| Human Molecular Genetics | Pages |
©1999 Oxford University Press |
Unusual 5[prime] transcript complexity of plectin isoforms: novel tissue-specific exons modulate actin binding activity
Introduction
Results
RACE analysis of mouse cDNAs reveals an unprecedented variety of alternative first exons (coding/non-coding) and additional exons altering the plectin ABD
The murine plectin gene locus is highly complex and maps to chromosome 15
Structural conservation of the plectin, dystonin and ACF7 N-termini extends to isoform-specific sequences preceding their highly conserved ABD
Identification of plectin variants dominant in brain, muscle and epithelia
Optimization of the plectin actin binding properties in skeletal muscle through alternative splicing
Discussion
Materials And Methods
RACE, PCR, DNA sequencing and analysis of genomic organization
Database search and sequence alignments
Chromosomal gene mapping
RNase protection assays
Expression of fusion proteins in bacteria and in vitro protein interaction assay
Acknowledgements
References
Unusual 5[prime] transcript complexity of plectin isoforms: novel tissue-specific exons modulate actin binding activity
Received July 26, 1999; Revised and Accepted September 9, 1999
Plectin, the most versatile cytolinker identified to date, has essential functions in maintaining the mechanical integrity of skin, skeletal muscle and heart, as indicated by analyses of plectin-deficient mice and humans. Expression of plectin in a vast variety of tissues and cell types, combined with a large number of different binding partners identified at the molecular level, calls for complex mechanisms regulating gene transcription and expression of the protein. To investigate these mechanisms, we analyzed the transcript diversity and genomic organization of the murine plectin gene and found a remarkable complexity of its 5[prime]-end structure. An unusually high number of 14 alternatively spliced exons, 11 of them directly splicing into plectin exon 2, were identified. Analysis of their tissue distribution revealed that expression of a few of them is restricted to tissues such as brain, or skeletal muscle and heart. In addition, we found two short exons tissue-specifically spliced into a highly conserved set of exons encoding the N-terminal actin binding domain (ABD), common to plectin and the superfamily of spectrin/dystrophin-type actin binding proteins. Using recombinant proteins we show that a novel ABD version contained in the muscle-specific isoform of plectin exhibits significantly higher actin binding activity than other splice forms. This fine tuning mechanism based on alternative splicing is likely to optimize the proposed biological role of plectin as a cytolinker opposing intense mechanical forces in tissues like striated muscle.
INTRODUCTION
Plectin, a highly versatile cytoskeletal linker protein of exceptionally large size (>500 kDa), is abundantly expressed in a wide variety of mammalian tissues and cell types. It is particularly prominent in various types of muscle, stratified and simple epithelia, and cells forming the blood-brain barrier (1,2). At the cellular level, plectin co-distributes with different types of intermediate filament (IF) and is located at plasma membrane attachment sites of IFs and microfilaments, such as hemidesmosomes (3), desmosomes (4), Z-line structures and dense plaques of striated and smooth muscle, intercalated discs of cardiac muscle, and focal contacts (5,6). At the molecular level, plectin has been shown to directly interact with membrane skeleton proteins such as fodrin and [alpha]-spectrin (7), the hemidesmosomal integrin subunit [beta]4 (8), desmosome-associated desmoplakin (4), various IF subunit proteins and actin. The interaction with vimentin, cytokeratins and desmin involves a specific binding domain located near the C-terminus of the protein (9; unpublished data), whereas a functional actin binding domain (ABD) is contained within the plectin N-terminal domain (10,11). Furthermore, whole mount electron microscopy was used to demonstrate that plectin is capable of physical linkage of IFs to microfilaments and microtubules (12,13).
Plectin has been cloned and sequenced from rat (10,14), from human (15) and partially from mouse (16). Analyses of the human gene locus revealed a complex organization of 32 exons spanning over ~32 kb of DNA located in the telomeric region (q24) of chromosome 8 (15,17). In subsequent studies, four alternative first coding exons were identified in plectin transcripts isolated from rat. Additionally, transcripts lacking exon 31, which encodes a large part of the rod domain of the molecule, were found (10). Secondary structure predictions based on the deduced amino acid sequences, as well as electron microscopy of purified plectin molecules (18), revealed a multidomain structure composed of a central ~200 nm long [alpha]-helical coiled-coil rod structure flanked by large globular domains. A similar domain organization has been found in proteins that share partial sequence homology with plectin, such as desmoplakin (19), the isoforms of bullous pemphigoid antigen (BPAG) 1 (20,21), and envoplakin (22). Sequence comparisons also revealed a highly conserved ABD consisting of a pair of calponin-like (CH) subdomains (23) found in a large family of actin binding proteins. The binding affinity of plectin for actin (11) turned out to be similar to that of other actin binding proteins such as dystonin (21), tensin (24) and dystrophin (25).
The important role of plectin as a versatile cytolinker protein is also evident from the phenotypic analysis of plectin gene knockout mice which died 2 days after birth due to severe skin blistering and clearly showed abnormalities in muscle and heart (16). Patients lacking plectin suffer from epidermolysis bullosa simplex associated with muscular dystrophy (EBS-MD) (17,26-29), a severe skin blistering disease combined with muscular dystrophy and in some cases respiratory stridor, respiratory distress involving laryngeal obstruction, and urethral strictures (30,31). The biological role and molecular structure of plectin have been the subjects of recent reviews (32,33).
The expression of plectin in a vast variety of cell types and tissues, the various pathological abnormalities resulting from plectin deficiency, and the large number of different binding partners identified so far, hint at a complex regulation of transcription and protein expression of this cytolinker protein, resulting in a number of different isoforms potentially performing diverse cellular tasks. Therefore, we have investigated in detail the transcript diversity and genomic organization of the murine plectin gene and report here the identification of a total of 16 alternatively spliced exons in the 5[prime]-region of plectin transcripts. Eleven of these were first exons spliced into a common exon 2, three were non-coding exons preceding one of the first exons, and two additional exons were optionally spliced within the plectin ABD. We analyzed the expression patterns of transcripts containing these various alternative exons in different organs and identified a number of isoforms expressed in a tissue-specific manner. Furthermore, we detected specifically altered actin binding properties of certain plectin isoforms.
RESULTS
RACE analysis of mouse cDNAs reveals an unprecedented variety of alternative first exons (coding/non-coding) and additional exons altering the plectin ABD
In our previous analyses of the human and rat plectin gene we found a total of four alternative first coding exons (exons 1, 1a, 1b and 1c) splicing into a common downstream exon (exon 2) succeeded by exons 3-32 (10,15). To analyze this situation in mouse, we performed 5[prime]- and 3[prime]-RACE experiments using cDNAs derived from different tissues and sets of nested primer pairs binding to either plectin sequences or to adapter sequences ligated to the cDNA ends. Sequencing of PCR products resulted in the identification of 11 alternative first plectin exons, including those previously identified. The seven new exons were termed exons 1d, 1e, 1f, 1g, 1h, 1i and 1j, in chronological order of their discovery (Fig. 1). By sequencing the corresponding genomic loci it was confirmed that these newly identified sequences represented single exons. In the longest 5[prime]-RACE products obtained with primers located in exons 1, 1a, 1b, 1c, 1d or 1e, putative start ATGs were preceded by in-frame stop codons designating these exons as first coding exons (Fig. 2). In the cases of exons 1f and 1g, an open reading frame extended to the 5[prime]-end of the isolated cDNAs, but no stop codons determined putative start codons. Sequence analysis of the genomic loci harboring these exons revealed an upstream in-frame stop codon in the case of exon 1f and a possible start ATG located upstream of the isolated cDNA sequence in the case of exon 1g (Fig. 2). Thus, the designation of these two exons as first coding exons remains speculative, until splice events taking place upstream of the isolated cDNAs have been ruled out. Three exons (1h, 1i and 1j) were classified as non-coding exons since they lacked possible start ATGs but contained in-frame stop codons.
Figure 1. Schematic representation of transcripts generated by alternative splicing at the 5[prime]-end of the plectin gene. A total of 11 identified alternative first exons splicing into exon 2 are shown. Six of them are first coding exons (E1, E1a, E1b, E1c, E1d and E1e), two are putative first coding exons (E1f and E1g) and three are non-coding first exons (E1h, E1i and E1j). Three additional non-coding exons (E0 and E0a, splicing into E1c, and E-1, splicing into E0a) and two optionally spliced exons (2[alpha] and 3[alpha], inserted between exons 2 and 3, and 3 and 4, respectively) are indicated. Individual exons are indicated by boxes. Empty boxes and white areas within boxes designate non-coding sequences. Black areas within boxes indicate regions coding in all cases whereas light gray areas represent sequences that are coding only in conjunction with preceding first coding exons. Lines indicate splice events.
Figure 2. cDNA and predicted amino acid sequences of alternatively spliced exons in the 5[prime]-region of the murine plectin gene. cDNA sequences are shown using upper case letters (letters in italic indicate the exon -1 cDNA sequence derived from EST clone AA268720) and non-transcribed or putative cDNA sequences derived from sequencing of genomic DNA are in lower case letters. In-frame stop codons contained in 5[prime]-untranslated sequences are underlined and the two possible start codons in exon 1g are marked with asterisks.
5[prime]-RACE experiments using exon 1c-specific primers were performed to identify cDNA sequences upstream of exon 1c, as have been described for human keratinocytes (17). Indeed, we were able to isolate two cDNA sequences upstream of exon 1c, which were different, however, from the previously reported one. We refer to these sequences as exons 0 and 0a, respectively. A comparison with databank sequences showed that exon 0a was contained within an expressed sequence tag (EST) clone (AA268720). Subsequent analysis of the genomic plectin locus revealed that this EST sequence actually consisted of two exons, referred to as exons 0a and -1. Lacking start codons following in-frame stop codons, both exons were non-coding, representing an untranslated region of ~950 bp in front of exon 1c. Exon 0 was found to be a second non-coding exon directly splicing into exon 1c (Fig. 2).
In 3[prime]-RACE experiments using primers specific for various first coding exons of plectin and in several PCR reactions using pairs of plectin-specific primers, we observed additional splice variants containing two short sequences located between exons 2 and 3, and 3 and 4, respectively. Comparison of these short sequences with the corresponding genomic loci showed that they represented novel exons flanked by conventional splice acceptor and donor sites (Table 1). Without altering the reading frame, these additional exons, termed exons 2[alpha] and 3[alpha], encoded 5 and 12 amino acids, respectively (Fig. 2). We found cDNAs containing exon 2[alpha] alone (without exon 3[alpha]) in combination with exons 1, 1b and 1d, whereas exons 2[alpha] and 3[alpha] together were found in cDNAs starting with exon 1c or 1j. No cDNAs containing exon 3[alpha] alone have been found so far. 3[prime]-RACE experiments using primers specific for the non-coding exons 1h and 1j yielded cDNAs extending up to exon 16. The first in-frame ATG of these cDNAs was located near the beginning of exon 4 (see below), and thus corresponding plectin proteins would lack a part of the ABD. In numerous additional RACE and PCR experiments using cDNAs from various mouse tissues no transcript diversity caused by alternative splicing could be detected between exons 4 and 30 (data not shown). Mouse plectin cDNAs containing the alternatively spliced exons identified so far are shown in Table 2.
Table 1. Exon-intron organization of the murine plectin gene
Exon sizes were determined by nucleotide sequencing. Sizes of exons 0, 1f, 1e, 1i, 1j, 1, 1d, 1b, 1h, 1g and 1a refer to the longest cDNAs found so far; the size of exon -1 corresponds to the sequence contained within the EST clone AA268720. The 14 bp surrounding the splice sites are shown for each exon; intron sequences are in lower case, exons in upper case. Intron sizes were determined by sequencing or restriction fragment analysis. The polyadenylation consensus sequence (AATAAA) at the 3[prime]-end of exon 32 is underlined.
Table 2. Exon composition of plectin cDNAs found by RACE or PCR
| Plectin isoform | Exon composition | Source | Primer location(s) | Experiment type |
| plec(1,2[alpha]) | 1-20 (2[alpha]) | Muscle | Exon 1 | 3[prime]-RACE |
| plec(1) | 1-3 | Testis | Exon 3 | 5[prime]-RACE |
| plec(1a) | 1a-3 | Heart | Exon 3 | 5[prime]-RACE |
| plec(1b,2[alpha]) | 1b-16 (2[alpha]) | Muscle | Exons 1b,16 | PCR |
| plec(1b) | 1b-18 | Muscle | Exons 1b,18 | PCR |
| plec(0?,1c) | 1c-16 | Brain | Exon 1c | 3[prime]-RACE |
| plec(0,1c,2[alpha]) | 0-3 (2[alpha]) | Brain | Exon 3 | 5[prime]-RACE |
| plec(0?,1c,2[alpha],3[alpha]) | 1c-16 (2[alpha], 3[alpha]) | Brain | Exon 1c | 3[prime]-RACE |
| plec(Oa,1c) | -1-1c | Testis | Exon 1c | 5[prime]-RACE |
| plec(1d,2[alpha]) | 1d-3 (2[alpha]) | Muscle | Exon 3 | 5[prime]-RACE |
| plec(1d) | 1d-3 | Heart | Exon 3 | 5[prime]-RACE |
| plec(1e,2[alpha]) | 1e-3 (2[alpha]) | Brain | Exon 3 | 5[prime]-RACE |
| plec(1e) | 1e-3 | Brain | Exon 3 | 5[prime]-RACE |
| plec(1f) | 1f-3 | Heart | Exon 3 | 5[prime]-RACE |
| plec(1g) | 1g-3 | Kidney | Exon 3 | 5[prime]-RACE |
| plec(1h) | 1h-16 | Kidney | Exon 1h | 3[prime]-RACE |
| plec(1i) | 1i-3 | Embryo | Exon 3 | 5[prime]-RACE |
| plec(1j,2[alpha],3[alpha]) | 1j-16 (2[alpha], 3[alpha]) | Embryo | Exon 1j | 3[prime]-RACE |
The murine plectin gene locus is highly complex and maps to chromosome 15
To precisely map the newly identified exons within the plectin gene locus, murine [lambda] clones, isolated previously (16) or obtained by gene walking and screening of a genomic mouse library with cDNA fragments corresponding to exons 1c and 0 ([lambda] S1 and S3), were analyzed in detail by restriction enzyme digestion, Southern blotting, and partial sequencing after subcloning into pBluescript as a series of restriction fragments. The nucleotide and, where applicable, the predicted amino acid sequences of all 5[prime]-exons identified (1, 1a, 1b, 1c, 1d, 1e, 1f, 1g, 1h, 1i, 1j, 2[alpha] and 3[alpha]) and the partial sequences of intron-exon borders, covering splice donor and acceptor consensus sequences of all mouse exons known, are shown in Figure 2 and Table 1, respectively. The positions of splice junctions reported for rat (10) and human (15) matched those of their mouse counterparts, but slight differences were found in the sizes of introns. These analyses led to the precise localization of all murine plectin exons identified (Fig. 3). In contrast to a previous study (17) in which the human exon 1c was placed at a position ~1 kb upstream of exon 2, we found that the distance between exons 1c and 2 on the genomic mouse locus is ~35 kb (Fig. 3). These data confirmed our former sequencing of the human plectin gene locus, where we have analyzed 14 kb of continuous sequence covering the region from exon 2 to upstream of exon 1, without encountering sequences corresponding to exon 1c (unpublished data). Furthermore, we were unable to identify the mouse homolog of the small non-coding exon in front of exon 1c reported by McLean et al. (17). The analyses of the murine plectin gene performed so far led to the identification of 47 exons in total, spanning a distance of ~62 kb in the genome (Fig. 3).
Figure 3. Genomic organization of the murine plectin gene. Exons are represented by black boxes, introns by lines. The corresponding genomic clones ([lambda] phage inserts) are specified below. Note expansion of the plectin gene (exons -1 to 32) over ~62 kb; exon 32 terminates at the location of the putative polyadenylation consensus sequence.
The chromosomal localization of the murine plectin gene was determined by interspecific backcross analysis using DNA progeny derived from mating of [(C57BL/6JEi × SPRET/Ei) × SPRET/Ei] mice. To identify polymorphisms usable for mapping, we amplified by PCR a 398 bp DNA fragment between exons 2 and 3 of the plectin gene in the two parental strains. Sequencing revealed an allelic difference at position 247 of the amplified fragment that created an NcoI restriction site in the C57BL/6J DNA (CCATGG versus CCGTGG in Mus spretus). Analysis of the backcross panel BSS was performed by PCR amplification and subsequent digestion with NcoI. Results from this mapping positioned the mouse plectin in the central region of mouse chromosome 15, co-segregating with Kifc2 (kinesin family member C2), Smstr3 (somatostatin receptor 3) and the anchor marker D15Mit68 (Fig. 4). This region of mouse chromosome 15 is syntenic to two different human chromosomes, 8q24 and 22q13, where the Kifc2 and Smstr3 loci, respectively, map. Since the human plectin locus has been mapped to chromosome 8q24 (15), the murine locus must be close to the translocation of the two conserved syntenic groups.
Figure 4. Mapping of the murine plectin gene to chromosome 15. (A) Map figure from the Jackson BSS backcross showing part of chromosome 15. The map is depicted with the centromere towards the top. A scale bar (3 cM) is shown to the right of the figure. Loci mapping to the same position are listed in alphabetical order. Missing typings were inferred from surrounding data where assignment was unambiguous. Raw data were obtained from http://www.jax.org/resources/documents/cmdata . (B) Haplotype figure from the Jackson BSS backcross showing part of chromosome 15 with loci linked to Plec1. Loci are listed in order with the most proximal at the top. Black boxes represent the C57BL/6JEi allele, white boxes the SPRET/Ei allele. The number of animals with each haplotype is given at the bottom of each column of boxes. Percent recombination (R) between adjacent loci is given to the right of the figure, with the standard error (SE) for each R value. Missing typings were inferred from surrounding data where assignment was unambiguous.
Structural conservation of the plectin, dystonin and ACF7 N-termini extends to isoform-specific sequences preceding their highly conserved ABD
As previously shown for rat plectin (10), the predicted amino acid sequence of mouse plectin exon 1c, in particular its C-terminal part, was remarkably similar to the corresponding parts of mouse dystonin exon A (34) and exon A of mouse ACF7 (35), a protein closely related to dystonin (Fig. 5A). Similar to the plectin exon 1c, these exons of dystonin and ACF7 are spliced directly into the first exon encoding the ABD of these proteins.
Figure 5. Protein sequence alignments of N-terminal regions of plectin isoforms and of related cytolinkers. (A) Comparison of 3[prime]-regions of plectin exon 1c and dystonin isoform A (EMBL accession no. U25158) and ACF7 isoform A (U67204). (B) Comparison of part of plectin exon 1f with dystonin isoform A[prime] (U22452) and ACF7 isoform A[prime] (U67203). (C) Alignment of actin binding domains of plectin isoforms, containing or lacking exons 2[alpha] and 3[alpha], and of selected proteins with high homology scores: ACF7 (U67203), dystonin (U25158), [beta]-spectrin (M74773) and dystrophin (M68859). Secondary structure of features are illustrated: cylinders, [alpha]-helices based on structural data and designations used for [beta]-spectrin, fimbrin and utrophin (38,40,43); ABS1-ABS3, actin binding sites as reported for other actin binding proteins (41, and references therein). Plectin exon boundaries (black triangles) and the putative start codon in exon 4 (star) are marked. All sequences shown are from mouse; numbers on the left correspond to the amino acid positions in the different proteins. Background in black indicates identical amino acids, in light gray similar amino acids; dashes indicate gaps introduced to allow maximum alignment.
Another first exon of plectin showing high similarity to alternatively spliced exons of dystonin and ACF7 was exon 1f. As shown in Figure 5B, the C-terminal amino acid sequence of this exon was nearly identical to corresponding regions of exons A[prime] of the murine dystonin (34) and ACF7 genes (35). Again, these sequences are directly spliced into the first of seven exons encoding the ABD of the proteins, indicating a highly preserved intron/exon structure in this region. In a comparison of cDNA and amino acid sequences of the remaining newly identified exons with other known sequences available from databanks, no significant homologies were found.
The region downstream of the plectin alternative first exons, encoding the ABD (exons 2-8), gave high similarity scores for ACF7 (35), dystonin (34), [beta]-spectrin (36) and dystrophin (37). However, for none of these proteins have isoforms been reported that contain equivalents of exons 2[alpha] and/or 3[alpha] (see gaps in sequence alignment shown in Fig. 5C).
Identification of plectin variants dominant in brain, muscle and epithelia
To determine the tissue distribution of plectin transcripts containing alternative exons preceding exon 2, RNase protection assays were carried out using antisense riboprobes specific for exons 1, 1a, 1b, 1c, 1d, 1e, 1f, 1g, 1h, 1i and 1j, as well as a ribosomal protein S16-specific probe included for RNA quantification (Fig. 6). Relatively high levels of plectin transcripts were measured in lung, brain, small intestine, muscle, heart and skin, whereas lower levels were detected in kidney, liver, uterus, spleen and salivary gland. With the exception of exon 1d, all alternative first exons were found in all tissues tested, although for some exons very weak signals were obtained in certain tissues. Exon 1, 1e, 1g, 1h, 1i and 1j transcripts in general showed ~10-fold lower expression compared with the highest levels of exons 1a, 1b, 1c, 1d and 1f (Fig. 6B). Plectin isoforms containing exons 1e, 1g, 1h, 1i or 1j were neither dominant nor entirely missing in any tissue tested. Exon 1f transcripts showed a similar pattern of distribution, but at higher levels of transcription.
Figure 6. Tissue distribution of alternatively spliced first exons of murine plectin transcripts. Total RNA prepared from indicated tissues was analyzed by RNase protection assay using exon-specific RNA probes. An S16 probe served as control for RNA quantification. (A) Autoradiography of RNase-protected bands. Only relevant parts of gels are shown. S16 bands displayed are from one of the 11 autoradiographs shown above. Exposure times were from 6 h to 7 days depending on signal strength. (B) Quantitative analysis of signals shown in (A). Analysis was done using a PhosphorImager and values were normalized for RNA loading (S16) and G content of the different probes. Note the two different scales used.
In contrast to the widespread expression of other transcripts, exon 1c transcripts clearly dominated in brain and were expressed in skin at relatively high levels, i.e. tissues from which exon 1c was originally isolated (10,17). Tissue-specific dominance of expression was also observed for exon 1d transcripts, which were most prominent in skeletal muscle and heart, but also detectable in skin (Fig. 6). The weak signal obtained for exon 1d in skin most likely originated from stratified muscle which was not eliminated during preparation. Thus, exon 1d is the only first coding exon of plectin known so far that seems to be exclusively expressed in a certain tissue, namely muscle. The expression pattern of exon 1a showed high transcript levels in lung, small intestine and skin, suggesting a dominance of exon 1a-containing isoforms in epithelial tissues. Exon 1-containing mRNAs were distributed over most organs tested, with a clear dominance in skeletal muscle.
To determine the tissue distribution of transcripts containing the non-coding exons 0 and 0a, RNase protection assays were performed using probes consisting of 81 bp of exon 1c joined to 109 bp of exon 0 or 0a (Fig. 7). Exon 0 transcripts were virtually exclusively expressed in brain, whereas those containing exon 0a showed a distribution similar to that of exon 1c, except that they were not dominant in brain and seemed to be more abundant in skin compared with exon 1c transcripts.
Figure 7. Tissue distribution of plectin transcripts containing the non-coding exons preceding exon 1c and optionally spliced exons 2[alpha] and 3[alpha]. (A) Autoradiography of RNase-protected bands. Only relevant parts of the gels containing fully protected probes [see (B)] are shown. Exposure times: E0-E1c and E0a-E1c, 3 days; all others 24 h. (B) Schematic representation of probes used. The expected nucleotide length (nt) of antisense probes protected by plectin mRNAs and their exon composition are indicated.
The expression pattern of exon 2[alpha]- and 3[alpha]-containing isoforms was assessed using two probes, one covering exons 2, 2[alpha] and 3, the other exons 3, 3[alpha] and 4 (Fig. 7B). Interestingly, exon 2[alpha]-containing transcripts were found to be restricted to brain, heart, skeletal muscle and skin tissues (Fig. 7A). Similarly, exon 3[alpha] was dominantly expressed in brain, and only very low amounts were detected in small intestine, muscle and skin (Fig. 7A). As exon 2[alpha] was found in skeletal and heart muscle in combination with exons 1b and 1d (Table 2), which are most prominently expressed in these tissues (Fig. 6), we examined whether in brain exon 2[alpha] is transcribed in combination with exon 1c. Using a probe for detection of transcripts containing exons 1c, 2, 2[alpha] and 3 (Fig. 7B), we found that such transcripts were indeed fully restricted to brain (Fig. 7A), irrespective of other exon 1c transcripts showing a more widespread expression (Fig. 6).
Optimization of the plectin actin binding properties in skeletal muscle through alternative splicing
The ABD of a large superfamily of cytoskeletal proteins responsible for the organization and regulation of F-actin, including fimbrin, [alpha]-actinin, spectrin, dystrophin, dystonin and calponin (to name a few), is a highly conserved domain of ~275 amino acids consisting of a pair of calponin-like subdomains (CH1 and CH2 domains). Crystal structures have been reported for the N-terminal ABD of fimbrin (38) and of the C-terminal CH domains of [beta]-spectrin (39) and utrophin (40). Each CH domain contains six [alpha]-helices, [alpha]1-[alpha]6 and [alpha]1[prime]-[alpha]6[prime], respectively, and both subdomains are connected by the central [alpha]-helix [alpha]6, which is two turns longer than its counterpart [alpha]6[prime] in CH2. Three potential actin binding sequences (ABS1-ABS3) within the ABD have been identified by biochemical analyses (41, and references therein). A number of in vitro actin binding studies with recombinant full-length and truncated protein versions of members of this protein family indicated that the actin binding interface is found mainly in the first CH domain (see for example refs 41-44). A sequence alignment including characteristic structural features of the ABDs of plectin and actin binding protein superfamily members with high sequence homology showed that plectin exons 2[alpha] and 3[alpha] are spliced into the conserved ABD in non-[alpha]-helical regions, adding sequences not present in any of the other closely related proteins, but presumably not altering the tertiary structure of this domain (Fig. 5C). Another interesting situation arose from plectin transcripts starting with one of the non-coding first exons 1h, 1i or 1j, where the first available ATG was located at the beginning of exon 4, with the resulting protein isoforms lacking the first three [alpha]-helices of CH1, including ABS1 (Fig. 5C).
In order to investigate the biological role of the alternatively spliced exons 2[alpha] and 3[alpha] and the putative shorter isoforms starting with the ATG in exon 4, we performed in vitro protein interaction assays using maltose binding protein (MBP) fusions of plectin ABD fragments expressed in bacteria. Expression constructs were generated by PCR using plectin cDNA templates covering the ABD in its entirety (complete exons 2-7 and part of exon 8), and either lacking exons [alpha] (MBP-E2-8) or containing exon 2[alpha] alone (MBP-E2-8/2[alpha]) or exons 2[alpha] and 3[alpha] (MBP-E2-8/2[alpha]3[alpha]). Additionally, we used expression constructs ranging from the putative start ATG in exon 4 to exon 8 (MBP-E4-8, corresponding to plectin transcripts containing one of the non-coding exons 1h, 1i or 1j, and lacking the first three [alpha]-helices of CH1), or from the exon 5/6 boundary into exon 8 (MBP-E6-8, lacking the entire CH1 domain) (Figs 1 and 5C). Fusion proteins were affinity purified (Fig. 8, inset), labeled with Eu3+, and used in overlay assays where rabbit skeletal muscle actin was coated onto wells of microtiter plates. Fusion proteins MBP-E2-8 and MBP-E2-8/2[alpha]3[alpha] both showed significant binding to actin. Interestingly, the shorter MBP-E4-8, lacking part of the ABD, was still capable of binding to actin to a similar extent, while MBP-E6-8, containing only the CH2 domain, failed to show any specific actin binding. MBP-E2-8/2[alpha] exhibited a significantly (~2-fold) higher binding compared with all other protein versions (Fig. 8). This is particularly exciting in the light of our finding that plectin transcripts containing exon 2[alpha] alone are the dominant forms expressed in skeletal muscle and heart (Fig. 7). Insertion of exon 2[alpha] might therefore present a means to enhance the actin binding capacity of plectin isoforms expressed in these tissues. An ABD version corresponding to a hypothetical transcript (not found in our analyses) containing exon 3[alpha] but not 2[alpha] showed binding similar to MBP-E2-8, MBP-E2-8/2[alpha]3[alpha] and MBP-E4-8 (data not shown).
Figure 8. Concentration-dependent binding of Eu3+-labeled plectin-MBP fusion proteins to immobilized rabbit skeletal muscle actin. Actin (100 nM) was coated onto microtiter plates and overlaid with increasing concentrations (20-1000 nM) of Eu3+-labeled MBP, MBP-E2-8, MBP-E2-8/2[alpha], MBP-E2-8/2[alpha]3[alpha], MBP-E4-8 and MBP-E6-8. Note that error bars not extending outside symbols are not shown. (Inset) SDS-PAGE of plectin fusion proteins expressed in bacteria. MBP fusions were purified from bacteria as described in the text and analyzed on a 12% polyacrylamide gel. Proteins were visualized by staining with Servablue-G. The predicted masses of the recombinant proteins were 77.9 (MBP-E2-8), 78.5 (MBP-E2-8/2[alpha]), 80.0 (MBP-E2-8/2[alpha]3[alpha]), 71.1 (MBP-E4-8), 65.2 (MBP-E6-8) and 50.6 kDa (MBP). Molecular weight markers are indicated.
DISCUSSION
The analysis of mouse plectin gene transcripts disclosed an unusually large number of variants differing in 5[prime]-exon composition. In total, we could identify 11 alternative first exons upstream of exon 2, two short exons spliced in between exons encoding the highly conserved N-terminal ABD of the protein, and three non-coding exons in front of one of the first coding exons (exon 1c). Such 5[prime] transcript complexity to our knowledge is unprecedented in the literature, exceeding by far that of other cytolinker proteins, including dystonin (21,34), ACF7 (35) and dystrophin (45). Moreover, as no splice variants were found downstream of exon 4, plectin transcript diversity appears to be restricted to the 5[prime]-region, except for variants without exon 31 that encode a rodless version of the protein (10).
Two 5[prime] coding sequences of the murine plectin gene characterized in this study, exons 1c and 1f, show high homology to corresponding exons of the dystonin/BPAG1n and ACF7 genes. The very high N-terminal homology of two splice variants each of plectin, dystonin and ACF7 highlights the close relationship of these proteins within the cytolinker gene family. The extensive homology of their ABDs, as revealed by sequence alignment, is solely interrupted by the optional insertion of two amino acid sequences due to alternative splicing of exons 2[alpha] and 3[alpha] in some plectin isoforms (see below). Until now no homologous sequences corresponding to exons 2[alpha] and 3[alpha] have been identified in other family members, but their existence would not come as a surprise.
In this study we determined the precise genomic localization of all plectin exons identified to date. As expected, the exon/intron structure of the mouse gene was found to be identical to that of the rat (10) and human (15,17) gene versions. However, a disparity exists between our analysis and the study of McLean et al. (17) regarding the genomic localization of exon 1c. In their analysis of the human gene, exon 1c (exon 2 in their nomenclature) was placed at a distance of ~1 kb from exon 2 (their exon 3), whereas we found exon 1c to be located ~35 kb upstream of exon 2 in mouse. Furthermore, we could not find the small non-coding exon in front of exon 1c presented by this group (their exon 1), possibly due to the shortness of this exon and sequence differences in this locus between man and mouse. The highly homologous dystonin counterparts to plectin exons 1c and 1f, exons A and A[prime], are deleted in a transgenic strain of mice (Tg4) which showed the phenotype of dystonia musculorum mice (34). Because of extensive similarities in the gene structure between plectin and dystonin, mutations in the area of plectin exons 1c and 1f may lead to a similar phenotype. A possible human counterpart of such a mouse phenotype could be hereditary motor and sensory neuropathy-Lom (HMSNL), a disease identified in gypsies (46), which was mapped by genetic linkage analysis to chromosome 8q24, the chromosomal localization of the human plectin gene. Thus, we consider it likely that the genetic defect causing HMSNL will be traced to mutations of the plectin gene in the area harboring exons 1c and 1f.
Our RNase protection mapping provided the first clear evidence for occurrence of tissue-specific or dominant plectin isoforms. Transcripts containing exon 1d were exclusively found in skeletal muscle, heart muscle and skin. Considering that the small amounts of exon 1d transcripts found in skin were probably due to contamination by underlying muscle tissue, this plectin isoform is apparently specific for striated muscle, where it might play a role in mechanical strengthening of the tissue. Thus, it is most likely that the plectin isoforms which are responsible for the muscular aspects of EBS-MD contain exon 1d. The distribution of the plec(1b) isoforms was similar to that of plec(1d) isoforms, although their expression was less restricted. Exon 1a-containing transcripts were clearly dominant in organs rich in epithelial cell types, such as lung, small intestine and skin. Also in support of this was the previous finding that a rabbit antiserum raised against a part of human exon 1a reacted specifically with plectin isoforms located at hemidesmosomes and alongside cytokeratin filaments in keratinocytes from rat skin (8). In addition, while specifically staining frozen sections of skin and lung, this anti-exon 1a antiserum failed to react with plectin isoforms expressed in skeletal muscle and heart tissues, which were readily detectable by antibodies immunoreactive with the plectin rod domain (unpublished data). Regarding exon 1-containing transcripts, RNase protection experiments using mRNAs isolated from cell lines of various types indicated that they are dominant in fibroblasts (unpublished data). The expression pattern of plec(1) isoforms in mouse organs was consistent with these findings, as we observed a clear dominance of such transcripts in organs containing high amounts of connective tissue, including muscle, skin and uterus. Transcripts containing exons 1e, 1f and 1g showed a rather broad expression pattern without precluding the possibility that they are specific for certain cell types present in the tested tissues. The three plectin isoforms containing the non-coding exons 1h, 1i and 1j were expressed at low levels with no clear preference for any organ. Since exons 1i and 1j were found in cDNAs isolated from 11-day-old embryos, isoforms containing these exons may be expressed predominantly in embryonic tissue. Both isoforms showed very similar expression patterns, suggesting that their transcription could be controlled by the same promoter.
Tissue-specific expression was characteristic also of the two alternatively spliced exons 2[alpha] and 3[alpha]. In particular, our data indicated that the splice consensus sites flanking exon 2[alpha] were exclusively recognized in brain, skeletal muscle and heart, while those flanking exon 3[alpha] were only used in brain. Exon 0, one of the non-coding exons preceding exon 1c, was also brain specific. The untranslated nucleotide sequence of this exon may have important functions for plectin mRNA targeting in neurons or glia cells. Not only single exons, but also certain combinations of exons, such as transcripts containing exons 1c, 2, 2[alpha] and 3, which were exclusively expressed in brain, showed tissue-specific expression whereas other exon 1c-containing isoforms showed a broader distribution.
Alternative splicing of exons 2[alpha] and 3[alpha] within the conserved ABD introduces short sequences of five and 12 amino acids into the non-helical regions between the first and second [alpha]-helix, and immediately following the third [alpha]-helix, respectively. The in vitro protein interaction assays performed to assess the influence of these insertions on the actin binding properties of recombinant plectin proteins revealed that the presence of exon 2[alpha], but not that of exon 2[alpha] together with 3[alpha], significantly enhanced binding to skeletal muscle actin. Together with the finding that isoforms containing exon 2[alpha], but not exon 3[alpha], are predominantly expressed in muscle and heart, this leads us to conclude that the optional splicing of these short exons might present a `fine tuning' mechanism, enabling the expression of not only tissue-specific but also `custom tailored' plectin isoforms with regard to their actin binding properties. Such proteins might represent an evolutionary solution to cope with the high mechanical stresses experienced by certain tissues, in particular muscle. Similarly, the brain-specific isoform plec(0?,1c,2[alpha],3[alpha]) may exhibit distinct actin binding characteristics for brain-specific actin.
Actin binding studies performed with versions of various proteins containing truncated ABDs revealed that the main actin binding interface lies within the more N-terminal CH domain that harbors ABS1 and ABS2. While truncated proteins lacking ABS1 were still able to bind to actin, proteins also lacking ABS2 failed to bind (42,43,47). In agreement with these data, the recombinant truncated plectin version (MBP-E4-8), putatively resulting from transcripts containing the non-coding first exons 1h, 1i or 1j, and therefore lacking a part of the CH1 domain including ABS1, but still containing ABS2, showed binding to actin that was comparable with that of the protein version containing the complete ABD (without exon 2[alpha]). Furthermore, as expected, a truncated plectin version comprising only the CH2 domain, lacking ABS1 and ABS2 (MBP-E6-8), had lost its ability to bind to actin. Interestingly, ACF7 isoform 3 (35) consists of an alternative sequence spliced into a site corresponding to the plectin exon 5/6 boundary and thus contains only the CH domain highly homologous to the plectin CH2 domain. Since the corresponding plectin protein (MBP-E6-8) failed to bind actin we predict that this ACF7 isoform behaves similarly.
The vast diversity of differentially spliced plectin transcripts, varying in 5[prime]-end structure, and their differential and in some cases selective or even exclusive expression in different tissues and cell types, as presented in this work, unfold new perspectives regarding both possible functions of expressed isoforms and regulation of gene expression. The unusual multiplicity of plectin variants distinguished by their different N-termini raises the question of what their functional significance may be. There are several possible explanations. (i) In front of all or most of the different exons 1 (exons 0) there may exist different promoters and regulatory elements controlled by distinct tissue/cell type-specific transcription factors. In this case, the specific role of different promoters and consequently of the subsequent exons 1 would be to regulate the level of plectin expression in certain cell types without influencing the properties of the molecule. (ii) Different 5[prime]-ends of transcripts may influence distinct properties of mRNAs, such as stability, or determine targeting of transcripts to specific cellular compartments. This could affect plectin expression levels locally in subcompartments of cells. (iii) Distinct N-terminal sequences encoded by alternative first exons may affect molecular properties of the protein, for instance by providing binding sites for alternative interaction partners or signals for subcellular targeting. In view of the additional diversity provided by three non-coding exons 0 preceding exon 1c, none of these possibilities may be exclusive of the others. In any case, the newly discovered plectin transcript diversity does not seem to be a mere consequence of a complex gene regulatory machinery controlling the level and the timing of plectin expression in different tissues and cell types, but it also sets up a basis for providing isoforms with different properties and functions, as we have demonstrated for the muscle-specific plectin isoform.
On the whole, like no other protein thus far analyzed, plectin seems to be fit for its proposed complex role as organizer of cytoarchitecture and regulator of cellular plasticity and morphogenesis. Further studies addressing transcription control, cell type specificity, subcellular localization and additional or distinct functionality of plectin isoforms are in progress.
MATERIALS AND METHODS
RACE, PCR, DNA sequencing and analysis of genomic organization
5[prime]- and 3[prime]-RACE as well as PCR analyses of Marathon-Ready cDNA derived from brain, heart, skeletal muscle, kidney, testis and embryo (Clontech, Palo Alto, CA) were performed using Advantage cDNA polymerase (Clontech) in a Perkin-Elmer (Norwalk, CT) GeneAmp 2400 thermal cycler, following the protocols supplied by the manufacturers. Nested plectin-specific primers were designed with a melting temperature >60°C using the Oligo 4.0 program. Optimized PCR conditions for the first PCR consisted of five cycles of 94 (5 s) and 72°C (3 min), five cycles of 94 (5 s) and 70°C (3 min), and 30 cycles of 94 (5 s) and 68°C (3 min). Aliquots of 2 µl of a 1:50 dilution of the initial PCR was used in a second round of PCR with nested primers GSP2 and AP2 (40 cycles of 94°C for 5 s, 64°C for 30 s, 72°C for 3 min). PCR products were cloned into PCR2.1 (Invitrogen, San Diego, CA) for further analyses and sequencing. Nucleotide sequences were determined by the chain termination method using the DyeDeoxy Terminator Cycle Sequencing kit (Applied Biosystems, Foster City, CA).
Genomic clones were isolated from a mouse genomic library (129 strain; Stratagene, La Jolla, CA) using rat and mouse plectin cDNA probes for screening. Exon-intron boundaries were identified by comparing murine genomic DNA and cDNA sequences from mouse (rat cDNA in the cases of the introns between exons 30 and 32). Intron sizes were determined by sequencing or restriction analysis.
Database search and sequence alignments
Database searches were performed using the BLAST program (48). All sequence alignments were generated with the CLUSTAL W program (v.1.7) (49) and prepared for publication with Boxshade (v.3.21; Kay Hofmann and Michael D. Baron, http://www.ch.embnet.org/software/BOX_form.html ).
Chromosomal gene mapping
Genetic mapping was determined using the interspecific backcross panel BSS [(C57BL/6JEi × SPRET/Ei)F1 × SPRET/Ei] from the Jackson Laboratory (Bar Harbor, ME) (50). An aliquot of 25 ng of DNA of each panel was amplified in 25 µl by PCR (40 cycles of 94°C for 10 s, 60°C for 30 s, 72°C for 2 min, and a final extension at 72°C for 7 min) using a high fidelity polymerase mix (51) and a primer pair spanning from exon 2 to exon 3 (forward primer, GGTGTTTGTTGACCCACTTGGTG; reverse primer, CGGAGGTCTTCATACAGGTCAC). Backcross progeny mice were typed by NcoI polymorphism, a restriction site present in C56BL/6J but not M.spretus. An aliquot of 10 µl of each PCR reaction was digested with NcoI in a total volume of 20 µl and analyzed by 1.8% agarose gel electrophoresis. The results were submitted to the Jackson Laboratory to be analyzed using the Map Manager program (52).
RNase protection assays
cDNA sequences used as probes were subcloned into pSP64 or pSP65 (Promega, Madison, WI) by PCR cloning using primers flanked with suitable restriction sites. RNA probes were transcribed from linearized plasmids in the presence of [[alpha]-32P]GTP (800 Ci/mmol; Dupont-NEN, Boston, MA) using SP6 RNA polymerase (Boehringer Mannheim, Mannheim, Germany) and subsequently purified on 8% polyacrylamide gels. All antisense RNAs used included a piece of vector sequence to ensure that obtained bands corresponded to protected RNA exclusively and not to remnants of undigested probes. Total RNA was extracted from tissues according to Chomczynski and Sacchi (53) and quantified by absorbance at 260 nm; the 260/280 nm absorbance ratios were ~1.6. To perform the assay, 10 µg total RNA was co-precipitated with an excess of probe (50 000 c.p.m.) and hybridized at 60°C for 16 h in 10 µl of 80% formamide, 0.4 M NaCl, 40 mM PIPES and 1 mM EDTA. To digest RNA, 350 µl of 100 U/ml RNase T1 and 5 µg/ml RNase A (both from Boehringer Mannheim) in 10 mM Tris-HCl (pH 7.5), 300 mM NaCl and 5 mM EDTA were added and mixtures incubated for 1 h at 37°C. The reaction was stopped by adding 10 µl 20% SDS and 5 µl proteinase K (20 mg/ml; Merck, Darmstadt, Germany) followed by incubation for 15 min at 37°C. Samples were extracted with phenol/chloroform, precipitated with ethanol, denatured at 90°C for 3 min, and subsequently analyzed on 8% polyacrylamide gels containing 7.7 M urea. Protected fragments were visualized by autoradiography at -78°C for from 6 h up to 7 days. A probe specific for murine ribosomal protein S16 mRNA, yielding a protected band of 90 nucleotides, served as an internal control, and was used in all samples. Signals were quantified using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) and the relative intensities obtained were normalized for the size and G content of the fragments and the amount of RNA loaded as determined by the S16 signal.
Expression of fusion proteins in bacteria and in vitro protein interaction assay
Mouse plectin cDNAs representing various isoforms lacking or containing exons 2[alpha] and/or 3[alpha] were used as templates for PCR using EcoRI-tailed primers to generate fragments containing the ABD in full, or parts of it. Amplified fragments were subcloned into the unique EcoRI site of the bacterial expression vector pMal-c (New England Biolabs, Beverly, MA). The following plectin fragments were subcloned: E2-8, starting with the first codon (GAT) of exon 2 and extending close to the end of exon 8 (GCA CAG); E2-8/2[alpha], as E2-8 but including exon 2[alpha]; E2-8/2[alpha]3[alpha], including exons 2[alpha] and 3[alpha]; E4-8, starting with the first in-frame ATG in exon 4; E6-8, starting at the last codon of exon 5. Soluble MBP-plectin fusion proteins were expressed in Escherichia coli BL21(DE3) and purified using amylose affinity chromatography. Fusion proteins were analyzed by SDS-12% PAGE under reducing conditions (54) and visualized by staining with Servablue-G (Serva, Heidelberg, Germany). Fusion proteins and MBP alone were labeled with Eu3+ labeling reagent (Wallac, Turku, Finland) as previously described (8).
Microtiter plates were coated with 100 µl of 100 nM rabbit skeletal muscle actin (Sigma, St Louis, MO) in 25 mM sodium borate buffer, pH 9.2, overnight at 4°C. Blocking was carried out with 4% BSA in overlay buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EGTA, 2 mM MgCl2, 1 mM DTT and 0.1% Tween 20) for 1 h, followed by incubation with different concentrations of Eu3+-labeled proteins (in 100 µl overlay buffer) for 90 min at room temperature. After extensive washing with overlay buffer, the amount of bound proteins was determined by measuring Eu3+ fluorescence with a Delfia time-resolved fluorometer (Wallac). The fluorescence values were converted to concentrations by comparison with an Eu3+ standard.
ACKNOWLEDGEMENTS
The help of Reinhard Ackerl in RACE and cDNA cloning experiments and of Christina Abrahamsberg in RNase protection assays is gratefully acknowledged. G.A.R. was supported by a predoctoral fellowship from the Austrian Academy of Sciences. This work was supported by grants from the Austrian Science Research Fund (P12398 and SFB006-611), Bundesministerium für Wissenschaft und Verkehr and Verein zur Erforschung von Muskelkrankheiten bei Kindern.
REFERENCES
+To whom correspondence should be addressed. Tel: +43 1 4277 52851; Fax: +43 1 4277 52854; Email: wiche{at}abc.univie.ac.at
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
This article has been cited by other articles:
![]() |
P. Fuchs, M. Zorer, S. Reipert, G. A. Rezniczek, F. Propst, G. Walko, I. Fischer, J. Bauer, M. W. Leschnik, B. Luscher, et al. Targeted Inactivation of a Developmentally Regulated Neural Plectin Isoform (Plectin 1c) in Mice Leads to Reduced Motor Nerve Conduction Velocity J. Biol. Chem., September 25, 2009; 284(39): 26502 - 26509. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kostan, M. Gregor, G. Walko, and G. Wiche Plectin Isoform-dependent Regulation of Keratin-Integrin {alpha}6{beta}4 Anchorage via Ca2+/Calmodulin J. Biol. Chem., July 3, 2009; 284(27): 18525 - 18536. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Na, F. Chowdhury, B. Tay, M. Ouyang, M. Gregor, Y. Wang, G. Wiche, and N. Wang Plectin contributes to mechanical properties of living cells Am J Physiol Cell Physiol, April 1, 2009; 296(4): C868 - C877. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Winter, C. Abrahamsberg, and G. Wiche Plectin isoform 1b mediates mitochondrion-intermediate filament network linkage and controls organelle shape J. Cell Biol., October 21, 2008; 181(6): 903 - 911. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Konieczny, P. Fuchs, S. Reipert, W. S. Kunz, A. Zeold, I. Fischer, D. Paulin, R. Schroder, and G. Wiche Myofiber integrity depends on desmin network targeting to Z-disks and costameres via distinct plectin isoforms J. Cell Biol., October 17, 2008; 181(4): 667 - 681. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hijikata, A. Nakamura, K. Isokawa, M. Imamura, K. Yuasa, R. Ishikawa, K. Kohama, S. Takeda, and H. Yorifuji Plectin 1 links intermediate filaments to costameric sarcolemma through {beta}-synemin, {alpha}-dystrobrevin and actin J. Cell Sci., June 15, 2008; 121(12): 2062 - 2074. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Rezniczek, P. Konieczny, B. Nikolic, S. Reipert, D. Schneller, C. Abrahamsberg, K. E. Davies, S. J. Winder, and G. Wiche Plectin 1f scaffolding at the sarcolemma of dystrophic (mdx) muscle fibers through multiple interactions with {beta}-dystroglycan J. Cell Biol., March 26, 2007; 176(7): 965 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Spurny, K. Abdoulrahman, L. Janda, D. Runzler, G. Kohler, M. J. Castanon, and G. Wiche Oxidation and Nitrosylation of Cysteines Proximal to the Intermediate Filament (IF)-binding Site of Plectin: EFFECTS ON STRUCTURE AND VIMENTIN BINDING AND INVOLVEMENT IN IF COLLAPSE J. Biol. Chem., March 16, 2007; 282(11): 8175 - 8187. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Abrahamsberg, P. Fuchs, S. Osmanagic-Myers, I. Fischer, F. Propst, A. Elbe-Burger, and G. Wiche Targeted ablation of plectin isoform 1 uncovers role of cytolinker proteins in leukocyte recruitment PNAS, December 20, 2005; 102(51): 18449 - 18454. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wilhelmsen, S. H.M. Litjens, I. Kuikman, N. Tshimbalanga, H. Janssen, I. van den Bout, K. Raymond, and A. Sonnenberg Nesprin-3, a novel outer nuclear membrane protein, associates with the cytoskeletal linker protein plectin J. Cell Biol., December 5, 2005; 171(5): 799 - 810. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-M. Lin, H.-J. Chen, C. L. Leung, D. A. D. Parry, and R. K. H. Liem Microtubule actin crosslinking factor 1b: a novel plakin that localizes to the Golgi complex J. Cell Sci., August 15, 2005; 118(16): 3727 - 3738. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Zhang, P. Haws, and Q. Wu Multiple Variable First Exons: A Mechanism for Cell- and Tissue-Specific Gene Regulation Genome Res., January 1, 2004; 14(1): 79 - 89. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Rezniczek, C. Abrahamsberg, P. Fuchs, D. Spazierer, and G. Wiche Plectin 5'-transcript diversity: short alternative sequences determine stability of gene products, initiation of translation and subcellular localization of isoforms Hum. Mol. Genet., December 1, 2003; 12(23): 3181 - 3194. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. Young, M. Pool, and R. Kothary Bpag1 localization to actin filaments and to the nucleus is regulated by its N-terminus J. Cell Sci., November 15, 2003; 116(22): 4543 - 4555. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H.M. Litjens, J. Koster, I. Kuikman, S. van Wilpe, J. M. de Pereda, and A. Sonnenberg Specificity of Binding of the Plectin Actin-binding Domain to {beta}4 Integrin Mol. Biol. Cell, October 1, 2003; 14(10): 4039 - 4050. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Spazierer, P. Fuchs, V. Proll, L. Janda, S. Oehler, I. Fischer, R. Hauptmann, and G. Wiche Epiplakin Gene Analysis in Mouse Reveals a Single Exon Encoding a 725-kDa Protein with Expression Restricted to Epithelial Tissues J. Biol. Chem., August 22, 2003; 278(34): 31657 - 31666. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mouchel, F. Broackes-Carter, and A. Harris Alternative 5' exons of the CFTR gene show developmental regulation Hum. Mol. Genet., April 1, 2003; 12(7): 759 - 769. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. House, I. J. Frew, H.-L. Huang, G. Wiche, N. Traficante, E. Nice, B. Catimel, and D. D. L. Bowtell A binding motif for Siah ubiquitin ligase PNAS, March 18, 2003; 100(6): 3101 - 3106. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Jensen, O. N. Jensen, P. Ravn, B. F. C. Clark, and P. Kristensen Identification of Keratinocyte-specific Markers Using Phage Display and Mass Spectrometry Mol. Cell. Proteomics, February 1, 2003; 2(2): 61 - 69. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Beil, J. Leser, M. P. Lutz, A. Gukovskaya, T. Seufferlein, G. Lynch, S. J. Pandol, and G. Adler Caspase 8-mediated cleavage of plectin precedes F-actin breakdown in acinar cells during pancreatitis Am J Physiol Gastrointest Liver Physiol, March 1, 2002; 282(3): G450 - G460. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Okumura, H. Yamakawa, O. Ohara, and K. Owaribe Novel Alternative Splicings of BPAG1 (Bullous Pemphigoid Antigen 1) Including the Domain Structure Closely Related to MACF (Microtubule Actin Cross-linking Factor) J. Biol. Chem., February 15, 2002; 277(8): 6682 - 6687. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Bauer, F. Rouan, B. Kofler, G. A. Rezniczek, I. Kornacker, W. Muss, R. Hametner, A. Klausegger, A. Huber, G. Pohla-Gubo, et al. A Compound Heterozygous One Amino-Acid Insertion/Nonsense Mutation in the Plectin Gene Causes Epidermolysis Bullosa Simplex with Plectin Deficiency Am. J. Pathol., February 1, 2001; 158(2): 617 - 625. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Fuchs and I. Karakesisoglou Bridging cytoskeletal intersections Genes & Dev., January 1, 2001; 15(1): 1 - 14. [Full Text] |
||||
![]() |
T. DiColandrea, T. Karashima, A. Maatta, and F. M. Watt Subcellular Distribution of Envoplakin and Periplakin: Insights into Their Role as Precursors of the Epidermal Cornified Envelope J. Cell Biol., October 30, 2000; 151(3): 573 - 586. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fujiwara, N. Takeo, Y. Otani, D. A. D. Parry, M. Kunimatsu, R. Lu, M. Sasaki, N. Matsuo, M. Khaleduzzaman, and H. Yoshioka Epiplakin, a Novel Member of the Plakin Family Originally Identified as a 450-kDa Human Epidermal Autoantigen. STRUCTURE AND TISSUE LOCALIZATION J. Biol. Chem., April 13, 2001; 276(16): 13340 - 13347. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




















