Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (158)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Dahia, P. L.
Right arrow Articles by Eng, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dahia, P. L.
Right arrow Articles by Eng, C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 185-193  

PTEN is inversely correlated with the cell survival factor Akt/PKB and is inactivated via multiple mechanisms in haematological malignancies
Introduction
Results
   Mutation analysis
   Deletion analysis
   PTEN transcription analysis
Discussion
Materials And Methods
   Samples
   DNA and RNA extraction
   DGGE analysis of PTEN
   Sequencing analysis
   PTEN dosage analysis
   Expression analysis
Acknowledgements
References

PTEN is inversely correlated with the cell survival factor Akt/PKB and is inactivated via multiple mechanisms in haematological malignancies

PTEN is inversely correlated with the cell survival factor Akt/PKB and is inactivated via multiple mechanisms in haematological malignancies

Patricia L. M. Dahia1,5, Ricardo C. T. Aguiar1, John Alberta2, Jennifer B. Kum1,5, Stacey Caron1, Heinz Sill3, Debbie J. Marsh1,5, Jerome Ritz1, Arnold Freedman1, CharlesStiles2 and Charis Eng1,2,4,5,*

Departments of 1Adult Oncology and 2Cancer Biology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115, USA, 3Division of Hematology, Karl-Franzens-University, Graz, Austria, 4CRC Human Cancer Genetics Research Group, University of Cambridge, Cambridge, UK and 5Human Cancer Genetics Program, Ohio State University Comprehensive Cancer Center, 420 West 12th Avenue, 690C MRF, Columbus, OH 43210, USA

Received September 30, 1998; Accepted November 19, 1998

PTEN is a novel tumour suppressor gene that encodes a dual-specificity phosphatase with homology to adhesion molecules tensin and auxillin. It recently has been suggested that PTEN dephosphorylates phosphatidylinositol 3,4,5-trisphosphate [PtdIns(3,4,5)P3], which mediates growth factor-induced activation of intracellular signalling, in particular through the serine-threonine kinase Akt, a known cell survival-promoting factor. PTEN has been mapped to 10q23.3, a region disrupted in several human tumours including haematological malignancies. We have analysed PTEN in a series of primary acute leukaemias and non-Hodgkin’s lymphomas (NHLs) as well as in cell lines. We have also examined whether a correlation could be found between PTEN and Akt levels in these samples. We show here that the majority of cell lines studied carries PTEN abnormalities. At the structural level, we found mutations and hemizygous deletions in 40% of these cell lines, while a smaller number of primary haematological malignancies, in particular NHLs, carries PTEN mutations. Moreover, one-third of the cell lines had low PTEN transcript levels, and 60% of these samples had low or absent PTEN protein, which could not be attributed to gene silencing by hypermethylation. In addition, we found that PTEN and phosphorylated Akt levels are inversely correlated in the large majority of the examined samples. These findings suggest that PTEN plays a role in the pathogenesis of haematological malignancies and that it might be inactivated through a wider range of mechanisms than initially considered. The finding that PTEN levels inversely correlate with phosphorylated Akt supports the hypothesis that PTEN regulates PtdIns(3,4,5)P3 and suggests a role for PTEN in apoptosis.

INTRODUCTION

The disruption of oncogenes or inactivation of tumour suppressor genes plays a central role in the pathogenesis of malignant diseases. In most cancer types, in particular leukaemias and lymphomas, the detailed characterization of such abnormalities has provided a basis for disease classification and has helped to define prognosis in individual patients. Furthermore, the identification of the targets for these disruptions has advanced our understanding of the mechanisms of tumorigenesis and has been valuable in the design of molecular approaches to diagnosis and to monitoring response to treatment. Chromosomal translocations resulting in novel fusion proteins or transcriptional activation of an oncogene by juxtaposition of a T cell receptor or immunoglobulin gene (1) are usually present at initial diagnosis of leukaemias and lymphomas. Conversely, inactivation of tumour suppressor genes seems to play a more relevant role, albeit not exclusively, in disease progression, usually with ominous prognostic implications (2,3). Moreover, the chromosomal disruptions leading to such abnormalities are not evenly distributed throughout the genome, but rather cluster in certain regions. In leukaemias and lymphomas, one such region is 10q22-24 (4,5).

A novel gene encoding a dual-specificity phosphatase, PTEN, also known as MMAC1 or TEP1, has been identified at chromosome sub-band 10q23.3 (6-9). Abnormalities in PTEN have thus far been studied almost exclusively in epithelial malignancies. Positive findings have been reported prominently in glioblastomas and endometrial cancer (10,11). In addition, germline mutations of PTEN have been identified in two inherited hamartoma syndromes (12,13), one of which, Cowden syndrome, is associated with an increased risk for breast and thyroid cancers. In contrast to germline mutation, an ‘early’ event in these two syndromes, it has been suggested that inactivation of PTEN might participate as a late event in certain sporadic malignancies, such as glioblastomas, in which PTEN abnormalities at the DNA level have been identified frequently in more advanced tumours (10,14).

The role of phosphatases in tumour pathogenesis has not been fully explored. While several protein kinases have been implicated as oncogenes, and phosphatases have long been known frequently to antagonize their function, there has been no direct demonstration of the role of phosphatases in tumour development (15). PTEN characterization as a bona fide tumour suppressor gene has been confirmed by studies showing growth suppression in PTEN-mutated glioblastoma cell lines after transfection of wild-type PTEN (16).

Although a full characterization of PTEN substrates still requires further investigation, there is recent in vitro evidence that PTEN dephosphorylates phosphatidylinositol 3,4,5-triphosphate [PtdIns(3,4,5)P3] and inositol phosphate via a mechanism consistent with that described for other dual-specificity phosphatases (17). PtdIns(3,4,5)P3 mediates growth factor-induced activation of intracellular signalling, in particular through the serine-threonine kinase Akt (also known as Akt1, PKB or RAC1), a known cell survival-promoting factor (18,19). Activation of Akt by growth factors is mediated by phosphatidylinositol (PI) 3-kinase, the enzyme that catalyses the phosphorylation of PtdIns(3,4,5)P3 from phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] (20,21). Until now, there has been no human in vivo evidence for an association between PTEN and Akt pathways. A recent report, however, identified high levels of phosphorylated Akt in PTEN-deficient immortalized mouse embryonic fibroblasts (22).

While most studies have focused on PTEN mutational analysis, little is yet known about its transcription levels and protein expression, especially in haematological malignancies. In this study, we have investigated comprehensively whether PTEN abnormalities are involved in the development and/or progression of these disorders. We have performed mutation analysis and examined PTEN expression at the RNA level in a large series of acute leukaemias and non-Hodgkin’s lymphomas (NHLs), both at diagnosis and on progression, as well as in related cell lines. We also generated a rabbit polyclonal PTEN antibody and assessed PTEN protein levels in the available samples. In addition, we have examined whether a correlation would be found between the levels of PTEN and Akt in these neoplasias.

RESULTS

Mutation analysis

cDNA or genomic DNA from all primary malignancies and cell lines was analysed successfully for the presence of mutations in the whole coding region of PTEN. The denaturing gradient gel electro-phoresis (DGGE) analysis revealed abnormalities in 11 samples (Table 1), including one acute myeloid leukaemia (AML) secondary to a myelodysplastic syndrome, four NHLs and six cell lines. Sequence analysis of the samples confirmed mutations in all but one case. An intronic sequence variant, IVS4+42C->T, was found in the AML; a nonsense mutation in codon 17 (Gln17Stp) that would lead to a premature termination of the protein was found in a diffuse large B cell lymphoma (DLBCL) transformed from a low-grade NHL. A 20 bp insertion in exon 7, c.703insCTCCCTAAGGAGGAATTTAT was detected in a T cell lymphoma. This mutation is predicted to result in a truncated PTEN protein with 260 amino acids. A neutral polymorphism, Gly40Gly, was detected in one DLBCL. A DGGE variant was found in exon 1 in a low-grade B cell lymphoma. However, no sequence variations were detected when this sample was sequenced. Finally, amongst the cell lines, a total of eight sequence variants were found in six cell lines (Table 1).

Table 1. Results of PTEN structural analysis in primary leukaemias, lymphomas and cell lines
Diagnosis PTEN sequence PTEN deletion Abnormal PTEN splicing
Primary samples
Myeloid leukaemias 25L IVS4+42C->T 0/7a ND
Lymphoid leukaemias   0/6a ND
NHLs Gln17Stp   ND
Gly40Gly    
c.703 ins 20 bp (stop at codon 260)    
1 DGGE variant (exon 1)b    
Cell lines
Myeloid leukaemias   KU812  
  U937  
  K562  
Lymphoid leukaemias B15; REH: R173C; N334N B15 B15
REH REH 207
NHL HT:IVS3-52 delT   DHL8, RAJI
DHL8: IVS3-52delT; Leu295Leu   DHL4, DHL10
DHL4; DHL10: IVS4+5G->T    
aChronic phase-blast crisis chronic myelocytic leukaemia paired samples.
bNo abnormality found on sequencing analysis.
ND, not done.

Deletion analysis

PTEN dosage was assessed in paired samples by a combination of restriction analysis of a frequent single nucleotide polymorphism (SNP) present at intron 8 (IVS8+32G/T) and amplification of polymorphic markers located within or flanking the PTEN locus. In addition, the cell lines were also analysed for gene dosage by means of a semi-quantitative duplex PCR using PTEN primers alongside primers for a house-keeping gene, [beta]-glucuronidase (GUSB). Fourteen paired primary samples were used for assessment of intragenic PTEN deletions: in 13 cases of chronic myelocytic leukaemia (CML), both chronic phase and blast crisis DNA were available for comparison; in one case of a de novo AML, DNA from the remission phase was also analysed (Table 1). Only one CML pair, derived from a patient with a myeloid transformation, showed a borderline loss ratio between chronic and acute phase of 1.48, with the D10S2491 dinucleotide marker, while our operational limit was 1.5 (23,24). This might have been due to the presence of normal cells in the blast crisis sample. This sample was not informative for the SNP in intron 8.

None of the cell lines had homozygous deletion of PTEN. Five cell lines, including two acute lymphoid leukaemia (ALL) cell lines (B15 and REH) and three myeloid cell lines (KU812, K562 and U937), had evidence of PTEN hemizygous deletion based on the results of four polymorphic markers within (D10S2491 and IVS8+32G/T) and flanking PTEN (D10S1687 and D10S1765). Of these, only B15 and REH had mutations detected in the remaining allele (see above; Table 1).


Figure 1. Northern blot analysis of PTEN on lymphoma and leukaemia cell lines. A PTEN-deleted glioblastoma cell line (A172) has been included as a negative control. A GAPDH probe was used to control for RNA loading.

PTEN transcription analysis

RT-PCR. All cell lines for which cDNA was available were tested for the presence of abnormally sized products indicative of alternative splicing (data not shown). In addition to a fragment of the expected size carrying a mutation in exon 6, B15 cDNA amplicon C2, spanning exons 5-7, yielded a fragment which was 141 bp shorter than the predicted size. Sequencing revealed it to lack exon 6. Skipping of exon 6 results in a truncated PTEN protein with 171 amino acids. Furthermore, two other lymphoma cell lines carrying an intronic sequence variant, DHL4 and DHL10, were found, in addition to the normal fragment, to have an alternatively spliced transcript form in which exon 4 was absent. The latter is predicted to result in a truncated 74 amino acid protein lacking the phosphatase core motif. Three other cell lines, 207, DHL8 and RAJI, were shown to carry a more complex splice variant. The first 44 bp within exon 8 were spliced out along with intron 7, and exon 7 was joined to the remaining downstream bases of exon 8, resulting in a frameshift and a truncated product of 275 amino acids. All other cell lines with sequence variation produced fragments of the expected size only.

All 23 primary lymphomas for which cDNA was available showed PTEN expression by RT-PCR, with no variation in the intensity of the PTEN band (data not shown). Because an unknown number of admixed normal cells in each sample would interfere with quantitative analysis, we did not attempt to quantify PTEN expression in these samples.


Figure 2. Western blot analysis of lymphoma and leukaemia cell lines with a rabbit polyclonal PTEN antibody recognizing the C-terminus of the protein. Analysis of the same samples with a phospho-specific Akt antibody (P-Akt) and a phosphorylation state-independent Akt antibody is shown. Sample loading was controlled by probing the membrane with a monoclonal [alpha]-tubulin antibody. A mouse fibroblast lysate was used as a positive control and the PTEN-deleted A172 glioblastoma cell line as a negative control.
Northern blot. All samples analysed, except the A172 PTEN deleted cell line, showed expression of a major PTEN transcript of 5.5 kb, as well as two smaller mRNA species of ~4.5 and 2.5 kb. However, the level of PTEN expression varied widely amongst the samples: B15, BLIN1, DHL4, DHL10, NALM6, HT, RS4;11 and RAJI showed high transcript levels, whereas BV173, HL60 and U937 had very low transcript levels and the remaining samples (207, DHL7, DHL8 and K562) showed an intermediate level of PTEN transcription (Fig. 1). The GAPDH signal confirms that unequal loading of the samples did not account for the differences observed.

Table 2. Correlation between PTEN RNA and protein levels and between PTEN and Akt protein levels in the cell lines examined
Cell lines PTEN RNAa PTEN proteina Concordance between PTEN RNA and protein Inverse correspondence between PTEN and Akt protein levels
A172 - - Yes Yes
BLIN1 +++ +++ Yes Yes
DHL4 ++ + Yes Yes
DHL10 +++ ++ Yes Yes
HL60 -/+ -/+ Yes Yes
K562 -/+ + Yes Yes
NALM6 +++ +++ Yes Yes
RS4;11 +++ +++ Yes Yes
U937 -/+ -/+ Yes Yes
207 + + Yes No
B15 +++ -/+ No No
BV173 -/+ ++ No No
DHL7 ++ -/+ No Yes
DHL8 ++ -/+ No Yes
RAJI +++ +/++ No No
REH +++ -/+ No No
HT ++ -/+ No Yes
aIntensity of the signal.

Protein analysis. A rabbit polyclonal PTEN antibody directed against the final 15 amino acids of the PTEN protein sequence was generated and used for immunoblots. All cell lines analysed showed variable levels of PTEN protein expression: BLIN1, BV173, DHL4, DHL10, NALM6 and RS4;11 showed high or intermediate protein levels, while 207, B15, DHL7, DHL8, HL60, HT, K562, RAJI, REH and U937 had low or undetectable PTEN expression (Fig. 2). In most cases, RNA and protein levels were concordant. However, in one-third of the samples, there was some discrepancy between the RNA and protein expression: while B15, REH and RAJI had high and DHL7, DHL8, HT had moderate to high levels of PTEN transcript, virtually no protein was detected in these four samples on western analysis (Table 2). On the other hand, BV173 had detectable protein despite low PTEN transcript levels.


To determine whether PTEN levels correlated with an activated form of Akt, a phosphorylation-specific Akt antibody was used in immunoblots of the same samples described above. An antibody recognizing Ser473-phosphorylated Akt was found to correlate inversely with PTEN levels in 12 of 17 cell lines, including the PTEN-deleted cell line, A172 (Fig. 2). Analysis of the same samples with a phosphorylation state-independent Akt antibody did not reveal marked variations in Akt expression (Fig. 2). In five samples, 207, B15, BV173, REH and RAJI, PTEN and Akt did not show an inverted pattern of expression. In only two of these samples, 207 and RAJI, total Akt levels were reduced in comparison with the other cell lines.

[alpha]-Tubulin analysis revealed that the loading of the samples did not account for the differences observed in either PTEN or Akt expression.

Methylation analysis. To determine whether the low PTEN transcription level in some cell lines was due to methylation, we treated HL60 and U937 cells with the demethylator agent 5-aza 2[prime]-deoxycytidine at four doses (1, 2, 5 and 10 µM) for different exposure times, from 24 to 144 h. Two cell lines with higher levels of PTEN transcription, 207 and DHL10, were used as controls. No increase in PTEN expression was noted in the cell lines examined at any of the time points analysed (24, 48, 96 and 144 h), regardless of the dose of 5-aza 2[prime]-deoxycytidine used (data not shown). CDKN2/p16 mRNA and protein expression were determined in the treated samples as a control for the activity of 5-aza 2[prime]-deoxycytidine. The increase in p16 expression was proportional to the dose and time of exposure to 5-aza 2[prime]-deoxycytidine (data not shown).

DISCUSSION

We have analysed PTEN status in a panel of primary leukaemia and lymphoma samples and cell lines. We found that while only a minority of haematological malignancies had pathogenic mutations or deletions of PTEN, low mRNA levels were present in a subset of samples and virtually no protein was detected in 40% of the cell lines tested, most of which had high transcript levels of PTEN. This suggests that PTEN might be inactivated via several mechanisms, including not only the extensively reported mutations and deletions, but also transcription silencing and disruption at the protein level.

Overall, the majority of cell lines had PTEN abnormalities either at the structural, transcriptional or protein levels. The multiple mechanisms of PTEN inactivation were distributed indistinctly amongst myeloid and lymphoid lineages. Moreover, within the same lineage, abnormalities were present regardless of the differentiation level, as seen by involvement in both multipotent cell lines (e.g. K562) and cells committed to myeloid (HL60) or monocytic differentiation (U937), as well as in pro-pre-B ALLs (REH) and B cell neoplasias (RAJI and DHLs). In addition, the majority of the samples with PTEN disruption previously have been shown to carry a molecular abnormality thought to be causative of the phenotype, such as TEL-AML1 rearrangement in REH, MLL-AF4 in RS4;11, c-myc fusion in RAJI and BCR-ABL fusion in all CML-BC cell lines (25-28). Furthermore, in several of these cell lines, disruptions of other tumour suppressor genes are present and thought to be major secondary events responsible for progression (3). This suggests that PTEN might be involved in late stages of neoplastic development, which is in agreement with what has been reported in glioblastomas (10), and possibly might represent an additional ‘second event’ in certain tumours.

CML is thought to represent an ideal model to study progression in cancer. This myeloproliferative disorder is usually identified in a ‘pre-malignant’ stage, where some degree of maturation, albeit discordant, is maintained (chronic phase) (2). Eventually, an overt block in differentiation arrest occurs, resembling an acute leukaemia (blast crisis). We have therefore examined CML samples in chronic phase and blast crisis for PTEN abnormalities. While other tumour suppressor genes, such as p53 and CDKN2A/p16, have been implicated in the progression of a subset of CML in myeloid and lymphoid transformation (3,29), respectively, it is unlikely, from our findings, that PTEN plays a role in CML progression, as there was no clear evidence for deletion or mutation in the paired cases studied. However, due to our small sample size, a larger number of cases would need to be analysed to confirm these findings. Furthermore, PTEN RNA or protein levels were not analysed in these samples and might be the actual targets of PTEN disruption in such cases. In fact, this finding of PTEN abnormality in two CML-BC cell lines supports this notion.

Amongst the remaining primary samples, it appears from our analysis that a predominance of mutations was seen in the NHLs (10% of the cases versus 1.35% in leukaemias, P = 0.05 by Fisher’s exact test). RNA and protein analysis of primary samples will be relevant to determine whether PTEN involvement is more extensive than a structural analysis might have suggested. A recent report on mutation analysis of PTEN in haematological malignancies has revealed only a small incidence of abnormalities in lymphoid samples (30). However, no RNA or protein analyses were performed in this study.

The mechanisms involved in the low PTEN transcription levels shown by some samples are not known. In two cell lines, U937 and K562, hemizygous deletion of PTEN has been detected, which might account for low RNA levels seen in this sample. In fact, a recent report on a PTEN knockout mouse model suggests that PTEN haploinsufficiency may be pathologically relevant, as malignant tumours spontaneously developed in PTEN+/- mice (31). However, it is unlikely that monoallellic expression of the gene accounts for the low expression levels of PTEN in all cases, as other hemizygously deleted cell lines (B15 and REH) had higher levels of PTEN mRNA and/or protein. In addition, a non-deleted cell line, HL60, also expressed very low levels of both mRNA and protein. This suggests that other mechanisms of transcription down-regulation might occur, such as a mutation in the promoter region of the gene, giving rise to an unstable, or even absent, transcript. Alternatively, low transcription rates could be due to methylation of PTEN. To investigate further the mechanisms involved in the variable PTEN mRNA and protein levels, we analysed the effect of a demethylator agent, 5-aza 2[prime]-deoxycytidine, in cell lines with low PTEN transcription levels. It would be expected that mRNA and, consequently, protein levels would increase if PTEN were inactivated by methylation. Neither sample with low nor high baseline PTEN showed changes in the protein levels after exposure to the demethylator agent, whereas p16 expression, used as a control, was induced in at least one of the 5-aza 2[prime]-deoxycytidine-treated cell lines. There have been controversial results regarding the occurrence of PTEN methylation in epithelial tumours. While it recently has been suggested that PTEN might be methylated in prostate cancer (32), an earlier study failed to find PTEN hypermethylation in the same type of tumour (33). It is debatable whether the low PTEN expression observed in the former study may in fact reflect methylation of a putative PTEN up-regulator rather than methylation of the PTEN gene itself. It is possible, however, that methylation of PTEN, if present, may be restricted to certain tissues only, and that factors other than methylation may account for the low mRNA levels seen in certain samples.

While, in some cases, low protein levels most likely reflect the reduced transcription levels of PTEN, in six samples, comprising four lymphoma cell lines (DHL7, DHL8, RAJI and HT) and two ALL cell lines (B15 and REH), the low protein levels were associated with high PTEN mRNA levels. This suggests that a distinct mechanism of PTEN inactivation might occur in these cases. Interestingly, in the two ALL cell lines, hemizygous deletion of PTEN with a missense mutation of the remaining allele was detected. This could indicate that an abnormally unstable protein resulted which could account for the low detection of PTEN protein in these cases. In two other samples, DHL8 and RAJI, a splicing variant resulting in a truncated PTEN product was identified in addition to the wild-type fragment on RT-PCR. It is possible that the low protein levels in these samples might be related to the lower levels of wild-type PTEN. In the remaining samples, DHL7 and HT, derived from a DLBCL and a T cell lymphoblastic lymphoma, respectively, no pathogenic mutations, deletions or aberrant splices were identified. The mechanism responsible for low PTEN levels in this case remains to be characterized.

The identification of endogenous PTEN substrates is essential for a better understanding of its intracellular role. It has been suggested recently that PtdIns(3,4,5)P3, an important second messenger involved in cell growth signalling, is a substrate for PTEN (34). PtdIns(3,4,5)P3 is produced from PtdIns(4,5)P2 by PI-3 kinase on stimulation by various ligands such as insulin, platelet-derived growth factor (PDGF) and fibroblast growth factor (FGF). One target of PtdIns(3,4,5)P3 is the proto-oncogene Akt, which is the cellular homologue of the viral oncogene v-akt (18,35). Akt codes for a serine-threonine kinase with homology to protein kinase C (PKC) (36). In addition, it contains a unique N-terminal pleckstrin homology (PH) domain, which interacts with both PtdIns(3,4,5)P3 and PtdIns(4,5)P2 in vitro (35,37). Phosphorylation of Akt, in particular at Thr308 and Ser473 residues, has been proposed to be essential for its activation (20,38). Akt has been shown to promote cell survival (19,39), and its anti-apoptotic role has been characterized in differentiating neuronal cells (40). The anti-apoptotic role of Akt is mediated through the phosphorylation of BAD, which inhibits BAD binding to Bcl-xl, resulting in suppression of apoptosis (41). We hypothesized that if PTEN was indeed involved in the PtdIns(3,4,5)P3 regulatory pathway, we would detect an inverse correlation between PTEN and phosphorylated Akt levels. In fact, we did note an inverse correlation between these two proteins in all but five samples. It is possible that in this minority of samples, Akt is activated through a pathway independent of PI-3 kinase, such as that initiated by heat shock or hyperosmolarity stress (42) or an as yet unidentified mechanism. In two samples, reduced PTEN levels were accompanied by low levels of both phosphorylated Akt and total Akt. The reasons for the discrepancy seen in these samples are not clear and require further investigation. On the other hand, PTEN activity may be regulated by other mechanisms, such as phosphorylation, subcellular localization or interactions with other proteins, and Akt levels might be associated with only certain specific conditions of PTEN activation. Unlike another member of the PKB subfamily, AKT2, which has been found to be overexpressed in ovarian and pancreatic cancer (43,44), abnormalities of Akt have not been observed consistently in human malignancies. This is the first human in vivo indication that PTEN levels are related to activated Akt levels, which reinforces the in vitro data by Maehama and Dixon (34) suggesting that PtdIns(3,4,5)P3 is a substrate for PTEN. The possibility that PTEN might counteract the activity of a survival factor suggests an indirect role for PTEN in apoptosis. This has been confirmed recently by a report describing increased cell survival accompanied by high levels of phosphorylated Akt in PTEN-deficient immortalized mouse embryo fibroblasts (22). These cells were shown to resume sensitivity to apoptosis and reduce Akt levels on expression of exogenous PTEN.

The potential involvement of PTEN in the pathogenesis of haematological malignancies is not unexpected. Phosphatases have been implicated in several critical pathways responsible for cell growth, differentiation, cytoskeletal organization and B cell activation following antigen stimulation (45). Moreover, partial or complete absence of SHP1, a tyrosine phosphatase, is known to cause a lymphoproliferative disorder in motheaten mice (46). In addition to phosphatases, it has been suggested recently that another class of proteins, the cell adhesion molecules, might also play a role in leukaemia and lymphoma pathogenesis. There is recent evidence indicating that PTEN tumour suppressor function is mediated by its ability to down-regulate cell interactions with the extracellular matrix (47), which is in keeping with its structural homology to two cell adhesion molecules, tensin and auxillin (6,7). In this study, PTEN has been shown to inhibit cell migration and integrin-mediated cell spreading and formation of focal adhesions. Furthermore, two recent reports on a PTEN knockout mouse has revealed that chimaeric mice derived from PTEN+/- cells may develop myeloproliferative features (22,31), supporting a role for PTEN in haematological malignancies.

In conclusion, we have found that the majority of human haematological malignancy cell lines studied have PTEN abnormalities either at the structural, transcriptional or protein levels, while a smaller number of primary haematological malignancies carry PTEN mutations. These findings suggest that PTEN might be inactivated through a wider range of mechanisms than initially considered and also that PTEN plays a role in the pathogenesis of haematological malignancies. Further studies with primary samples will help to delineate the extent and precise subsets of tumours which have PTEN inactivation. Finally, the finding that PTEN levels inversely correlate with phosphorylated Akt supports the hypothesis that PTEN regulates PtdIns(3,4,5)P3 levels in vivo.

MATERIALS AND METHODS

Samples

We studied a total of 136 leukaemias or lymphomas comprising 114 primary samples and 22 cell lines (48). Amongst the primary malignancies, 74 were de novo or secondary acute leukaemias and 40 were NHLs, derived almost exclusively from an adult population. In 14 cases, paired samples were available from the same patient, including 13 cases of CML both in chronic phase and blast crisis, and one acute myeloid leukaemia AML at diagnosis and upon remission. Table 3 describes in detail the leukaemias and lymphomas examined.

Table 3. Leukaemias, lymphomas and tumour cell lines studied
  Primary samples Cell lines Total
De novo Secondarya
AML 22 21 6b 49
ALL 21 10 9 40
NHL B cell T cell    
  30 10 7 47
aPost-myelodysplastic syndrome or CML-blast crisis.
bIncludes the multipotent cell K562.

DNA and RNA extraction

DNA was obtained using standard methods (2). RNA was available from 32 primary tumours and most of the cell lines and was extracted with Trizol (Gibco BRL, Gaithersburg, MD) according to the manufacturer’s guidelines. cDNA was generated using random hexamers (Promega, Madison, WI) and Superscript II RNase H- reverse transcriptase (Gibco BRL) following the manufacturer’s instructions.

DGGE analysis of PTEN

Mutation analysis was performed by DGGE. Individual PTEN exons were amplified and run on denaturing gels according to the conditions described previously (49).

Sequencing analysis

Abnormal samples on DGGE were reamplified with another set of primers, purified and sequenced as previously published (23). Three pairs of overlapping primers (cPTEN1F, CATCTCTCTCCTCCTTTTTCTTCA; cPTEN1R, ATATCATTACACCAGTTCGTCCCT; cPTEN2F, ATGGCTAAGTGAAGATGACAATCA; cPTEN2R, ACTTTGATATCACCACACACAGGT; cPTEN3F, ACGACGGGAAGACAAGTTCAT; cPTEN3R, TTTTCATGTGTTTTATCCCTCTT) spanning the entire coding region of PTEN were used to analyse the integrity of the PTEN sequence in nine DLBCLs, for which only RNA was available.

PTEN dosage analysis

PTEN dosage was assessed in paired samples by restriction analysis of a frequent SNP present at intron 8 (IVS8+32G/T) with HincII, as previously described (23). The uninformative samples were reassessed by using a dinucleotide marker located within PTEN, D10S2491 (33). Cell lines were also analysed for gene dosage by means of a semi-quantitative duplex PCR. PTEN exon 8 was co-amplified with a non-related gene, GUSB. PCR was performed as described before (50) with minor modifications: 0.8 µM of PTEN primers and 0.1 µM of GUSB primers were used in a 25 cycle PCR. A standard curve of fixed amounts of a PTEN-deleted cell line, A172, and a PTEN wild-type sample was prepared to simulate PTEN dosage of 100, 75, 50, 25 and 0%, as described (51), and included on every PCR. A ratio of densitometric values of each band was obtained for the standard curve and every individual sample using the ImageQuant software (Molecular Dynamics, Sunnyvale, CA). A PTEN:GUSB ratio of <1:2, corresponding to a loss >50%, was assigned hemizygous deletion status. Due to variable levels of admixed normal cells in the DNA samples, assignment of the hemizygous deletion status in the primary tumours would be less precise; therefore, primary samples were not included in this assay.

Further, to confirm the validity of the data obtained with the semi-quantitative assay, the samples were amplified with primers recognizing three microsatellite markers within and centromeric to PTEN D10S2491 (see above), D10S1687 and D10S1765 (http://www.gdb.org ), and haplotypes were determined using the GeneScan software (Applied Biosystems) as previously described (23). Due to the high heterozygosity rate of such markers, the likelihood of a given sample being homozygous for all three markers and also for the IVS8+32G/T SNP mentioned above would be <0.08. Therefore, the finding of homozygosity of all four markers and a PTEN dosage of <50% on the semi-quantitative assay were considered to represent hemizygous deletion of PTEN.

Expression analysis

RT-PCR. PCR using the overlapping cDNA primers described above was performed to determine whether splicing abnormalities would result from any intronic or splice site mutation detected in the sequencing analysis. In addition, a duplex RT-PCR was performed in 23 lymphomas and 16 cell lines, in which the PTEN transcript was co-amplified with the house-keeping gene GUSB. PCR conditions were as previously described (50).

Northern blot. Seventeen leukaemia and lymphoma cell lines, 207, B15, BLIN1, BV173, DHL4, DHL7, DHL8, DHL10, HL60, K562, NALM6, RAJI, REH, U937, HT and RS4;11, in addition to a glioblastoma multiforme cell line, A172, which has a deletion of PTEN (6,7), were used in this assay. Twelve micrograms of total RNA were run on an 18% formaldehyde, 1× MOPS agarose gel, transferred to a nylon membrane (Hybond; Amersham, Buckinghamshire, UK) and probed with a 32P-labelled 809 bp cDNA fragment spanning PTEN exons 5-9. The membrane was then stripped and reprobed with a glyceraldehyde phosphate dehydrogenase (GAPDH) cDNA probe to control for RNA loading.

Protein analysis. A peptide corresponding to the final 15 amino acids of the human PTEN sequence was synthesized at the Physiology Department at Tufts Medical School and was coupled to maleimide-activated keyhole limpet haemocyanin, using the IMJECT system (Pierce, Rockford, IL), following the manu-facturer’s instructions. Immune sera were generated in a New Zealand white rabbit at HRP (Denver, PA) by injecting 0.5 mg of coupled peptide in Freund’s complete adjuvant (primary injection) and 0.25 mg/injection in Freund’s incomplete adjuvant (subsequent injections). Immunoglobulin was isolated using proteinA-Sepharose column chromatography, with elution by 100 mM glycine, pH 3.0, and used for western blots.

Immunoblot analysis was performed as follows: cell lysates from 16 cell lines, 207, B15, BLIN1, BV173, DHL4, DHL7, DHL8, DHL10, HL60, HT, K562, NALM6, RAJI, REH, RS4;11 and U937, and a PTEN-deleted cell line, A172, were prepared by harvesting 1 × 107 cells. After rinsing the cell pellet with phosphate-buffered saline (PBS), it was resuspended in 400 µl of extract buffer (20 mM HEPES pH 8.0, 1% NP-40, 10% glycerol) supplemented with 2.5 mM EGTA, 0.7 µg/ml pepstatin and1× Complete Protease Inhibitor Cocktail (Boehringer Mannheim, Indianapolis, IN). Cell lysates were incubated on ice for 10 min. Samples were centrifuged at 13 000 g for 10 min, and supernatants were quantified for protein content by the Bradford assay (Sigma, St Louis, MO). Fifty micrograms of whole cell lysates were mixed with sample buffer (0.125 M Tris pH 6.8, 20% glycerol, 10% [beta]-mercaptoethanol, 4% SDS), boiled for 10 min and resolved by 10% Tris-glycine SDS-PAGE. The gel was transferred to polyvinylidene difluoride membrane (Bio-Rad, Hercules, CA) with Tris-glycine transfer buffer and the membrane was blocked with Tris-buffered saline containing 0.05% Tween and 5% skim milk for 1 h. The membrane was incubated with the PTEN antibody diluted 1:1000, followed by a goat anti-rabbit IgG conjugated with horseradish peroxidase (Bio-Rad). Detection was performed by enhanced chemiluminescence (ECL; Amersham).

To examine the levels of Akt in each sample, the membranes were also probed separately with two Akt antibodies according to the manufacturer’s guidelines (New England Biolabs, Beverly, MA). One of these antibodies recognizes an activated form of Akt, phosphorylated at Ser473, while the other is a phosphorylation state-independent Akt antibody. The blots were stripped further with 2% SDS, 0.064 M Tris pH 6.8 and [beta]-mercaptoethanol, and reprobed with a commercially available mouse monoclonal [alpha]-tubulin antibody (T-9026; Sigma) to confirm equal protein loading.

Methylation analysis. Four cell lines, HL60, U937, 207 and DHL10, were treated with the demethylator agent 5-aza 2[prime]-deoxycytidine at 1, 2, 5 and 10 µM, for 24-144 h. After splitting, cells were harvested at 24, 48, 96 and 144 h or allowed to remain an additional 24 h in media without the drug, and harvested at the end of this period, as previously described (52). RNA and whole cell lysates were obtained as described above. RT-PCR using p16 primers was performed as previously published (53). Western blot with PTEN antibody and a commercially available p16 antibody (Pharmingen, San Diego, CA) was performed as described above.

ACKNOWLEDGEMENTS

The authors thank Margaret Shipp and Nick Cross for providing some of the cell lines or cell line DNAs used in this study; Sig Verselis for assistance with cell culture; and the Molecular Biology Core Facility at the Dana-Farber Cancer Institute for running the sequencing gels. Donna Neuberg is acknowledged for statistical advice, and Oliver Gimm for his critical review of the manuscript. This study was supported by the Susan G. Komen Breast Cancer Foundation (to P.L.M.D. and C.E.), the American Cancer Society (RPG 97-064-02VM and RPG-98-211-01-CCE), the Concert for the Cure and a Barr Investigatorship (to C.E.). C.E. is the Lawrence and Susan Marx Investigator in Human Cancer Genetics.

REFERENCES

1. Rabbitts, T.H. (1994) Chromosomal translocations in human cancer. Nature, 372, 143-149. MEDLINE Abstract

2. Aguiar, R.C., Dahia, P.L., Bendit, I., Beitler, B., Dorlhiac, P., Bydlowski, S. and Chamone, D. (1995) Further evidence for the lack of correlation between the breakpoint site within M-BCR and CML prognosis and for the occasional involvement of p53 in transformation. Cancer Genet. Cytogenet., 84, 105-112. MEDLINE Abstract

3. Drexler, H.G. (1998) Review of alterations of cyclin-dependent kinase inhibitor INK4 family genes p15, p16, p18 and p19 in human leukemia-lymphoma cells. Leukemia, 12, 845-849. MEDLINE Abstract

4. Speaks, S.L., Sanger, W.G., Masih, A.S., Harrington, D.S., Hess, M. and Armitage, J.O. (1992) Recurrent abnormalities of chromosome bands 10q 23-25 in non-Hodgkin's lymphoma. Genes Chromosomes Cancer, 5, 239-243. MEDLINE Abstract

5. Aguiar, R.C., Chase, A., Oscier, D.G., Carapeti, M., Goldman, J.M. and Cross, N.C. (1997) Characterization of a t(10;12)(q24;p13) in a case of CML in transformation. Genes Chromosomes Cancer, 20, 408-411. MEDLINE Abstract

6. Steck, P.A., Pershouse, M.A., Jasser, S.A., Yung, W.K.A., Lin, H., Ligon, A.H., Langford, L.A., Baumgard, M.L., Hattier, T., Davis, T., Frye, C., Hu, R., Swedlund, B., Teng, D.H.F. and Tavtigian, S.V. (1997) Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nature Genet., 15, 356-362. MEDLINE Abstract

7. Li, J., Yen, C., Liaw, D., Podsypanina, K., Bose, S., Wang, S., Puc, J., Miliaresis, C., Rodgers, L., McCombie, R., Bigner, S.H., Giovanella, B.C., Ittman, M., Tycko, B., Hibshoosh, H., Wigler, M.H. and Parsons, R. (1997) PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast and prostate cancer. Science, 275, 1943-1947. MEDLINE Abstract

8. Li, D.-M. and Sun, H. (1997) TEP1, encoded by a candidate tumor suppressor locus, is a novel protein tyrosine phosphatase regulated by transforming growth factor B. Cancer Res., 57, 2124-2129. MEDLINE Abstract

9. Myers, M.P., Stolarov, J., Eng, C., Li, J., Wang, S.I., Wigler, M.H., Parsons, R. and Tonks, N.K. (1997) PTEN, the tumor suppressor from human chromosome 10q23, is a dual specificity phosphatase. Proc. Natl Acad. Sci. USA, 94, 9052-9057. MEDLINE Abstract

10. Rasheed, B.K., Stenzel, T.T., McLendon, R.E., Parsons, R., Friedman, A.H., Friedman, H.S., Bigner, D.D. and Bigner, S.H. (1997) PTEN gene mutations are seen in high-grade but not in low-grade gliomas. Cancer Res., 57, 4187-4190. MEDLINE Abstract

11. Risinger, J.I., Hayes, A.K., Berchuk, A. and Barrett, J.C. (1997) PTEN/MMAC1 mutations in endometrial cancers. Cancer Res., 57, 4736-4738. MEDLINE Abstract

12. Liaw, D., Marsh, D.J., Li, J., Dahia, P.L.M., Wang, S.I., Zheng, Z., Bose, S., Call, K.M., Tsou, H.C., Peacocke, M., Eng, C. and Parsons, R. (1997) Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nature Genet., 16, 64-67. MEDLINE Abstract

13. Marsh, D.J., Dahia, P.L., Zheng, Z., Liaw, D., Parsons, R., Gorlin, R.J. and Eng, C. (1997) Germline mutations in PTEN are present in Bannayan-Zonana syndrome. Nature Genet., 16, 333-334. MEDLINE Abstract

14. Wang, S.I., Puc, J., Li, J., Bruce, J.N., Cairns, P., Sidransky, D. and Parsons, R. (1997) Somatic mutations of PTEN in glioblastoma multiforme. Cancer Res., 57, 4183-4186. MEDLINE Abstract

15. Myers, M.P. and Tonks, N.K. (1997) PTEN: sometimes taking it off can be better than putting it on. Am. J. Hum. Genet., 61, 1234-1238. MEDLINE Abstract

16. Furnari, F.B., Lin, H., Huang, H.S. and Cavenee, W.K. (1997) Growth suppression of glioma cells by PTEN requires a functional phosphatase catalytic domain. Proc. Natl Acad. Sci. USA, 94, 12479-12484. MEDLINE Abstract

17. Fauman, E.B. and Saper, M.A. (1996) Structure and function of the protein tyrosine phosphatases. Trends Biochem. Sci., 21, 413-417. MEDLINE Abstract

18. Burgering, B.M. and Coffer, P.J. (1995) Protein kinase B (c-Akt) in phosphatidyl-3-OH kinase signal transduction. Nature, 376, 599-602. MEDLINE Abstract

19. Kulik, G., Klippel, A. and Weber, M.J. (1997) Antiapoptopic signalling by the insulin-like growth factor 1 receptor, phosphatidylinositol 3-kinase, and Akt. Mol. Cell. Biol., 17, 1595-1606. MEDLINE Abstract

20. Alessi, D.R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P. and Hemmings, B.A. (1996) Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J., 15, 6541-6551. MEDLINE Abstract

21. Franke, T.F., Yang, S.I., Chan, T.O., Datta, K., Kazlauskas, A., Morrison, D.K., Kaplan, D.R. and Tsichlis, P.N. (1995) The protein kinase encoded by the Akt proto-oncogene is a target of the PDGF-activated phosphatidylinositol 3-kinase. Cell, 81, 727-736. MEDLINE Abstract

22. Stambolic, V., Suzuki, A., de la Pompa, J.L., Brothers, G.M., Mirtsos, C., Sasaki, T., Ruland, J., Penniger, J.M., Siderovski, D.P. and Mak, T.W. (1998) Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell, 95, 29-39. MEDLINE Abstract

23. Dahia, P.L., Marsh, D.H., Zheng, Z., Zedenius, J., Komminoth, P., Frisk, T., Wallin, G., Parsons, R., Longy, M., Larsson, C. and Eng, C. (1997) Somatic deletions and mutations in the Cowden disease gene, PTEN, in sporadic thyroid tumors. Cancer Res., 57, 4710-4713. MEDLINE Abstract

24. Marsh, D.J., Zheng, Z., Zedenius, J., Kremer, H., Padberg, G.W., Larsson, C., Longy, M. and Eng, C. (1997) Differential loss of heterozygosity in the region of the Cowden locus within 10q22-23 in follicular thyroid adenomas and carcinomas. Cancer Res., 57, 500-503. MEDLINE Abstract

25. Uphoff, C.C., MacLeod, R.A., Denkmann, S.A., Golub, T.R., Borkhardt, A., Janssen, J.W. and Drexler, H.G. (1997) Occurrence of TEL-AML1 fusion resulting from (12;21) translocation in human early B-lineage leukemia cell lines. Leukemia, 11, 441-447. MEDLINE Abstract

26. Domer, P.H., Fakharzadeh, S.S., Chen, C.S., Jockel, J., Johansen, L., Silverman, G.A., Kersey, J.H. and Korsmeyer, S.J. (1993) Acute mixed-lineage leukemia t(4;11)(q21;q23) generates an MLL-AF4 fusion product. Proc. Natl Acad. Sci. USA, 90, 7884-7888. MEDLINE Abstract

27. Drexler, H.G. (1994) Leukemia cell lines: in vitro models for the study of chronic myeloid leukemia. Leukemia Res., 18, 919-927.

28. Hamlyn, P.H. and Rabbitts, T.H. (1983) Translocation joins c-myc and immunoglobulin gamma 1 genes in a Burkitt lymphoma revealing a third exon in the c-myc oncogene. Nature, 304, 135-139. MEDLINE Abstract

29. Sill, H., Goldman, J.M. and Cross, N.C. (1995) Homozygous deletions of the p16 tumor-suppressor gene are associated with lymphoid transformation of chronic myeloid leukemia. Blood, 85, 2013-2016. MEDLINE Abstract

30. Gronbaek, K., Zeuthen, J., Guldberg, P., Ralfkiaer, E. and Hou-Jensen, K. (1998) Alterations of the MMAC1 PTEN gene in lymphoid malignancies. Blood, 91, 4388-4390. MEDLINE Abstract

31. Di Cristofano, A., Pesce, B., Coron-Cardo, C. and Pandolfi, P.P. (1998) PTEN is essential for embryonic development and tumour suppression. Nature Genet., 19, 348-355. MEDLINE Abstract

32. Whang, Y.E., Wu, X., Suzuki, H., Reiter, R.E., Tran, C., Vessella, R.L., Said, J.W., Isaacs, W.B. and Sawyers, C.L. (1998) Inactivation of the tumor suppressor PTEN/MMAC1 in advanced human prostate cancer through loss of expression. Proc. Natl Acad. Sci. USA, 95, 5246-5250. MEDLINE Abstract

33. Cairns, P., Okami, K., Halachmi, S., Halachmi, N., Esteller, M., Herman, J.G., Jen, J., Isaacs, W.B., Bova, G.S. and Sidransky, D. (1997) Frequent inactivation of PTEN/MMAC1 in primary prostate cancer. Cancer Res., 47, 4997-5000.

34. Maehama, T. and Dixon, J.E. (1998) The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J. Biol. Chem., 273, 13375-13378. MEDLINE Abstract

35. Alessi, D.R. and Cohen, P. (1998) Mechanism of activation and function of protein kinase B. Curr. Opin. Genet. Dev., 8, 55-62. MEDLINE Abstract

36. Bellacosa, A., Testa, J.R., Staal, S.P. and Tsichlis, P.N. (1991) A retroviral oncogene, akt, encoding a serine-threonine kinase containing an SH2-like region. Science, 254, 274-277. MEDLINE Abstract

37. Franke, T.F., Kaplan, D.R., Cantley, L.C. and Toker, A. (1997) Direct regulation of the Akt proto-oncogene product by phosphatidylinositol 3,4-bisphosphate. Science, 275, 665-668. MEDLINE Abstract

38. Kitamura, T., Ogawa, W., Sakaue, H., Hino, Y., Kuroda, S., Takata, M., Matsumoto, M., Maeda, T., Konishi, H., Kikkawa, U. and Kasuga, M. (1998) Requirement for activation of the serine-threonine kinase Akt (protein kinase B) in insulin stimulation of protein synthesis but not of glucose transport. Mol. Cell. Biol., 18, 3708-3717. MEDLINE Abstract

39. Dudek, H., Datta, S.R., Franke, T.F., Birnbaum, M.J., Yao, R., Cooper, G.M., Segal, R.A., Kaplan, D.R. and Greenberg, M.E. (1997) Regulation of neuronal survival by the serine-threonine protein kinase Akt. Science, 275, 661-665. MEDLINE Abstract

40. Kennedy, S.G., Wagner, A.J., Conzen, S.D., Jordan, J., Bellacosa, A., Tsichlis, P.N. and Hay, N. (1997) The PI 3-kinase/Akt signaling pathway delivers an anti-apoptopic signal. Genes Dev., 11, 701-713. MEDLINE Abstract

41. Datta, S.R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y. and Greenberg, M.E. (1997) Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell, 91, 231-241. MEDLINE Abstract

42. Konishi, H., Matsuzaki, H., Tanaka, M., Takemura, Y., Kuroda, S., Ono, Y. and Kikkawa, U. (1997) Activation of protein kinase B (Akt/RAC-protein kinase) by cellular stress and its association with heat shock protein Hsp27. FEBS Lett., 410, 493-498. MEDLINE Abstract

43. Bellacosa, A., de Feo, D., Godwin, A.K., Bell, D.W., Cheng, J.Q., Altomare, D.A., Wan, M., Dubeau, L., Scambia, G., Masciullo, V., Ferrandina, G., Benedetti-Panici, P., Mancuso, S., Neri, G. and Testa, J.R. (1995) Molecular alterations of the AKT2 oncogene in ovarian and breast carcinomas. Int. J. Cancer, 64, 280-285. MEDLINE Abstract

44. Cheng, J.Q., Ruggeri, B., Klein, W.M., Sonoda, G., Altomare, D.A., Watson, D.K. and Testa, J.R. (1996) Amplification of AKT2 in human pancreatic cells and inhibition of AKT2 expression and tumorigenicity by antisense RNA. Proc. Natl Acad. Sci. USA, 93, 3636-3641. MEDLINE Abstract

45. Neel, B.G. (1997) Role of phosphatases in lymphocyte activation. Curr. Opin. Immunol., 9, 405-420. MEDLINE Abstract

46. Pani, G., Siminovitch, K.A. and Paige, C.J. (1997) The motheaten mutation rescues B cell signaling and development in CD45-deficient mice. J. Exp. Med., 186, 581-588. MEDLINE Abstract

47. Tamura, M., Gu, J., Matsumoto, K., Aota, S., Parsons, R. and Yamada, K.M. (1998) Inhibition of cell migration, spreading, and focal adhesion by tumor suppressor PTEN. Science, 280, 1614-1617. MEDLINE Abstract

48. Wormann, B., Anderson, J.M., Liberty, J.A., Gajl-Peczalska, K., Brunning, R.D., Silberman, T.L., Arthur, D.C. and LeBien, T.W. (1989) Establishment of a leukemic cell model for studying pre-B to B cell differentiation. J. Immunol., 142, 110-117. MEDLINE Abstract

49. Marsh, D.J., Roth, S., Lunetta, K.L., Hemminki, A., Dahia, P.L., Sistonen, P., Zheng, Z., Caron, S., van Orsouw, N.J., Bodmer, W.F., Cottrell, S.E., Dunlop, M.G., Eccles, D., Hodgson, S.V., Jarvinen, H., Kellokumpu, I., Markie, D., Neale, K., Phillips, R., Rozen, P., Sygnal, S., Vijg, J., Tomlinson, I.P., Aaltonen, L.A. and Eng, C. (1997) Exclusion of PTEN and 10q22-24 as the susceptibility locus for juvenile polyposis syndrome. Cancer Res., 57, 5017-5021. MEDLINE Abstract

50. Dahia, P.L., FitzGerald, M.G., Zhang, X., Marsh, D.J., Zheng, Z., Pietsh, T., von Deimling, A., Haluska, F.G., Haber, D.A. and Eng, C. (1998) A highly conserved processed PTEN pseudogene is located on chromosome band 9p21. Oncogene, 16, 2403-2406. MEDLINE Abstract

51. Aguiar, R.C., Dahia, P.L., Sill, H., Toledo, S.P., Goldman, J.M. and Cross, N.C. (1996) Deletion analysis of the p16 tumour suppressor gene in phaeochromocytomas. Clin. Endocrinol., 45, 93-96.

52. Otterson, G.A., Khleif, S.N., Chen, W., Coxon, A.B. and Kaye, F.J. (1995) CDKN2 gene silencing in lung cancer by DNA hypermethylation and kinetics of p16INK4 protein induction by 5-aza 2[prime]deoxycytidine. Oncogene, 11, 1211-1216. MEDLINE Abstract

53. Woloschak, M., Yu, A., Xiao, J. and Post, K.D. (1996) Frequent loss of the p16INK4a gene product in human pituitary tumors. Cancer Res., 56, 2493-2496. MEDLINE Abstract

*To whom correspondence should be addressed at the Ohio State University Comprehensive Cancer Center. Tel: +1 614 688 4508; Fax: +1 614 688 4245; Email: eng-1{at}medctr.osu.edu

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 4 Feb 1999
Copyright©Oxford University Press, 1999.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Sci SignalHome page
G. Firaguay and J. A. Nunes
Analysis of Signaling Events by Dynamic Phosphoflow Cytometry
Sci. Signal., September 1, 2009; 2(86): pl3 - pl3.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
C. Xie, R. Patel, T. Wu, J. Zhu, T. Henry, M. Bhaskarabhatla, R. Samudrala, K. Tus, Y. Gong, H. Zhou, et al.
PI3K/AKT/mTOR hypersignaling in autoimmune lymphoproliferative disease engendered by the epistatic interplay of Sle1b and FASlpr
Int. Immunol., April 1, 2007; 19(4): 509 - 522.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M. M. Stanford, J. W. Barrett, S. H. Nazarian, S. Werden, and G. McFadden
Oncolytic Virotherapy Synergism with Signaling Inhibitors: Rapamycin Increases Myxoma Virus Tropism for Human Tumor Cells
J. Virol., February 1, 2007; 81(3): 1251 - 1260.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. Uddin, A. R. Hussain, A. K. Siraj, P. S. Manogaran, N. A. Al-Jomah, A. Moorji, V. Atizado, F. Al-Dayel, A. Belgaumi, H. El-Solh, et al.
Role of phosphatidylinositol 3'-kinase/AKT pathway in diffuse large B-cell lymphoma survival
Blood, December 15, 2006; 108(13): 4178 - 4186.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
F. Okahara, K. Itoh, A. Nakagawara, M. Murakami, Y. Kanaho, and T. Maehama
Critical Role of PICT-1, a Tumor Suppressor Candidate, in Phosphatidylinositol 3,4,5-Trisphosphate Signals and Tumorigenic Transformation
Mol. Biol. Cell, November 1, 2006; 17(11): 4888 - 4895.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
A. Mirmohammadsadegh, A. Marini, S. Nambiar, M. Hassan, A. Tannapfel, T. Ruzicka, and U. R. Hengge
Epigenetic Silencing of the PTEN Gene in Melanoma.
Cancer Res., July 1, 2006; 66(13): 6546 - 6552.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
L. I. Yoo, D. W. Liu, S. L. Vu, R. T. Bronson, H. Wu, and J. Yuan
Pten Deficiency Activates Distinct Downstream Signaling Pathways in a Tissue-Specific Manner
Cancer Res., February 15, 2006; 66(4): 1929 - 1939.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
A. Hachem and R. B. Gartenhaus
Oncogenes as molecular targets in lymphoma
Blood, September 15, 2005; 106(6): 1911 - 1923.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. C. Subauste, P. Nalbant, E. D. Adamson, and K. M. Hahn
Vinculin Controls PTEN Protein Level by Maintaining the Interaction of the Adherens Junction Protein {beta}-Catenin with the Scaffolding Protein MAGI-2
J. Biol. Chem., February 18, 2005; 280(7): 5676 - 5681.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
P. G. Smith, F. Wang, K. N. Wilkinson, K. J. Savage, U. Klein, D. S. Neuberg, G. Bollag, M. A. Shipp, and R. C. T. Aguiar
The phosphodiesterase PDE4B limits cAMP-associated PI3K/AKT-dependent apoptosis in diffuse large B-cell lymphoma
Blood, January 1, 2005; 105(1): 308 - 316.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
A. Goel, C. N. Arnold, D. Niedzwiecki, J. M. Carethers, J. M. Dowell, L. Wasserman, C. Compton, R. J. Mayer, M. M. Bertagnolli, and C. R. Boland
Frequent Inactivation of PTEN by Promoter Hypermethylation in Microsatellite Instability-High Sporadic Colorectal Cancers
Cancer Res., May 1, 2004; 64(9): 3014 - 3021.
[Abstract] [Full Text] [PDF]

Home page
 Sci Aging Knowl EnvironHome page
P. Kaminker
Is Akt the Mastermind Behind Age-Related Heart Disease?
Sci. Aging Knowl. Environ., February 25, 2004; 2004(8): pe8 - 8.
[Abstract] [Full Text]

Home page
 BloodHome page
Q. Xu, S.-E. Simpson, T. J. Scialla, A. Bagg, and M. Carroll
Survival of acute myeloid leukemia cells requires PI3 kinase activation
Blood, August 1, 2003; 102(3): 972 - 980.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Xu, J. E. Yeon, H. Chang, G. Tison, G. J. Chen, J. Wands, and S. de la Monte
Ethanol Impairs Insulin-stimulated Neuronal Survival in the Developing Brain: ROLE OF PTEN PHOSPHATASE
J. Biol. Chem., July 11, 2003; 278(29): 26929 - 26937.
[Abstract] [Full Text] [PDF]

Home page
 JNCI J Natl Cancer InstHome page
T. Kumagai, J. O'Kelly, J. W. Said, and H. P. Koeffler
Vitamin D2 Analog 19-nor-1,25-Dihydroxyvitamin D2: Antitumor Activity Against Leukemia, Myeloma, and Colon Cancer Cells
J Natl Cancer Inst, June 18, 2003; 95(12): 896 - 905.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. M. Stahl, M. Cheung, A. Sharma, N. R. Trivedi, S. Shanmugam, and G. P. Robertson
Loss of PTEN Promotes Tumor Development in Malignant Melanoma
Cancer Res., June 1, 2003; 63(11): 2881 - 2890.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
L. M. Neri, P. Borgatti, P. L. Tazzari, R. Bortul, A. Cappellini, G. Tabellini, A. Bellacosa, S. Capitani, and A. M. Martelli
The Phosphoinositide 3-Kinase/AKT1 Pathway Involvement in Drug and All-Trans-Retinoic Acid Resistance of Leukemia Cells
Mol. Cancer Res., January 1, 2003; 1(3): 234 - 246.
[Abstract] [Full Text]

Home page
 Cancer Res.Home page
P. Dhawan, A. B. Singh, D. L. Ellis, and A. Richmond
Constitutive Activation of Akt/Protein Kinase B in Melanoma Leads to Up-Regulation of Nuclear Factor-{kappa}B and Tumor Progression
Cancer Res., December 15, 2002; 62(24): 7335 - 7342.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
V. Modur, R. Nagarajan, B. M. Evers, and J. Milbrandt
FOXO Proteins Regulate Tumor Necrosis Factor-related Apoptosis Inducing Ligand Expression. IMPLICATIONS FOR PTEN MUTATION IN PROSTATE CANCER
J. Biol. Chem., November 27, 2002; 277(49): 47928 - 47937.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
G. D. Girnun, W. M. Smith, S. Drori, P. Sarraf, E. Mueller, C. Eng, P. Nambiar, D. W. Rosenberg, R. T. Bronson, W. Edelmann, et al.
APC-dependent suppression of colon carcinogenesis by PPARgamma
PNAS, October 15, 2002; 99(21): 13771 - 13776.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
X. Shi, C. Xie, D. Kreska, J. A. Richardson, and C. Mohan
Genetic Dissection of SLE: SLE1 and FAS Impact Alternate Pathways Leading to Lymphoproliferative Autoimmunity
J. Exp. Med., August 5, 2002; 196(3): 281 - 292.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
L.-P. Weng, J. L. Brown, K. M. Baker, M. C. Ostrowski, and C. Eng
PTEN blocks insulin-mediated ETS-2 phosphorylation through MAP kinase, independently of the phosphoinositide 3-kinase pathway
Hum. Mol. Genet., July 15, 2002; 11(15): 1687 - 1696.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
H. Wang, W. Douglas, M. Lia, W. Edelmann, R. Kucherlapati, K. Podsypanina, R. Parsons, and L. H. Ellenson
DNA Mismatch Repair Deficiency Accelerates Endometrial Tumorigenesis in Pten Heterozygous Mice
Am. J. Pathol., April 1, 2002; 160(4): 1481 - 1486.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. DiRenzo, S. Signoretti, N. Nakamura, R. Rivera-Gonzalez, W. Sellers, M. Loda, and M. Brown
Growth Factor Requirements and Basal Phenotype of an Immortalized Mammary Epithelial Cell Line
Cancer Res., January 1, 2002; 62(1): 89 - 98.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Nomura, A. Kaji, Z. He, W.-Y. Ma, K.-i. Miyamoto, C. S. Yang, and Z. Dong
Inhibitory Mechanisms of Tea Polyphenols on the Ultraviolet B-activated Phosphatidylinositol 3-Kinase-dependent Pathway
J. Biol. Chem., November 30, 2001; 276(49): 46624 - 46631.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Thakkar, X. Chen, F. Tyan, S. Gim, H. Robinson, C. Lee, S. K. Pandey, C. Nwokorie, N. Onwudiwe, and R. K. Srivastava
Pro-survival Function of Akt/Protein Kinase B in Prostate Cancer Cells. RELATIONSHIP WITH TRAIL RESISTANCE
J. Biol. Chem., October 12, 2001; 276(42): 38361 - 38369.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
G. B. Mills, Y. Lu, and E. C. Kohn
Linking molecular therapeutics to molecular diagnostics: Inhibition of the FRAP/RAFT/TOR component of the PI3K pathway preferentially blocks PTEN mutant cells in vitro and in vivo
PNAS, August 28, 2001; 98(18): 10031 - 10033.
[Full Text] [PDF]

Home page
 Cancer Res.Home page
M. D. Ringel, N. Hayre, J. Saito, B. Saunier, F. Schuppert, H. Burch, V. Bernet, K. D. Burman, L. D. Kohn, and M. Saji
Overexpression and Overactivation of Akt in Thyroid Carcinoma
Cancer Res., August 1, 2001; 61(16): 6105 - 6111.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
L. Simpson, J. Li, D. Liaw, I. Hennessy, J. Oliner, F. Christians, and R. Parsons
PTEN Expression Causes Feedback Upregulation of Insulin Receptor Substrate 2
Mol. Cell. Biol., June 15, 2001; 21(12): 3947 - 3958.
[Abstract] [Full Text]

Home page
 J. Clin. Endocrinol. Metab.Home page
R. C. T. Aguiar, G. Cox, S. L. Pomeroy, and P. L. M. Dahia
Analysis of the SDHD Gene, the Susceptibility Gene for Familial Paraganglioma Syndrome (PGL1), in Pheochromocytomas
J. Clin. Endocrinol. Metab., June 1, 2001; 86(6): 2890 - 2894.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
G. L. Mutter, T. A. Ince, J. P. A. Baak, G. A. Kust, X.-P. Zhou, and C. Eng
Molecular Identification of Latent Precancers in Histologically Normal Endometrium
Cancer Res., June 1, 2001; 61(11): 4311 - 4314.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
X. Zhu, C.-H. Kwon, P. W. Schlosshauer, L. H. Ellenson, and S. J. Baker
PTEN Induces G1 Cell Cycle Arrest and Decreases Cyclin D3 Levels in Endometrial Carcinoma Cells
Cancer Res., June 1, 2001; 61(11): 4569 - 4575.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
K. Kurose, X.-P. Zhou, T. Araki, S. A. Cannistra, E. R. Maher, and C. Eng
Frequent Loss of PTEN Expression Is Linked to Elevated Phosphorylated Akt Levels, but Not Associated with p27 and Cyclin D1 Expression, in Primary Epithelial Ovarian Carcinomas
Am. J. Pathol., June 1, 2001; 158(6): 2097 - 2106.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J.-i. Hisatake, J. O'Kelly, M. R. Uskokovic, S. Tomoyasu, and H. P. Koeffler
Novel vitamin D3 analog, 21-(3-methyl-3-hydroxy-butyl)-19-nor D3, that modulates cell growth, differentiation, apoptosis, cell cycle, and induction of PTEN in leukemic cells
Blood, April 15, 2001; 97(8): 2427 - 2433.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
O. Gimm, H. Chi, P. L. M. Dahia, A. Perren, R. Hinze, P. Komminoth, H. Dralle, P. R. Reynolds, and C. Eng
Somatic Mutation and Germline Variants of MINPP1, a Phosphatase Gene Located in Proximity to PTEN on 10q23.3, in Follicular Thyroid Carcinomas
J. Clin. Endocrinol. Metab., April 1, 2001; 86(4): 1801 - 1805.
[Abstract] [Full Text]

Home page
 Hum Mol GenetHome page
L.-P. Weng, O. Gimm, J. B. Kum, W. M. Smith, X.-P. Zhou, D. Wynford-Thomas, G. Leone, and C. Eng
Transient ectopic expression of PTEN in thyroid cancer cell lines induces cell cycle arrest and cell type-dependent cell death
Hum. Mol. Genet., February 1, 2001; 10(3): 251 - 258.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
T. Hyun, A. Yam, S. Pece, X. Xie, J. Zhang, T. Miki, J. S. Gutkind, and W. Li
Loss of PTEN expression leading to high Akt activation in human multiple myelomas
Blood, November 15, 2000; 96(10): 3560 - 3568.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
X.-P. Zhou, O. Gimm, H. Hampel, T. Niemann, M. J. Walker, and C. Eng
Epigenetic PTEN Silencing in Malignant Melanomas without PTEN Mutation
Am. J. Pathol., October 1, 2000; 157(4): 1123 - 1128.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
O. Gimm, T. Attie-Bitach, J. A. Lees, M. Vekemans, and C. Eng
Expression of the PTEN tumour suppressor protein during human development
Hum. Mol. Genet., July 1, 2000; 9(11): 1633 - 1639.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
V. Stambolic, M.-S. Tsao, D. Macpherson, A. Suzuki, W. B. Chapman, and T. W. Mak
High Incidence of Breast and Endometrial Neoplasia Resembling Human Cowden Syndrome in pten+/- Mice
Cancer Res., July 1, 2000; 60(13): 3605 - 3611.
[Abstract] [Full Text]

Home page
 JNCI J Natl Cancer InstHome page
G. L. Mutter, M.-C. Lin, J. T. Fitzgerald, J. B. Kum, J. P. A. Baak, J. A. Lees, L.-P. Weng, and C. Eng
Altered PTEN Expression as a Diagnostic Marker for the Earliest Endometrial Precancers
J Natl Cancer Inst, June 7, 2000; 92(11): 924 - 930.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
X.-P. Zhou, W. M Smith, O. Gimm, E. Mueller, X. Gao, P. Sarraf, T. W Prior, C. Plass, A. von Deimling, P. M. Black, et al.
Over-representation of PPARgamma sequence variants in sporadic cases of glioblastoma multiforme: preliminary evidence for common low penetrance modifiers for brain tumour risk in the general population
J. Med. Genet., June 1, 2000; 37(6): 410 - 414.
[Abstract] [Full Text]

Home page
 Am. J. Pathol.Home page
O. Gimm, A. Perren, L.-P. Weng, D. J. Marsh, J. J. Yeh, U. Ziebold, E. Gil, R. Hinze, L. Delbridge, J. A. Lees, et al.
Differential Nuclear and Cytoplasmic Expression of PTEN in Normal Thyroid Tissue, and Benign and Malignant Epithelial Thyroid Tumors
Am. J. Pathol., May 1, 2000; 156(5): 1693 - 1700.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
X. Wu, K. Hepner, S. Castelino-Prabhu, D. Do, M. B. Kaye, X.-J. Yuan, J. Wood, C. Ross, C. L. Sawyers, and Y. E. Whang
Evidence for regulation of the PTEN tumor suppressor by a membrane-localized multi-PDZ domain containing scaffold protein MAGI-2
PNAS, April 11, 2000; 97(8): 4233 - 4238.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
P. Zhang and B. M. Steinberg
Overexpression of PTEN/MMAC1 and Decreased Activation of Akt in Human Papillomavirus-infected Laryngeal Papillomas
Cancer Res., March 1, 2000; 60(5): 1457 - 1462.
[Abstract] [Full Text]

Home page
 J. Clin. Endocrinol. Metab.Home page
Balanced Translocation of 10q and 13q, Including the PTENGene, in a Boy with a Human Chorionic Gonadotropin-Secreting Tumor and the Bannayan-Riley-Ruvalcaba Syndrome
J. Clin. Endocrinol. Metab., December 1, 1999; 84(12): 4665 - 4670.
[Full Text]

Home page
 JNCI J Natl Cancer InstHome page
I. U. Ali, L. M. Schriml, and M. Dean
Mutational Spectra of PTEN/MMAC1 Gene: a Tumor Suppressor With Lipid Phosphatase Activity
J Natl Cancer Inst, November 17, 1999; 91(22): 1922 - 1932.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
L.-P. Weng, W. M. Smith, P. L. M. Dahia, U. Ziebold, E. Gil, J. A. Lees, and C. Eng
PTEN Suppresses Breast Cancer Cell Growth by Phosphatase Activity-dependent G1 Arrest followed by Cell Death
Cancer Res., November 1, 1999; 59(22): 5808 - 5814.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
R. C.T. Aguiar, Y. Yakushijin, S. Kharbanda, S. Tiwari, G. J. Freeman, and M. A. Shipp
PTPROt: An Alternatively Spliced and Developmentally Regulated B-Lymphoid Phosphatase That Promotes G0/G1 Arrest
Blood, October 1, 1999; 94(7): 2403 - 2413.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
A. D. Cristofano, P. Kotsi, Y. F. Peng, C. Cordon-Cardo, K. B. Elkon, and P. P. Pandolfi
Impaired Fas Response and Autoimmunity in Pten+/ Mice
Science, September 24, 1999; 285(5436): 2122 - 2125.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
T. W. Kelley, M. M. Graham, A. I. Doseff, R. W. Pomerantz, S. M. Lau, M. C. Ostrowski, T. F. Franke, and C. B. Marsh
Macrophage Colony-stimulating Factor Promotes Cell Survival through Akt/Protein Kinase B
J. Biol. Chem., September 10, 1999; 274(37): 26393 - 26398.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
E.-M. Duerr, O. Gimm, D. S. Neuberg, J. B. Kum, S. C. Clifford, S. P. A. Toledo, E. R. Maher, P. L. M. Dahia, and C. Eng
Differences in Allelic Distribution of Two Polymorphisms in the VHL-Associated Gene CUL2 in Pheochromocytoma Patients without Somatic CUL2 Mutations
J. Clin. Endocrinol. Metab., September 1, 1999; 84(9): 3207 - 3211.
[Abstract] [Full Text]

Home page
 BloodHome page
Y. Haseyama, K.-i. Sawada, A. Oda, K. Koizumi, H. Takano, T. Tarumi, M. Nishio, M. Handa, Y. Ikeda, and T. Koike
Phosphatidylinositol 3-Kinase Is Involved in the Protection of Primary Cultured Human Erythroid Precursor Cells From Apoptosis
Blood, September 1, 1999; 94(5): 1568 - 1577.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Torres and R. Pulido
The Tumor Suppressor PTEN Is Phosphorylated by the Protein Kinase CK2 at Its C Terminus. IMPLICATIONS FOR PTEN STABILITY TO PROTEASOME-MEDIATED DEGRADATION
J. Biol. Chem., January 5, 2001; 276(2): 993 - 998.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Nomura, A. Kaji, W.-Y. Ma, S. Zhong, G. Liu, G. T. Bowden, K.-i. Miyamoto, and Z. Dong
Mitogen- and Stress-activated Protein Kinase 1 Mediates Activation of Akt by Ultraviolet B Irradiation
J. Biol. Chem., June 29, 2001; 276(27): 25558 - 25567.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (158)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Dahia, P. L.
Right arrow Articles by Eng, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dahia, P. L.
Right arrow Articles by Eng, C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?