleotide repeats could affect the alternative splicing of exon 9 even in a way independent of the allele found at the T locus. We have analysed how the length of the TG tract might regulate the efficiency of exon inclusion in our minigene system, where the T5 allele was linked to 11, 12 or 13 TG repeats, respectively (Fig. 3a).
Figure 3. Effect of TG/T interplay on alternative splicing of human exon 9. (a) Sequence of intron 8 3[prime] end and exon 9 splice junction of constructs carrying variable numbers of TG repeats juxtaposed to seven or five thymidines [p(TG)11/Tn]. (b) Analysis of pre-mRNA splicing of human constructs in NCI-H322 cells. The size of the PCR products including (409 bp) and excluding (226 bp) exon 9 are indicated. Activation of exon 9 skipping is observed only when five thymidines are present. PCR products were separated on 1.5% agarose gel. The proportion of exon 9 exclusion was determined by densitometry using the total densitometric units of 9+ and 9- amplicons as 100%. p(TG)11/T5, 4%; p(TG)12/T5, 10%; p(TG)13/T5, 18%.
Transient transfections of these constructs into the NCI-H322 cell line show that for the T5 allele the proportion of exon 9 exclusion is further modulated by the number of TG repeats, since the longer the TG tract is the higher is the proportion of transcripts devoid of exon 9 (Fig. 3b).
On the other hand, when the T7 allele is used there is no activation of exon 9 skipping regardless of the number of TG repeats (Fig. 3b). These results suggest that the TG repeats cannot directly control exon 9 skipping, i.e. independently from the T tract, but they can only modulate alternative splicing when this is activated by the T5 allele.
To improve the sensitivity of the system and to explore the structural reasons for this poor exon definition as well as the possible effects the TG repeats if masked by other cis-elements, we introduced a mutation in the 5[prime] splice site of exon 9 to decrease its definition and hence increase the exclusion rate of this exon. Transfections with constructs carrying the mutated exon 9 5[prime] splice site showed again that activation of alternative splicing occurs only with the T5 allele, and that the number of TG repeats acts in synergy with the T5 allele to drive exclusion of exon 9 (Fig. 4).
Figure 4. Effect of 5[prime] splice site mutation on alternative splicing of CFTR exon 9. The influence of exon definition on 3[prime] splice site recognition was investigated through mutagenesis of the 5[prime] splice site of exon 9 by replacing guanine in position +1 within intron 9 with an adenine (AAG/gtag->AAG/atag). Analysis of pre-mRNA splicing of human constructs mutagenized at the 5[prime] splice site shows activation of exon 9 skipping only when five thymidines are present. PCR products were separated on 1.5% agarose gel. The proportion of exon 9 exclusion was determined by densitometry using the total densitometric units of 9+ and 9- amplicons as 100%. p(TG)11/T5-5[prime]A, 18%; p(TG)12/T5-5[prime]A, 52%; p(TG)13/T5-5[prime]A, 75%.
These findings show that the exclusion rate of exon 9 is inversely proportional to the length of the T tract and directly proportional to the number of TG repeats. Moreover, these experiments indicate that the 3[prime] splice site affects exon 9 definition more significantly than the 5[prime] splice site.
Secondary structure of human CFTR IVS8 3[prime] splice site
The secondary structure of the pre-mRNA has been shown to strongly influence the interaction with splicing factors and its processing (18). We have analysed experimentally the RNA secondary structure of exon 9 to test whether the composition and length of the TG/T polymorphic loci might affect the secondary structure of the 3[prime] splice site of IVS8.
Single- and double-strand specific RNases confirmed the structure predicted by the energy minimization modelling through the program RNAfold (19-21) (Fig. 5a). The resulting model structure suggests that the CFTR transcripts contain four loop regions (I, II, III and IV) with the (UG)11/U7 region actively involved in the formation of domain II by fixing the structure of this stem-loop (which also contains the 3[prime] splice site). To evaluate the role of U7 sequence on this structure we also performed a similar analysis on a mutant carrying the (UG)11/U5 polymorphism. These results (Fig. 5b) suggest that loss of two thymidine residues might weaken the stability of the stem, as evidenced by the presence of V1 cleavages in the U7 tract which are absent in the U5 structure. No other changes could be detected in the cleavage pattern of the rest of the RNA (data not shown).
Figure 5. Enzymatic determination of the RNA secondary structure of the human CFTR intron 8 polymorphic loci. (a) Computer prediction of the secondary stucture models of the (UG)11/U7 region. The four loops (I, II, III and IV) are shown and the (UG)11/U7 region is actively involved in the formation of domain II, which also contains the 3[prime] splice site splice site. (b) Enzymatic analysis of RNA templates of (UG)11/U7 and (UG)11/U5 genotypes. In vitro transcribed RNAs were enzymatically digested with S1 nuclease and T1 and V1 RNases and reverse transcribed. The reverse-transcribed products were separated on polyacrylamide sequencing gels. Target sites of S1 nuclease and of T1 and V1 RNases digestions are shown.
Cis-acting elements regulating mouse and human exon 9 definition
Interestingly, the comparison between human and murine CFTR splice variants showed that in mouse the alternative splicing of CFTR exon 9 is not present (22).
To investigate the molecular basis of this difference, the murine genomic regions spanning exons 8-9 and exons 9-10 were amplified by PCR and the 3[prime] and 5[prime] splice junctions and flanking intronic sequences of mouse exon 9 were sequenced.
Two main differences were immediately apparent. First, the sizes of the human and murine IVS8 and IVS9 are significantly different (Fig. 6a) and, secondly, the alignment of mouse and human exon 9 with its flanking intronic sequences shows that mouse IVS8 3[prime] splice site does not contain the human TG/T polymorphic sequences (Fig. 6b). These structural differences were consistent with the results obtained in this study indicating that the human TG and T polymorphic loci can regulate the alternative splicing of human exon 9. To experimentally confirm this observation, the mouse CFTR exon 9 and its flanking sequences was cloned in the same minigene construct used for the human CFTR exon 9 (Fig. 1b). A series of constructs was designed, in which murine IVS8 was replaced with human IVS8 carrying the (TG)11/T5 or (TG)11/T7 genotypes (Fig. 7a). These human/mouse hybrid constructs, as well as the human exon 9 constructs, were transiently transfected either into human hepatocarcinoma Hep3B or into mouse hepato-carcinoma N-Muli cell lines, which express endogeneous CFTR mRNA (data not shown). Figure 7b shows that the human constructs in the mouse cell line displayed activation of alternative splicing when the T5 allele was present. The same constructs in the human cell line showed the activation of CFTR exon 9 alternative splicing with a significantly lower rate of exclusion (Fig. 7b). On the other hand, the mouse minigene did not present exon 9 skipping in both the human and mouse cell lines (Fig. 7b). The transfections of the phTG11T7/M/m and phTG11T5/M/m hybrid minigenes resulted in 100% inclusion of exon 9 both in the human and in mouse cell lines, regardless the number of Ts within the polypyrimidine tract (Fig. 7b). Together, these results suggest that in humans the polymorphic loci at the 3[prime] end of intron 8 might be critical but not sufficient to regulate the exon 9 alternative splicing.
Figure 6. Comparison of human and mouse genomic regions spanning exons 8-10. (a) Schematic representation of mouse and human exons 8-10. Sizes of introns are shown. (b) Alignment of mouse and human exon 9 (183 bp) with its flanking sequences of intron 8 (157 bp; GenBank accession no. AF176095) and of intron 9 (209 bp; GenBank accession no. AF176096). Upper line, human sequence; lower line, mouse sequence; uppercase, exon 9; lowercase, introns 8 and 9. The asterisk denotes the guanine nucleotide in position +1 within human intron 9 replaced with an adenine nucleotide in constructs mutagenized at the 5[prime] splice site. Bases in bold indicate the human cryptic 5[prime] splice site activated after mutagenesis of the wild-type 5[prime] splice site (CCAG/GCAAGatag). Superlined bases, 118 bp within the human exon (nt 275, AG/AT), indicate the cryptic 3[prime] splice site activated in transfection of pm/H/m construct.
Figure 7. Analysis of pre-mRNA splicing from human/mouse hybrid constructs. (a) Schematic representation of human/mouse hybrids. White box, human exon 9; black box, mouse exon 9; dotted lines, human intron 8 or 9; solid lines, mouse introns. h(TG)11-T7 and h(TG)11-T5 refer to the genotypes of the polymorphic loci at the 3[prime] end of human intron 8. (b) Analysis of pre-mRNA splicing of human/mouse hybrid constructs. PCR products were separated on a 1.5% agarose gel. The proportion of exon 9 exclusion was determined by densitometry using the total densitometric units of 9+ and 9- amplicons as 100%. Hep3B: p(TG)11/T5, 3%; p(TG)12/T5, 7%; p(TG)13/T5, 11%. N-Muli: p(TG)11/T5, 54%; p(TG)12/T5, 72%; p(TG)13/T5, 100%.
In order to define the localization of other regulatory sequences, we generated further human/mouse hybrids where the murine sequences progressively replaced the human counterpart. Transient transfections of the phTG11T7/H/m and phTG11T5/H/m constructs again resulted in 100% exon 9 inclusion (Fig. 8b). Conversely, transfections of pm/H/h construct resulted in 100% exon 9 exclusion (Fig. 8b). The weakness of the mouse 3[prime] splice junction was confirmed through the transfections of pm/H/m construct that showed activation of a cryptic splice site 118 bp within the human exon (Fig. 8b), whose upstream sequences resemble a canonical 3[prime] splice site better than that present within mouse IVS8 (Fig. 6b, nt 275).
Figure 8. Analysis of pre-mRNA splicing from human/mouse hybrid constructs. (a) Schematic representation of human/mouse hybrids. White box, human exon 9; black box, mouse exon 9; dotted lines, human intron 8 or 9; solid lines, mouse introns; h(TG)11-T7 and h(TG)11-T5, genotype of the polymorphic loci at 3[prime] end of human intron 8. (b) Effect of transient transfection of human/mouse hybrid constructs into Hep3B and N-Muli cell lines. Transient transfections of the phTG11T7/H/m and phTG11T5/H/m constructs show 100% exon 9 inclusion. Transfection of pm/H/h construct shows 100% exon 9 exclusion. The transfection of pm/H/m construct shows activation of a cryptic splice site 118 bp within the human exon (nt 275, Fig. 6b). The sizes of PCR product including and excluding exon 9 are shown. PCR products were separated on a 1.5% agarose gel.
These experiments exclude exon 9 sequences as the site of human/mouse differences for regulatory cis-acting elements and point out to the human CFTR IVS9 5[prime] splice site and its flanking intronic sequences as another regulatory region critical for exon 9 splicing. Furthermore, they indicate that the 5[prime] splice region of human CFTR IVS9 might exert an inhibitory effect on exon 9 recognition.
DISCUSSION
Human CFTR exon 9 and its flanking introns apparently share most of the canonical features of splicing sites (23). However, the polypyrimidine tract at the 3[prime] splice site is composed exclusively by thymidines and is polymorphic for its length. Moreover, it is placed immediately downstream of another polymorphic locus made of a variable number of TG repeats.
We have shown that this peculiar architecture of the intron 8 3[prime] splice site modulates the alternative splicing of human CFTR exon 9. In our minigene system, we have found that a stretch of five, but not seven or nine, thymidines activates the exon 9 skipping. This is consistent with the relevance of polypyrimidine tract length observed in other genes. In fact, it was shown previously that the longer the tract consisting of pyrimidines (in particular, thymidines) is, the more efficient is the inclusion of the downstream exon (24). In addition, we have demonstrated that the TG tract is unable to complement the polythymidine function and seems to have a detrimental effect for exon 9 inclusion when associated with the T5 allele (Fig. 3b). Therefore, within the 3[prime] splice site of CFTR exon 9, the effects of the TG tract are different from those reported in other contexts where it is able to form a fully functional polypyrimidine tract (17,25).
In our system, the proportion of exon 9 skipping in NCI-H322 does not reach the reported levels of exon 9 exclusion observed in the individuals with the T5 allele (11,15,26,29) although it has the same qualitative trend. The quantitative differences may be due to the variations in cell- and/or tissue-specific trans-acting factors involved in the regulation of the CFTR exon 9 splicing. This is consistent with the reported cell type- and development-specific variations of the total and relative amounts of splicing factors, such as SR (27) and hnRNP proteins (28,29). However, it should be noted that in our construct, exon 9 and its intronic region are flanked by unrelated genomic sequences lacking CFTR distant exons and, possibly, some other crucial cis-acting element. Hence, we cannot rule out that the minigene context might influence the level of exon 9 exclusion. In any case, the TG/T constructs show a very clear qualitative difference due only to the polymorphic loci as they differ only in the length of the TG and/or T tract making them a suitable system for studying the alternative splicing of CFTR exon 9.
It is surprising that Hep3B and N-muli give such a striking difference in efficiency of CFTR exon 9 alternative splicing (Fig. 7b), considering that both cells have the same tissue of origin. It is unlikely that we are seeing species-specific interactions of the murine and human splicing factors because they are highly homologous (30). It is possible that the cells represent different stages of hepatocyte differentiation and may have qualitative and quantitative differences in the set of trans-acting factors.
Our studies then confirm previous observations by Cuppens et al. (10) based on genotype-phenotype correlations about the relevance of TG repeats on the modulation of exon 9 alternative splicing. However, our findings strongly suggest that the two TG and T polymorphic loci do not work independently from each other and that their function is not only to define spacing between the branch point and the 3[prime] splice site. The other observation that further supports this hypothesis is that if only the space that these polymorphic loci create between branch site and the 3[prime] splice site was important, we would have expected to obtain the same proportion of exon 9 exclusion with different TG/T genotypes. However, we have found that the behaviour of two genotypes which have the same total number of 29 bases, i.e. (TG)11/T7 and (TG)12/T5, is different: the (TG)12/T5 but not the (TG)11/T7 combination activates alternative splicing (Fig. 3b).
Since the polymorphic T tract is placed adjacently to the 3[prime] splice site of exon 9, two possible models could be proposed to explain the activation of the exon 9 alternative splicing. It is plausible that the decrease in the length of the polypyrimidine tract might reduce its ability to interact with one of the splicing factors which recognizes the polypyrimidine tract, such as PTB, U2AF65 or hRNPC (24,31) lowering the efficiency of 3[prime] splice site selection. On the other hand, changes in the length of the polypyrimidine tract might change the binding specificity or increase the binding affinity of some splicing factor(s) resulting in a low recognition of intron 8-exon 9 junction.
Recent studies demonstrated that hnRNPA1 can exert an effect at the 3[prime] splice site, promoting exon skipping (32), so we can hypothesize that the decrease in length of the T tract might reduce the affinity for a splicing factor recognizing the poly-pyrimidine tract and this, in turn, might allow a novel or stronger binding of hnRNP A1 protein to the 3[prime] splice site of exon 9, resulting in the activation of alternative splicing. This hypothesis is supported by the observation that the 3[prime] splice junction of exon 9 (Fig. 6b) has a high homology with the hnRNPA1 consensus target sequence (TAGGGACTTAGGGT) (33). Moreover, the comparison between human and mouse sequences (Fig. 6b) shows that the mouse 3[prime] splice site also shares the high homology with the hnRNPA1 consensus sequence (Fig. 6b) and, according to our human/mouse hybrid studies, it is poorly recognized when placed into the human minigene context (Fig. 7b).
Following this reasoning, we are tempted to speculate that variations in the accessibility of the CFTR exon 9 3[prime] splice site to splicing factors, such as hnRNPA1, might affect its splicing efficiency. Furthermore, experimental studies of the secondary structure of the 3[prime] end of intron 8 are consistent with the hypothesis that variations in length of the poly(T) tract might affect the accessibility of some splicing factors to the 3[prime] splice site.
The transfection experiments suggest that decreasing the number of thymidines within the polypyrimidine tract up to five is critical and provides the basis for a lower exon recognition at its 3[prime] splice site. We have tested the overall influence of exon definition on 3[prime] splice site recognition, mutagenizing the 5[prime] splice site of exon 9. Interestingly, the mutation in the 5[prime] splice site increased the rate of exon skipping only when the T5 allele was present. In this case the proportion of exon exclusion was higher than that of the corresponding wild-type 5[prime] splice site constructs and it was directly proportional to the length of the TG tract. These experiments indicate that (i) the function of the polymorphic polypyrimidine tract might be to rescue a poorly defined exon, at least in its 3[prime] splice site where five thymidines seem to be the threshold for exon 9 recognition; (ii) the contribution of 5[prime] splice site to exon 9 definition is significantly less critical than that of the 3[prime] splice site.
The fact that the human T tract juxtaposed to mouse exon 9 was not able to activate alternative splicing even when T5 allele was present (Fig. 7b) led us to consider the existence of other inhibitory cis-acting sequences within the human CFTR minigene. To identify the localization of the other cis-elements we progressively replaced human with mouse sequences.
The first information obtained through the transfections with human/mouse hybrids was that there are not different regulatory elements within human exon 9, as compared with mouse. In fact, on one hand, exon 9 skipping was not observed either when mouse exon 9/intron 9 replaced the human counterparts (Fig. 7b) or when mouse intron 9 replaced its human homologue (Fig. 8b). On the other hand, when mouse intron 8 was juxtaposed to human exon 9/intron 9, the resulting transfections showed 100% exon 9 exclusion (Fig. 8b).
It was possible to exclude the 5[prime] splice site as another cis-acting element determinant in exon 9 definition for two reasons: (i) when we mutagenized the human exon 9 5[prime] splice site, the modulation of alternative splicing was not affected; it continued to be activated uniquely by the presence of five Ts at the 3[prime] end of intron 8, but not by seven or nine Ts; (ii) comparison of the mouse and human 5[prime] splice site sequences by computer analysis showed that the human exon 9 5[prime] splice site is closer to the consensus than the mouse 5[prime] splice site.
Subsequent analysis of the human/mouse hybrids shows that the 269 bases at the 5[prime] region of human intron 9 have a role in the human-specific exon skipping. Figure 8b shows that human intron 9 exerts a negative effect for exon 9 inclusion as it leads to the complete exon 9 skipping when it is linked to the mouse 3[prime] splice site (construct pm/H/h). In our model, it seems that the exon 9 definition is decreased through two independent mechanisms: one is determined by the polymorphic loci at the 3[prime] end of intron 8 and the other is controlled by sequences placed within the 269 bp at the 5[prime] region of human intron 9, whose function is currently under study.
In conclusion, the divergences of the intronic sequences and the different regulation of exon 9 alternative splicing observed in human and mouse might be interpreted through an evolutionary point of view. In fact, Rozmahel et al. (34) have found that a fragment of CFTR gene spanning exon 9 and its flanking introns and polymorphic loci is present in multiple copies in the human genome, whereas it is present in only single copy in different Old World monkeys. These results have suggested that an ancestral retrotransposition event followed by an amplification of the integration site occurred in the human genome (34). Our studies have now found that mouse CFTR IVS 8 does not present the human polymorphic loci and does not show alternative splicing of exon 9. Therefore, it is conceivable that insertion and rearrangement events occurred in intervening sequences surrounding human CFTR exon 9, placing fortuitous new cis-acting elements in the proximity of its splice junction which lowered exon definition and provided the basis for exon 9 skipping in CFTR mRNA.
MATERIALS AND METHODS
Constructs
The human CFTR genomic region including intron 8 (221 bp at the 3[prime] end), exon 9 (183 bp) and intron 9 (269 bp at the 5[prime] end) was amplified by PCR (94°C 30 s, 60°C 30 s, 72°C 60 s, 35 cycles) using the following oligonucleotides, that include an NdeI target site: hcfIVS8 dir, 5[prime]-ttttcatatggggccgctctaggacttgataatgggcaaatatctta-3[prime]; hcfIVS9 rev, 5[prime]-cccctcgaccatatgctcgccatgtgcaagatacag-3[prime]. The PCR product was NdeI-cut and ligated into a pBluescript KS plasmid (Stratagene, La Jolla, CA), previously mutagenized by deletion of the XbaI-XhoI fragment and insertion of an NdeI site through two complementary synthetic oligonucleotides within the NotI site.
To permit subsequent clonings, an EcoRI target site was introduced through a two-step PCR overlap extension method (35) by replacing an adenine with a cytosine at position +15 within exon 9. Sequencing excluded the presence of mutations within the insert.
To create Tn and (TG)m alleles, an XbaI-EcoRI cassette was generated by PCR using a common sense primer (5[prime]-catatggggccgctctagga-3[prime]) and antisense primer (5[prime]-aaagaattcccc-aaatccctgttaaaaaaacacacacacacacacacacacacatcaaaaataaaagatg-agtt-3[prime]) where A and/or CA number was changed according to the desired genotype. Identity of each construct was confirmed by sequencing.
To generate expression vectors, pBluescript human exon 9 inserts were NdeI cut and ligated within the EDA intron of the pSV-mEDA NdeI-digested vector, described previously (36).
In order to study the influence of exon definition on 3[prime] splice site recognition, we mutagenized the 5[prime] splice site of exon 9 by replacing guanine in position +1 within intron 9 with an adenine (AAG/gtag->AAG/atag) using a two-step PCR overlap extension method. After mutagenesis, the new 5[prime] splice site selected for exon 9 splicing was placed 5 bases upstream of the wild-type site (CCAG/GCAAGatag) (Fig. 6b).
Mouse exons 8-9 and exons 9-10 were amplified by long-range PCR (Expand Long Template; Boehringer Mannheim, Wielandstrasse, Germany) according to the manufacturer's instructions using genomic DNA of CD1 strain as template and the following oligonucleotides: 8dir, 5[prime]-agtataacttaatgaccacaggcataatc-3[prime]; 9rev, 5[prime]-tccagtagatccagtaatagccaacatctc-3[prime]; 9dir, 5[prime]-gagatgttggctattactggatctactgga-3[prime]; 10rev, 5[prime]-atctgtactcatcataggaaacaccaaaga-3[prime].
The 2.2 kb exon 8-9 and the 6 kb exon 9-10 fragments were blunt-end cloned into pBluescript and exon and their junctions were sequenced.
The mouse CFTR genomic region including intron 8 flanking sequences (157 bp at the 3[prime] end), exon 9 (183 bp) and intron 9 flanking sequences (209 bp at the 5[prime] end) was amplified by PCR (94°C 30 s, 60°C 30 s, 72°C 60 s, 35 cycles) using the following oligonucleotides: mCF8i dir, 5[prime]-ttttcatatgtctagaaaccatgtgctttatagt-3[prime], that includes the NdeI and XbaI target sites; mCF9i rev, 5[prime]-aaaacatatgataggttatccaatcttaagtgatcagttctaaacacgtgta-3[prime], that includes the NdeI target site.
The PCR product was NdeI-cut and ligated into the previously described pBluescript NdeI-digested vector. An EcoRI target site was also introduced in mouse minigene through a two-step PCR overlap extension by replacing an adenine with a cytosine at position +15 within exon 9.
The mouse minigene was NdeI-excised from pBluescript and transferred into the EDA intron of the pSV-mEDA NdeI-digested vector.
Human/mouse hybrids were generated by exchanging human/mouse XbaI-EcoRI cassettes or through a two-step PCR overlap extension using previous constructs as a template. Before expression, the identity of all constructs was checked by sequencing.
Transfections
Human lung carcinoma NCI-H322 cell line (ECACC 95111734) was maintained in culture in RPMI supplemented with 10% fetal calf serum, 50 µg/ml gentamicin and 4 mM glutamine. Human hepatocarcinoma Hep3B cell line and mouse hepatocarcinoma N-Muli cell line were grown in Dulbecco's modified Eagle's medium supplemented with 4.5 g/l glucose, 10% fetal calf serum, 50 µg/ml gentamicin and 4 mM glutamine.
The DNA used for transfections was purified with JetStar columns (Genomed, Wielandstrasse, Germany). Cells were transfected with the calcium phosphate co-precipitation technique. Five micrograms of DNA construct were used for each transfection and 200 ng of a plasmid carrying human growth hormone (hGH) under CMV promoter control were included as an internal control to normalize transfection efficiency. After 12 h the medium was replaced with fresh medium and 24 h later the cultures were terminated. The RNA was extracted by the method of Chomczynski and Sacchi (37), whilst the medium was used to assay the hGH production by ELISA (hGH-ELISA; Boehringer Mannheim). Each transfection experiment was repeated at least three times.
Poly(dT) cDNA was synthesized using MoMuLV reverse transcriptase (Gibco BRL, Grand Island, NY). Oligonucleotides specific for pSVEDA constructs, mFN-alphaglob dir (cactgcctgctggtgacgtac) and mFN-alphaglob rev (5[prime]-tgggcggccagggtcacggc-3[prime]), were used for PCR amplifications (35 cycles, 45 s at 94°C, 30 s at 60°C, 30 s at 72°C), using 2 U of Taq DNA polymerase (Boehringer Mannheim).
PCRs were optimized to remain in the exponential range of amplification and products were fractionated in 1.5% (w/v) agarose gels. Densitometric analysis of PCR amplicons was carried out using the Macintosh version of the public domain NIH Image 1.62 program (developed at the US National Institutes of Health and available at http://rsb.info.nih.gov/nih-image ). Densitometry data were confirmed by Phospho-imager quantitation of radioactive PCRs. Radioactive PCRs were carried out for 35 cycles (45 s at 94°C, 30 s at 60°C, 30 s at 72°C) in 50 µl reaction volumes containing 0.1 µl [[alpha]-32P]dCTP (1 µCi). PCR products were purified with Microspin S-200-HR columns (Amersham Pharmacia Biotech, Little Chalfont, UK) and analyzed on 6% denaturing polyacrylamide gels. A phosphor-imager (Instant Imager; Packard Instrument, Meriden, CT) was used to quantitate PCR amplifications normalized for the C/G content in the PCR-product sequence.
Splice site prediction was carried out using Neural Network (38) at http://www.fruitfly.org/seq_tools/splice.html and Splice View (39) at http://l25.itba.mi.cnr.it/~webgene/wwwspliceview.html ;.
Expression of the CFTR in the cell lines used for our study
Endogenous CFTR expression in NCI-H322, Hep3B and N-Muli cell lines was assayed by RT-PCR using species-specific primers. cDNA synthesis was carried out with random hexamer primers. Primers specific for human (dir, 5[prime]-gaagtagtgatggagaatgt-3[prime]; rev, 5[prime]-agaatgaaattcttccactgtgct-3[prime]) and mouse (dir, 5[prime]-agtataacttaatgaccacaggcataatc-3[prime]; rev, 5[prime]-gcttaataattccctctgaagctt-3[prime]) were used to amplify CFTR mRNA spanning exons 8-10, by PCR (35 cycles, 94°C min, 58°C 1 min, 72°C 1 min). Semi-nested PCRs were, if necessary, carried out using dir primers and rev primers (human: rev, 5[prime]-cttgctcgttgacctccactca-3[prime]; mouse: rev, 5[prime]-atccttgcacgctgacctcca-3[prime]) spanning exons 8-11 following amplification of exons 8-10. Expression of CFTR was detected in the NCI-H322 cell line after one round of PCR, whereas in Hep3B and N-Muli it was detected after the semi-nested PCR.
RNA structural mapping
In order to probe the RNA secondary structure of the human exon 9 3[prime] splice site we used single- and double-strand specific RNases.
RNA was transcribed using T7 RNA polymerase (Stratagene) from the pBluescript construct containing the human CFTR exon 9 with its flanking intronic sequences, after linearization with BamHI. Reaction mixes (100 µl final volume) contained 1 µg of RNA and 0.02 U RNase V1 (Amersham Pharmacia Biotech) or 0.5 U of RNase T1 (Sigma-Aldrich, Steinheim, Germany) in buffer A (10 mM Tris pH 7.5, 10 mM MgCl2, 50 mM KCl), or 20 U S1 nuclease (Amersham Pharmacia Biotech) in buffer B (buffer A plus 1 mM ZnSO4). The RNA was digested at 30°C for 15 min in a water bath. A control aliquot of RNA without the addition of RNase was processed simultaneously with the digested samples. Reactions were stopped by extraction with phenol-chloroform and the aqueous phase was extracted again with chloroform and ethanol precipitated in 0.3 M potassium acetate. The pellet was resuspended in 3 µl of water and RNase cleavage sites were identified by primer extension with an end-labelled oligonucleotide primer: h9rl, 5[prime]-tccagcaaccgccaacaactg-3[prime]. In a total volume of 5 µl, 10 ng of 32P-labelled primer were hybridized to the resuspended RNA in RT buffer (50 mM Tris pH 8.3, 3 mM MgCl2, 75 mM KCl). The solution was heated at 65°C for 5 min and allowed to cool for 5 min at room temperature. To each reaction we then added 15 µl of a solution in RT buffer containing 0.2 U of MoMuLV reverse transcriptase (Gibco BRL), 2 µl of 5 mM dNTP mix and 2 µl of 0.1 M DTT. The mixture was held at 42°C for 30 min and then 2 µg of RNase A were added and the mixture was incubated for a further 30 min at 37°C. It was then phenol-chloroform extracted and ethanol precipitated in 0.3 M potassium acetate. The samples (enzymatically digested RNA, control reaction and a sequencing reaction using the same primer as the RT reaction) were loaded on a 6% polyacrylamide gel which was subsequently dried and exposed to Kodak X-Omat AR films for 12-24 h.
The theoretical prediction of the RNA secondary structure of the human exon 9 3[prime] splice site was performed using the Mfold program (21,40).
ACKNOWLEDGEMENTS
We thank Roberto Marcucci for his skilful technical assistance. This work was supported by grants from the region Friuli-Venezia Giulia (no. 119/EC.FIN), from the I.R.C.S.S. Burlo Garofalo (Progetto Finalizzato; no. 1327) and from Telethon Onlus Foundation, Italy (no. E.1038).
REFERENCES
+These authors contributed equally to this work
§To whom correspondence should be addressed. Tel: +39 040 3757337; Fax: +39 040 3757361; Email: baralle{at}icgeb.trieste.it
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  E. Buratti, C. Stuani, G. De Prato, and F. E. Baralle SR protein-mediated inhibition of CFTR exon 9 inclusion: molecular characterization of the intronic splicing silencer Nucleic Acids Res., July 26, 2007; 35(13): 4359 - 4368. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Radpour, H. Gourabi, M. A. S. Gilani, and A. V. Dizaj Molecular Study of (TG)m(T)n Polymorphisms in Iranian Males With Congenital Bilateral Absence of the Vas Deferens J Androl, July 1, 2007; 28(4): 541 - 547. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Mantovani, P. Garagnani, P. Selva, C. Rossi, S. Ferrari, M. Cenci, N. Calza, V. Cerreta, D. Luiselli, and G. Romeo Simple Method for Haplotyping the Poly(TG) Repeat in Individuals Carrying the IVS8 5T Allele in the CFTR Gene Clin. Chem., March 1, 2007; 53(3): 531 - 533. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Buratti, A. Brindisi, M. Giombi, S. Tisminetzky, Y. M. Ayala, and F. E. Baralle TDP-43 Binds Heterogeneous Nuclear Ribonucleoprotein A/B through Its C-terminal Tail: AN IMPORTANT REGION FOR THE INHIBITION OF CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR EXON 9 SPLICING J. Biol. Chem., November 11, 2005; 280(45): 37572 - 37584. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Bernacki, J. C. Beck, A. K. Stankovic, L. O. Williams, J. Amos, K. Snow-Bailey, D. H. Farkas, M. J. Friez, F. M. Hantash, K. J. Matteson, et al. Genetically Characterized Positive Control Cell Lines Derived from Residual Clinical Blood Samples Clin. Chem., November 1, 2005; 51(11): 2013 - 2024. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F U Weiss, P Simon, N Bogdanova, J Mayerle, B Dworniczak, J Horst, and M M Lerch Complete cystic fibrosis transmembrane conductance regulator gene sequencing in patients with idiopathic chronic pancreatitis and controls Gut, October 1, 2005; 54(10): 1456 - 1460. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Lei and I. Vorechovsky Identification of Splicing Silencers and Enhancers in Sense Alus: a Role for Pseudoacceptors in Splice Site Repression Mol. Cell. Biol., August 15, 2005; 25(16): 6912 - 6920. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Morea, M. Cameran, A. G. Rebuffi, D. Marzenta, O. Marangon, L. Picci, F. Zacchello, and M. Scarpa Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility Mol. Hum. Reprod., August 1, 2005; 11(8): 607 - 614. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Faustino and T. A. Cooper Identification of Putative New Splicing Targets for ETR-3 Using Sequences Identified by Systematic Evolution of Ligands by Exponential Enrichment Mol. Cell. Biol., February 1, 2005; 25(3): 879 - 887. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Anyanful, K. Ono, R. C. Johnsen, H. Ly, V. Jensen, D. L. Baillie, and S. Ono The RNA-binding protein SUP-12 controls muscle-specific splicing of the ADF/cofilin pre-mRNA in C. elegans J. Cell Biol., November 22, 2004; 167(4): 639 - 647. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Kamory, B. Csokay, and Z. Hollo Rapid Detection of Cystic Fibrosis Transmembrane Conductance Regulator Gene IVS8 5T Variant by Real-Time PCR Clin. Chem., October 1, 2004; 50(10): 1837 - 1839. [Full Text] [PDF]
|
|
|
|
|
|
P. Arrisi-Mercado, M. Romano, A. F. Muro, and F. E. Baralle An Exonic Splicing Enhancer Offsets the Atypical GU-rich 3' Splice Site of Human Apolipoprotein A-II Exon 3 J. Biol. Chem., September 17, 2004; 279(38): 39331 - 39339. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Pont-Kingdon, M. Jama, C. Miller, A. Millson, and E. Lyon Long-Range (17.7 kb) Allele-Specific Polymerase Chain Reaction Method for Direct Haplotyping of R117H and IVS-8 Mutations of the Cystic Fibrosis Transmembrane Regulator Gene J. Mol. Diagn., August 1, 2004; 6(3): 264 - 270. [Abstract] [Full Text]
|
|
|
|
 |
|
 Y.-C. Li, A. B. Korol, T. Fahima, and E. Nevo Microsatellites Within Genes: Structure, Function, and Evolution Mol. Biol. Evol., June 1, 2004; 21(6): 991 - 1007. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Dayangac, H. Erdem, E. Yilmaz, A. Sahin, C. Sohn, M. Ozguc, and T. Dork Mutations of the CFTR gene in Turkish patients with congenital bilateral absence of the vas deferens Hum. Reprod., May 1, 2004; 19(5): 1094 - 1100. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Zuccato, E. Buratti, C. Stuani, F. E. Baralle, and F. Pagani An Intronic Polypyrimidine-rich Element Downstream of the Donor Site Modulates Cystic Fibrosis Transmembrane Conductance Regulator Exon 9 Alternative Splicing J. Biol. Chem., April 23, 2004; 279(17): 16980 - 16988. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. W. Hefferon, J. D. Groman, C. E. Yurk, and G. R. Cutting A variable dinucleotide repeat in the CFTR gene contributes to phenotype diversity by forming RNA secondary structures that alter splicing PNAS, March 9, 2004; 101(10): 3504 - 3509. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sebastian, S. G. Spitzer, L. E. Grosso, J. Amos, F. V. Schaefer, E. Lyon, D. J. Wolff, A. Hajianpour, A. K. Taylor, A. Millson, et al. Multicenter Characterization and Validation of the Intron-8 Poly(T) Tract (IVS8-T) Status in 25 Coriell Cell Repository Cystic Fibrosis Reference Cell Lines for Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene Mutation Assays Clin. Chem., January 1, 2004; 50(1): 251 - 254. [Full Text] [PDF]
|
|
|
|
|
|
F. Pagani, E. Buratti, C. Stuani, and F. E. Baralle Missense, Nonsense, and Neutral Mutations Define Juxtaposed Regulatory Elements of Splicing in Cystic Fibrosis Transmembrane Regulator Exon 9 J. Biol. Chem., July 11, 2003; 278(29): 26580 - 26588. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Pagani, C. Stuani, M. Tzetis, E. Kanavakis, A. Efthymiadou, S. Doudounakis, T. Casals, and F. E. Baralle New type of disease causing mutations: the example of the composite exonic regulatory elements of splicing in CFTR exon 12 Hum. Mol. Genet., May 15, 2003; 12(10): 1111 - 1120. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. A. Faustino and T. A. Cooper Pre-mRNA splicing and human disease Genes & Dev., February 15, 2003; 17(4): 419 - 437. [Full Text] [PDF]
|
|
|
|
|
|
F. Pagani, C. Stuani, E. Zuccato, A. R. Kornblihtt, and F. E. Baralle Promoter Architecture Modulates CFTR Exon 9 Skipping J. Biol. Chem., January 10, 2003; 278(3): 1511 - 1517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. DiDonato, C. L. Lorson, Y. De Repentigny, L. Simard, C. Chartrand, E. J. Androphy, and R. Kothary Regulation of murine survival motor neuron (Smn) protein levels by modifying Smn exon 7 splicing Hum. Mol. Genet., November 1, 2001; 10(23): 2727 - 2736. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Gimm, H. Chi, P. L. M. Dahia, A. Perren, R. Hinze, P. Komminoth, H. Dralle, P. R. Reynolds, and C. Eng Somatic Mutation and Germline Variants of MINPP1, a Phosphatase Gene Located in Proximity to PTEN on 10q23.3, in Follicular Thyroid Carcinomas J. Clin. Endocrinol. Metab., April 1, 2001; 86(4): 1801 - 1805. [Abstract] [Full Text]
|
|
|
|
|
|
M. Romano, R. Marcucci, and F. E. Baralle Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene Nucleic Acids Res., February 15, 2001; 29(4): 886 - 894. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. HUGHES, T. DÖRK, M. STUHRMANN, and C. GRAHAM Mutation and haplotype analysis of the CFTR gene in atypically mild cystic fibrosis patients from Northern Ireland J. Med. Genet., February 1, 2001; 38(2): 136 - 139. [Full Text]
|
|
|
|
 |
|
 P. G. NOONE, C. A. PUE, Z. ZHOU, K. J. FRIEDMAN, E. L. WAKELING, M. GANESHANANTHAN, R. H. SIMON, L. M. SILVERMAN, and M. R. KNOWLES Lung Disease Associated with the IVS8 5T Allele of the CFTR Gene Am. J. Respir. Crit. Care Med., November 1, 2000; 162(5): 1919 - 1924. [Abstract] [Full Text]
|
|
|
|
|
|
M. Nissim-Rafinia, O. Chiba-Falek, G. Sharon, A. Boss, and B. Kerem Cellular and viral splicing factors can modify the splicing pattern of CFTR transcripts carrying splicing mutations Hum. Mol. Genet., July 22, 2000; 9(12): 1771 - 1778. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Buratti and F. E. Baralle Characterization and Functional Implications of the RNA Binding Properties of Nuclear Factor TDP-43, a Novel Splicing Regulator of CFTR Exon 9 J. Biol. Chem., September 21, 2001; 276(39): 36337 - 36343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Pagani, E. Buratti, C. Stuani, M. Romano, E. Zuccato, M. Niksic, L. Giglio, D. Faraguna, and F. E. Baralle Splicing Factors Induce Cystic Fibrosis Transmembrane Regulator Exon 9 Skipping through a Nonevolutionary Conserved Intronic Element J. Biol. Chem., July 7, 2000; 275(28): 21041 - 21047. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||