Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (74)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Smyth, I.
Right arrow Articles by Wainwright, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smyth, I.
Right arrow Articles by Wainwright, B. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 291-297  

Isolation and characterization of human Patched 2 (PTCH2), a putative tumour suppressor gene inbasal cell carcinoma and medulloblastoma on chromosome 1p32
Introduction
Results
   Isolation and characterization of PTCH2
   Chromosomal localization of PTCH2
   SSCP analysis of PTCH2
Discussion
Materials And Methods
   Isolation of a PTCH2 cDNA by degenerate PCR
   Library screening
   Intron-exon boundaries
   Mapping of PTCH2
   Mutation detection
   Sequencing
   Patient and tumour samples
Acknowledgements
Abbreviations
References

Isolation and characterization of human Patched 2 (PTCH2), a putative tumour suppressor gene inbasal cell carcinoma and medulloblastoma on chromosome 1p32

Isolation and characterization of human Patched 2 (PTCH2), a putative tumour suppressor gene inbasal cell carcinoma and medulloblastoma on chromosome 1p32

Ian Smyth1,2, Monica A. Narang1, Tim Evans1, Cornelia Heimann3, Yusuke Nakamura4, Georgia Chenevix-Trench5, Torsten Pietsch3, Carol Wicking1 and Brandon J. Wainwright1,2,*

1Centre for Molecular and Cellular Biology and 2Department of Biochemistry, Research Road, University of Queensland, Brisbane 4072, Australia, 3Department of Neuropathology, University of Bonn Medical Centre, Bonn D-53105, Germany, 4Laboratory of Molecular Medicine, University of Tokyo, Tokyo, Japan and 5Queensland Institute of Medical Research, Royal Brisbane Hospital, Brisbane 4029, Australia

Received September 4, 1998; Revised and Accepted November 3, 1998

DDBJ/EMBL/GenBank accession no. AF087651

Mutations of the human Patched gene (PTCH) have been identified in individuals with the nevoid basal cell carcinoma syndrome (NBCCS) as well as in sporadic basal cell carcinomas and medulloblastomas. We have isolated a homologue of this tumour suppressor gene and localized it to the short arm of chromosome 1 (1p32.1-32.3). Patched 2 (PTCH2) comprises 22 coding exons and spans ~15 kb of genomic DNA. The gene encodes a 1203 amino acid putative transmembrane protein which is highly homologous to the PTCH product. We have characterized the genomic structure of PTCH2 and have used single-stranded conformational polymorphism analysis to search for mutations in PTCH2 in NBCCS patients, basal cell carcinomas and in medulloblastomas. To date, we have identified one truncating mutation in a medulloblastoma and a change in a splice donor site in a basal cell carcinoma, suggesting that the gene plays a role in the development of some tumours.

INTRODUCTION

In Drosophila, the patched-hedgehog signalling pathway is involved in establishing segment polarity and the anterior-posterior orientation of a number of developing appendages. The pathway is conserved from the fly to vertebrates (1,2) and has recently been implicated in a number of human neoplasias and developmental syndromes. Mutations in the human Patched gene (PTCH) have been reported in the nevoid basal cell carcinoma syndrome (NBCCS) (3-6) which is characterized by multiple basal cell carcinomas (BCCs) of the skin, a predisposition to other neoplasms including medulloblastoma, and by a range of developmental abnormalities primarily affecting the limbs and axial skeleton (7). PTCH mutations have been identified in both sporadic BCCs and in medulloblastomas (8-10). Taking into account the loss of heterozygosity seen in many of these tumours, it has been proposed that they result from homozygous inactivation of PTCH and that the developmental features of NBCCS are a result of haploinsufficiency (5).

Patched has been shown to act as the receptor for the secreted morphogen hedgehog (11). In addition to binding hedgehog, patched also interacts with a putative G-protein-coupled receptor known as smoothened. The current model of patched-hedgehog signalling suggests that association of hedgehog with patched disturbs this interaction. Signalling through smoothened then occurs, leading to the up-regulation of a number of genes including members of the Wnt and transforming growth factor-[beta] (TGF-[beta]) gene families as well as patched itself. Patched therefore acts to repress the action of smoothened but, in cells lacking patched, smoothened is constitutively activated and the resultant up-regulation of the downstream targets of the pathway is thought to lead to neoplasia. It has been suggested that the patched protein acts as a ‘gatekeeper’ for the development of BCC (12). However, the recent observation of activating missense mutations in smoothened in BCCs (13) indicates that it is probably the pathway itself which is crucial in controlling tumour progression and that dysregulation of hedgehog signalling in the form of either a patched knockout or a smoothened gain of function is a prerequisite event for neoplasia.

The evolution of vertebrates has seen a diversification of the numbers of genes involved in patched-hedgehog signalling. There currently are three known murine products of hedgehog genes; Sonic- (Shh), Desert- (Dhh) and Indian- (Ihh) hedgehog, which regulate the development of a wide range of tissues including the limbs, central nervous system, gonads and bone. Similarly, the murine Wnt gene family, homologous to Drosophila wingless, has 16 members which regulate a large number of developmental processes. Recently a second vertebrate patched gene was identified in the mouse and newt (14,15). Mouse Patched 2 (Ptc2) encodes a 1182 amino acid, 12 transmembrane (TM) domain protein with 56% identity to Ptc but which diverges from Ptc in the hydrophilic loop between TM6 and TM7 and in a region of the intracellular C-terminus. The function of Ptc2 remains unclear. Like Ptc, it is transcriptionally activated in Xenopus in response to Shh (14) and is down-regulated in Gli2 null mice (15), suggesting that it is involved in hedgehog signalling. However, in developing epidermal structures, Ptc2 is co-expressed with Shh, unlike Ptc which is generally expressed in a complementary fashion. This suggests that, although acting in the same pathway, Ptc2 may play a different role from that of Ptc in controlling tissue differentiation, at least in epidermal development.

Given the established role of PTCH mutations in the development of tumours of the skin and brain, we proposed that human Patched 2 (PTCH2) may also act as a tumour suppressor. Using degenerate PCR and homology screening, we have isolated several human PTCH2 cDNA clones and have characterized genomic clones spanning the gene. We have localized PTCH2 to chromosome 1p32.1-32.3, a region syntenic with the mouse Ptc2 locus on chromosome 4. Using combined single-stranded conformational polymorphism (SSCP) and heteroduplex analysis, we have looked for mutations in exons of PTCH2 in a number of tumour types, and in sporadic and familial NBCCS patients. As a result of this analysis, we have identified a frameshift mutation resulting in premature truncation of the PTCH2 protein in a single medulloblastoma and a nucleotide substitution in the splice donor site of PTCH2 exon 20 in a BCC.

RESULTS

Isolation and characterization of PTCH2

Takabatake et al. (14) previously described the isolation of fragments of the newt and mouse Ptc2 genes by degenerate RT-PCR. We have utilized a similar approach to amplify a 766 bp fragment of human PTCH2 from a human fetal brain cDNA library. The sequence of this fragment revealed an open reading frame (ORF) with significant homology to both mouse and newt Ptc2 and human PTCH between exons 5 and 10. This product was used to screen a fetal brain library, and two cDNAs corresponding to the 5[prime] end of PTCH2 were isolated. One clone represented an unprocessed transcript and the other, a 2.2 kb polyadenylated clone, truncates in intron 11 and presumably encodes an alternate PTCH2 transcript. Q15, a genomic clone of PTCH2, was isolated from a [lambda]gt10 human liver library, and subsequent analysis provided sequence information for PTCH2 exons 12a-18. Exon 17 was amplified from genomic DNA and was used to rescreen the fetal brain library. Two cDNA clones were isolated which contained the remaining PTCH2 exons 19-21. Sequencing these clones completed the PTCH2 ORF of 1203 amino acids (Fig. 1).


Figure 1. Alignment of human Patched 1 (PTCH), human Patched 2 (PTCH2) and mouse Patched 2 (Ptc2). Transmembrane domains (solid lines) and a conserved proline-rich intracellular domain (dashed line) are indicated. An aspartate residue implicated in sterol sensing (D599 in PTCH and D553 in PTCH2) is indicated by an asterisk.

Using a combination of genomic PCR and subcloning, we were able to determine the intron/exon structure of PTCH2 (Fig. 2). A 4.8 kb SacI subclone of the phage Q15, containing exons 3-13, was subcloned into pBluescript and was sequenced by primer walking. The genomic sequence of a second 2.2 kb PCR-generated fragment from exon 11 to 18 was obtained by SacI and HpaII subcloning and sequencing (Fig. 2). The sequence of introns 18, 19 and 20 was derived by directly sequencing genomic PCR fragments between the exons and by direct sequencing of a P1 artificial chromosome (PAC) which spans the gene. Intron/exon boundaries of PTCH2 were mapped and were found to be generally conserved between PTCH and PTCH2, although introns in the latter were generally smaller in size. An Alu repeat was identified in intron 18. The intronic sequence was used to design SSCP primers to undertake mutation detection in PTCH2 exons (Table 1). As has previously been reported for mouse Ptc2, attempts to detect PTCH2 transcripts on multiple tissue poly(A) northern blots were unsuccessful, suggesting that the gene is expressed at low levels (15).

Chromosomal localization of PTCH2

PTCH2 primers spanning intron 6 (PTCH2ex6f/PTCH2ex7r) were used to screen a monochromosomal Coriell mapping panel. A PCR product ~1 kb in size, comprising intron 6 and portions of exons 6 and 7, was observed in the hybrid containing chromosome 1. Finer mapping using the Genebridge 4 radiation-reduced hybrid panel localized the gene to chromosome 1p32.1-32.3 between the markers D1S443 and WI6598. This localization was confirmed using the forward primer in exon 6 (PTCH2ex6f) and a reverse primer within intron 6 (PTCH2in6r). Human chromosome 1 is syntenic with a significant portion of mouse chromosome 4 to which murine Ptc2 previously has been localized (15).

SSCP analysis of PTCH2


Figure 2. The genomic structure of PTCH2. Coding exons (solid boxes) are numbered according to homology with PTCH exons as previously described (4). Untranslated regions are indicated by open boxes. The PTCH2 genomic clones Q15 and 11D are indicated. The position of primers used to sequence the 5[prime] end of the gene are indicated, as are the SacI (S) and HpaII (H) restriction sites used in subcloning and sequencing 11D.

Given the close homology and possible functional redundancy between PTCH and PTCH2, we searched for PTCH2 mutations in NBCCS patients and in a range of sporadic tumours associated with NBCCS including BCCs and medulloblastomas. All samples had been screened previously by SSCP for PTCH mutations. SSCP analysis of 11 sporadic and 11 familial NBCCS patients, eight families with multiple BCCs but no other NBCCS symptoms and 92 medulloblastomas or medulloblastoma cell lines was undertaken using primers from exons 3-18. Sixteen BCCs were screened for PTCH2 mutations in exons 3-18 (excluding exon 15). Additionally, five other BCCs and three medulloblastomas were screened for PTCH2 mutations but limited DNA meant that only exons 3-11 were investigated. In a single medulloblastoma, we found a deletion of 2 bp in PTCH2 at position 1170 (1170delCT). This mutation results in premature truncation of the PTCH2 protein. Constitutional DNA for this tumour was unavailable so complementary assessment of germline status or chromosomal loss of 1p32 markers was not possible. The normal allele was apparent after direct sequencing of the tumour PCR product but may be due to contaminating wild-type stromal DNA. A second change in intron 20 was also identified in the splice donor site of a BCC (C3357+5T). This change was not detected in germline DNA from this patient or in any of the other samples analysed in this study. A number of polymorphisms were also identified throughout PTCH2 (Table 2).

Table 1. Primers used to amplify PTCH2 exons
Exona Position Exon size (bp) Primers Sequence PCR programb
3 266-455 189 P2int2f CTTCAGAGTTAGAAGCCCCCTTC SS60
P2int3r ATTCCCACTCCAGAACCCCCACAGC
4 456-525 69 P2int3f CCTTCTTCTGCTGATCTCCTATGC SS55
P2int4r TAAGGGGGCAAATTGCAGGC
5 526-617 92 P2int4f CAAAGGGCATCCTACAAAGGTTG SS55
P2int5r AGCGGGAGATGAAGCAGGG
6 618-813 196 P2int5f AGATAAGAGGAGGGTGGGGTACAG SS55
P2int6r TCCCCCAGAACACAGGAGTATG
7 814-935 122 P2int6f TACACTCCAGCCCTACTGAGCTTC SS55
P2int7r TGAACAGAGTCCCCTCACCAAC
8 936-1083 148 P2int7f GAGTTGGTGAGGGGACTCTGTTC SS60
P2int8r TGGAGAAACAGGGTGGATAGGAG
9 1084-1215 132 P2int8f CGGTATGGACAAGGACAAGGG SS55
P2int9r CAAGGTGCCAGGTGCAAGAC
10 1216-1371 156 P2int9f ACCTCCAACCAGTGCCCACC TD60
P2ex11r CGATTCCCAGAGCCAAGAAGG + 5% DMSO
11 1372-1464 93 P2int10f TCGGCGTGGATGACGTATTC SS55
P2int11r GGGGCAGTCATAACACAGTGGC
12a 1465-1590 126 P2int11f TCCCCTTCACTCCACTTTG TD55
P2int12ar GGACGGACAGGAGGGGAATG 2 mM MgCl2
12b 1591-1709 119 P2int12af GCTTCATCCAGCCTTCATTCC SS55
P2int12br TGACAGGTCTGTGCCTTGAAATG
13 1710-2058 349 P2int12bf CCCCTCACCAGCATTTCAAGG SS55
P2int13r TAAGCCCTCTCTGCCCTTCTGG
14c 2059-2371 313 P2int13f AAGGGCAGAGAGGGCTTAGTCC SS55
P2ex14r CTGACAGGGAGAAGTACCTGAGCTG
P2ex14f CTGACGGATGTGGTGCCTC SS60
P2int14r GACCAGGATAGGGTTCTATTAGCTG
15 2372-2514 143 P2int14f TGGCTACAGGGTGAGAGGCG TD60
P2int15r GAGGCAGAGAGGGCTGAAGG 1 mM MgCl2
16 2515-2695 181 P2int15f AGGTTGGGAGAGGGCTGGAG TD60
P2int16r AGGCTCAGGGCTTGTGTGGG
17c 2696-2976 281 P2int16f ACAAGCCCTGAGCCTGAGGC SS55
P2ex17r GCCCAGATACTGTTCCCAGAAGAG
P2ex17f GGAGTTTGCCCAGTTCCC TD60
P2int17r TGGCAGGAGGGATGACAGG
18 2977-3114 138 P2int17f TGAGTGCTTGCAGGAGTGG TD60
P2int18r CCTAGCACATAGTAGGGGCTTGAAC
aExons are numbered according to homology with PTCH as previously described (4).
bEither standard SSCP (SS) or touchdown (TD) protocols were used at the annealing temperatures indicated (55 or 60°C). Some reactions required the addition of 5% DMSO or altered MgCl2 concentrations as indicated.
cTwo primer sets were used to amplify exons 14 and 17.

Table 2. PTCH2 polymorphisms identified by SSCP
Exon Nucleotide change Amino acid change
6 G735C Gln-His
6 A618(-37)G intronic
7 T840C Ser-Ser
8 G1073A Arg-His
8 G1080T Val-Val
11 G1425A Ala-Ala
12b C1596T Ala-Ala
13 A1826G Glu-Glu
13 A2055G Ala-Ala
Variants were designated as polymorphisms if the change was present in normal patients or in germline DNA from tumour samples.

DISCUSSION

We describe the isolation and characterization of human PTCH2. The gene encodes a 1203 amino acid protein with similarity to both human PTCH and mouse Ptc2. The mouse and human Patched 2 genes are highly homologous (91.5% identity; 95.5% similarity) although human PTCH2 is 21 amino acids longer at its C-terminus than its mouse counterpart. Compared with their patched homologues, both proteins are similar in that they have truncated N- and C-terminal intracellular domains and vary significantly in the intracellular loop between TM domains 6 and 7. Conservation in the TM domains, however, is higher, and PTCH2 retains extensive homology in TM domains 2-6 to a number of proteins involved in sterol sensing, including HMG CoA reductase, SREBP cleavage-activating protein (SCAP) and the product of the gene for Niemann-Pick C1 disease (NPC) (16). An aspartate residue close to TM6 in SCAP has been shown to be involved in sterol sensing. A naturally occurring mutant of this amino acid in CHO cells (D443N) renders the protein insensitive to intracellular cholesterol levels (17). This residue is conserved in both PTCH (D599) and in PTCH2 (D553) (Fig. 1), suggesting that the two proteins may function in part by responding to intracellular cholesterol.

While the C-terminus of PTCH2 is truncated as compared with PTCH, both contain a proline-rich 15 amino acid motif (Fig. 1). This motif has no homology to any other published proteins although its presence in both human PTCH gene products, albeit at a different position within the C-terminus, suggests that it may have a functional role in PTCH signalling or protein-protein interactions. It is conceivable that such a motif may be important in the interaction of PTCH with the smoothened protein which is thought to be responsible for intracellular signalling on reception of hedgehog by patched.

By a combination of genomic PCR and subcloning, and sequencing of PTCH2 genomic phage and PAC clones, we have determined the intron/exon structure of the gene (Fig. 2). PTCH2 has 22 coding exons whose boundaries are conserved with PTCH. Screening of a fetal brain library identified a 2.2 kb polyadenylated transcript of the PTCH2 gene which ends in intron 11. A canonical AATAAA polyadenylation signal in human intron 11 appears to direct adenylation of this smaller transcript but this signal was not apparent in the mouse, suggesting that it may be unique to the human gene and is therefore unlikely to encode the primary PTCH2 protein. PTCH2 expression was undetectable on a multiple tissue poly(A)+ northern blot, making it impossible to predict transcript size. This suggests that expression of PTCH2 is low in adult tissues, an observation previously made with murine Ptc2 (15).

PTCH2 maps to chromosome 1p32.1-32.3 between the markers D1S443 and WI6598, a region syntenic with the mouse Ptc2 locus on chromsome 4. To date, we have observed no chromosomal loss of this region in BCCs (unpublished data); however, 1p32.1-32.3 does exhibit some rearrangement in tumours of the brain including neuroblastomas and a meningioma (18). We have used SSCP to look for mutations in PTCH2 in BCCs, medulloblastomas and in sporadic and familial NBCCS patients. We identified a 2 bp deletion in PTCH2 in a medulloblastoma at nucleotide 1170 which results in premature truncation of the protein. Unfortunately, germline DNA was unavailable for this tumour so we were unable to determine if loss of the other PTCH2 allele on 1p had occurred. We have, however, observed low levels of Ptc2 expression in the developing mouse brain, suggesting that the gene plays a role in neural differentiation (unpublished data). A second PTCH2 mutation was detected in the splice donor site of exon 20 in a BCC (C3357+5T). The change, a nucleotide substitution which alters the consensus donor site, was not present in matched germline DNA from the patient, suggesting that it may be associated with the genesis of the tumour. Unfortunately, RNA was not available from this BCC so the effect of the change on PTCH2 splicing could not be determined. While mutation of PTCH2 is a rare event in medulloblastoma and BCC, our data suggest that PTCH2 may act as a tumour suppressor gene in a small proportion of these tumours, where inactivation of the gene may act to promote tumour formation or progression. PTCH mutations have been identified by SSCP in only 10-15% of medulloblastomas, indicating that the hedgehog signalling pathway may only be implicated in a subset of these tumours (9,19). Interestingly, 1p32 has been identified as a region of genome amplification in a rhabdomyosarcoma (20), a tumour observed at increased frequency in NBCCS patients. Mice heterozygous for Ptc develop these soft tissue tumours frequently, implicating the patched signalling pathway in their development (21). It remains possible, therefore, that PTCH2 could be involved in some aspect of rhabdomyosarcoma aetiology.

The patched-hedgehog signalling pathway has already been shown to play an important role in the development of a number of tumour types (5,8,9). The isolation, mapping and characterization of a homologue of PTCH in humans therefore identifies a candidate tumour suppressor gene. We have demonstrated inactivation of one allele of this gene in a medulloblastoma and have identified a putative PTCH2 mutation in a BCC. It also remains a possibility that mutation of the gene may be involved in the development of other tumours.

MATERIALS AND METHODS

Isolation of a PTCH2 cDNA by degenerate PCR

Degenerate primers as described by Takabatake et al. (14) were used to amplify PTCH2 from a dT/random primed human fetal brain cDNA library (Clontech, Palo Alto, CA). A total of 1 × 107 p.f.u. of the library was subjected to the following PCR conditions: 94°C for 4 min then 35 cycles of 94°C for 45 s, 1 min at 55°C and 45 s at 72°C. PCR products were cloned into the GEM-T Easy vector (Promega) using the manufacturer’s protocols (Promega, Madison, WI) and sequenced with M13 forward and reverse primers.

Library screening

The degenerate PCR product was labelled using standard oligo labelling techniques and was used to probe ~1 × 106 p.f.u. of a dT/random primed human fetal brain library (Clontech) as well as a [lambda]-GEM-11 human liver genomic library (Promega). A second hybridization to isolate 3[prime] cDNAs was performed using exon 17 of PTCH2 amplified from human genomic DNA using primers and conditions detailed in Table 1. Hybridizations were carried out using standard techniques (22). A gridded PAC library (23) was screened by PCR for PTCH2 using primers in exons 6 and 7, and a positive clone, 4N14, was isolated.

Intron-exon boundaries

The PTCH2 cDNA spanning exons 1-11 was subcloned into pBluescript KS and sequenced directly by primer walking with oligos in exons 5, 6, 7 and 9 (PTCH2ex5r 5[prime]-AGG ATC ACG CAC GGA AAC AG-3[prime], PTCH2ex6f 5[prime]-GTC CCT TTG CCT CCC TTG AG-3[prime], PTCH2ex6r 5[prime]-GGA CCC AGC TCC TCC AGC AGC-3[prime], PTCH2ex7f 5[prime]-CCA TGG CTT CTC CCA CAA ATT C-3[prime], PTCH2ex9f 5[prime]-CGC TTC CCA GCA GAT CCA TG-3[prime]) and with universal forward and reverse primers. These oligos were also used to sequence a 4.8 kb SacI fragment of a PTCH2 genomic phage (Q15). Intronic sequence from exons 11-18 was derived from a 2.2 kb genomic DNA fragment amplified between a primer in exon 11 (PTCH2ex11f 5[prime]-TCG GCG TGG ATG ACG TAT TC-3[prime]) and a degenerate reverse primer in exon 18 (panPTCH2r 5[prime]-TGG AAT TCC (A/G)AA (N)AG (C/T)TC (N)AC (N)GT CAT CAT-3[prime]). This fragment, termed 11D, was subcloned into pGEM-T (Promega) and subcloned again using SacI and HpaII (Fig. 2).

Mapping of PTCH2

Primers homologous to PTCH2 exon 6 (PTCH2ex6f 5[prime]-GTC CCT TTG CCT CCC TTG AG-3[prime]) and exon 7 (PTCH2ex7r 5[prime]-TCC TGC CAG TGC ATG AAT TTG-3[prime]) were used to screen a Coriell monochromosomal hybrid panel (NIGMS) and the Genebridge 4 radiation-reduced hybrid mapping panel (UK HGMP). DNAs were subjected to the following PCR conditions: 94°C for 45 s, 56°C for 45 s, 72°C for 1 min 30 s for 30 cycles. These localizations were confirmed using a second reverse primer in intron 6 (PTCH2in6r 5[prime]-TCC CCC AGA ACA CAG GAG TAT G-3[prime]) using the same PCR conditions.

Mutation detection

Tumour and patient DNAs were screened for mutations using the SSCP protocol described by Hahn et al. (3). Briefly, patient and tumour DNAs were amplified using the primer pairs listed in Table 1 in the presence of [[alpha]-33P]dCTP. PCR conditions were 30 s at 94°C, 45 s at either 55 or 60°C as indicated in Table 1 then 20 s at 72°C for 35 cycles in the presence of 1.5 mM MgCl2. Touchdown PCR protocols were employed to amplify some exons. They consisted of three cycles of amplification at 8, 6, 4 and 2°C above normal annealing temperature, with a further 25 cycles at either 55 or 60°C. Samples were then run at room temperature and 4°C on non-denaturing polyacrylamide gels with and without 10% glycerol, respectively. Variant samples were reamplified and either sequenced directly or subcloned into pGEM-T (Promega) and sequenced. Additionally, variant bands were excised from the gel, incubated at room temperature for 2-3 h in 50 µl of TE pH 7.6 and then reamplified and sequenced.

Sequencing

Plasmid DNAs and PCR fragments were purified for sequencing using Bresatec miniprep kits (Bresatec, Adelaide, South Australia) and Progen PCR spinclean columns (Progen Industries, Brisbane, Australia) respectively. Templates were sequenced using Big Dye terminator sequencing chemistry (Perkin Elmer, Norwalk, CT) and the results analysed on an ABI 377 electrophoresis unit (ABI).

Patient and tumour samples

A total of 85 medulloblastoma samples from 82 patients were analysed (in three cases from primary and secondary tumours). Thirteen were of the desmoplastic phenotype, two were medullomyoblastomas and the remainder were classic medulloblastomas. Four previously described medulloblastoma cell lines D283Med, D341Med and MHH-MED-1 (non-desmoplastic), and Daoy (desmoplastic) were investigated (9). Three additional cell lines derived from classic medulloblastomas were also included (Wu-1580, MEB-MED-8A and MEB-MED-8S). Tumours were diagnosed according to the revised World Health Organization classification of brain tumours using standard histological methods including haematoxilin and eosin, reticulin stains and immunohistochemical reactions. NBCCS patients were diagnosed according to the clinical criteria in the study by Shanley et al. (24). All sporadic and familial patients have been screened previously for mutations in PTCH (4,5). The eight families presenting with increased BCC numbers were identified on presentation at the Royal Brisbane Hospital but do not conform to the NBCCS clinical criteria.

ACKNOWLEDGEMENTS

We would like to thank Panos Ioannou, Tim Cox and Rick Sturm for providing the PAC, cDNA and genomic libraries used in this study. The authors acknowledge the support of the Australian Cancer Research Fund, Australian Research Council and Australian National Health and Medical Research Council (C.W., B.J.W, G.C.-T.), and German Research Council (T.P.). I.S. acknowledges an Australian Postgraduate Award from the Commonwealth Government.

ABBREVIATIONS

BCC, basal cell carcinoma; NBCCS, naevoid basal cell carcinoma syndrome; PAC, P1 artifical chromosome; PTCH, human patched; Ptc, mouse patched.

REFERENCES

1. Hahn, H., Christiansen, J., Wicking, C., Zaphiropoulos, P.G., Chidambaram, A., Gerrard, B., Vorechovsky, I., Bale, A.E., Toftgard, R., Dean, M. and Wainwright, B. (1996) A mammalian patched homologue is expressed in target tissues of sonic hedgehog and maps to a region associated with developmental abnormalities. J. Biol. Chem., 271, 12125-12128. MEDLINE Abstract

2. Goodrich, L.V., Johnson, R.L., Milenkovic, L., McMahon, J.A. and Scott, M.P. (1996) Conservation of the hedgehog/patched signaling pathway from flies to mice: induction of a mouse patched gene by Hedgehog. Genes Dev., 10, 301-312. MEDLINE Abstract

3. Hahn, H., Wicking, C., Zaphiropoulos, P.G., Gailani, M.R., Shanley, S., Chidambaram, A., Vorechovsky., I., Holmberg, E., Unden, A.B., Gillies, S., Negus, K., Smyth, I., Pressman, C., Leffell, D.J., Gerrard, B., Goldstein, A.M., Dean, M., Toftgard, R., Chenevix-Trench, G., Wainwright, B. and Bale, A.E. (1996) Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell, 85, 841-851. MEDLINE Abstract

4. Wicking, C., Gillies, S., Smyth, I., Shanley, S., Fowles, L., Ratcliffe, J., Wainwright, B. and Chenevix-Trench, G. (1997) New mutations of the PATCHED gene in nevoid basal cell carcinoma syndrome help to define the clinical phenotype. Am. J. Med. Genet., 73, 304-307. MEDLINE Abstract

5. Wicking, C., Shanley, S., Smyth, I., Gillies, S., Negus, K., Graham, S., Suthers, G., Haites, N., Edwards, M., Wainwright, B. and Chenevix-Trench, G. (1997) Most germline mutations in the nevoid basal cell carcinoma syndrome lead to a premature termination of the PATCHED protein and no phenotype-genotype correlations are evident. Am. J. Hum. Genet., 60, 21-26. MEDLINE Abstract

6. Johnson, R.L., Rothman, A.I., Xie, J., Goodrich, L.V., Bare, J.W., Bonifas, J.M., Quinn, A.G., Myers, R.M., Cox, D.R., Epstein, E.H.J. and Scott, M.P. (1996) A human homologue of patched, a candidate for the basal cell nevus syndrome. Science, 272, 1668-1671. MEDLINE Abstract

7. Gorlin, R.J. (1995) Nevoid basal cell carcinoma syndrome. Dermatol. Clin., 13, 113-125. MEDLINE Abstract

8. Gailani, M., Stahle-Backdahl, M., Leffell, D., Glynn, M., Zaphiropolous, P., Pressman, C., Unden, A.B., Dean, M., Brash, D.E., Bale, A.E. and Toftgard, R. (1996) The role of the human homologue of Drosophila patched in sporadic basal cell carcinomas. Nature Genet., 14, 78-81. MEDLINE Abstract

9. Pietsch, T., Waha, A., Koch, A., Kraus, J., Albrecht, S., Tonn, J., Sorenson, N., Berthold, F., Henk, B., Wolf, H.K., von Deimling, A., Wainwright, B., Chenevix-Trench, G., Weistler, O.D. and Wicking, C.A. (1997) Medulloblastomas of the desmoplastic variant carry mutations in the human homologue of Drosophila patched. Cancer Res., 57, 2085-2088. MEDLINE Abstract

10. Raffel, C., Jenkins, R.B., Frederick, L., Hebrink, D., Alderete, B., Fults, D.W. and James, C.D. (1997) Sporadic medulloblastomas contain PTCH mutations. Cancer Res., 67, 842-845.

11. Stone, D.M., Hynes, M., Armanini, M., Swanson, T.A., Gu, Q., Johnson, R.L., Scott, M.P., Pennica, D., Goddard, A., Philips, H., Noll, M., Hooper, J.E., de Sauvage, D. and Rosenthal, A. (1996) The tumour suppressor gene Patched encodes a candidate receptor for Sonic Hedgehog. Nature, 384, 129-134. MEDLINE Abstract

12. Sidransky, D. (1996) Is human patched the gatekeeper of common skin cancers? Nature Genet., 14, 7-8. MEDLINE Abstract

13. Xie, J., Murone, M., Luoh, S.-M., Ryan, A., Gu, Q., Zhang, C., Bonifas, J.M., Lam, C.-W., Hynes, M., Goddard, A., Rosenthal, A., Epstein, E.H. and de Sauvage, F.J. (1998) Activating Smoothened mutations in sporadic basal-cell carcinoma. Nature, 391, 90-92. MEDLINE Abstract

14. Takabatake, T., Ogawa, M., Takahashi, T.C., Mizuno, M., Okamoto, M. and Takeshima, K. (1997) Hedgehog and patched gene expression in adult ocular tissues. FEBS Lett., 410, 485-489. MEDLINE Abstract

15. Motoyama, J., Takabatake, T., Takeshima, T. and Hui, C.-C. (1998) Ptch2, a second mouse Patched gene is co-expressed with Sonic Hedgehog. Nature Genet., 18, 104-106. MEDLINE Abstract

16. Carstea, E.D., Morris, J.A., Coleman, K.G., Loftus, S.K., Zhang, D., Cummings, C., Gu, J., Pavan, W.J., Krizman, D.B., Nagle, J., Polymeropoulos, M.H., Sturley, S.L., Ioannou, Y.A., Higgins, M.E., Comly, M., Cooney, A., Brown, A., Kaneski, C.R., Blanchette-Mackie, E.J., Dwyer, N.K., Neufeld, E.B., Chang, T.Y., Liscum, L., Strauss, J.F. and Pentchev, P.G. (1997) Neimann-Pick-C1 disease gene-homology to mediators of cholesterol homeostasis. Science, 277, 228-231. MEDLINE Abstract

17. Hua, X., Nohturfft, A., Goldstein, J.L. and Brown, M.S. (1996) Sterol resistance in CHO cells traced to a point mutation in SREBP cleavage-activating protein. Cell, 87, 415-426. MEDLINE Abstract

18. Mitelman, F., Mertens, F. and Johansson, B. (1997) A breakpoint map of recurrent chromosomal rearrangements in human neoplasia. Nature Genet., 15, 417-474. MEDLINE Abstract

19. Wolter, M., Reifenberger, J., Sommer, C., Ruzicka, T. and Reifenberger, G. (1997) Mutations in the human homologue of the Drosophila segment polarity gene patched (PTCH) in sporadic basal cell carcinomas of the skin and primitive neuroectodermal tumours of the central nervous system. Cancer Res., 57, 2581-2585. MEDLINE Abstract

20. Steilen-Gimbel, H., Remberger, K., Graf, N., Steudel, W.I., Zang, K.D. and Henn, W. (1996) A novel site of DNA amplification on chromosome 1p32-33 in a rhabdomyosarcoma revealed by comparative genomic hybridisation. Hum. Genet., 97, 87-90. MEDLINE Abstract

21. Hahn, H., Wojnowski, L., Zimmer, A.M., Hall, J., Miller, G. and Zimmer, A. (1998) Rhabdomyosarcoma and radiation hypersensitivity in a mouse model of Gorlin syndrome. Nature Med., 4, 619-622. MEDLINE Abstract

22. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

23. Ioannou, P.A., Amemiya, C.T., Garnes, J., Kroisel, P.M., Shizuya, H., Chen, C., Batzer, M.A. and de Jong, P.J. (1994) A new bacteriophage P1-derived vector for the propagation of large human DNA fragments. Nature Genet., 6, 84-89. MEDLINE Abstract

24. Shanley, S., Ratcliffe, J., Hockey, A., Haan, E., Oley, C., Ravine, D., Martin, N., Wicking, C. and Chenevix-Trench, G. (1994) Nevoid basal cell carcinoma syndrome: review of 118 affected individuals. Am. J. Med. Genet., 50, 282-290. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +61 7 3365 4542; Fax: +61 7 3365 4388; Email: b.wainwright@cmcb.uq.edu.au

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 4 Feb 1999
Copyright©Oxford University Press, 1999.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
T. Uziel, F. V. Karginov, S. Xie, J. S. Parker, Y.-D. Wang, A. Gajjar, L. He, D. Ellison, R. J. Gilbertson, G. Hannon, et al.
The miR-17~92 cluster collaborates with the Sonic Hedgehog pathway in medulloblastoma
PNAS, February 24, 2009; 106(8): 2812 - 2817.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
P. N. Kongkham, P. A. Northcott, Y. S. Ra, Y. Nakahara, T. G. Mainprize, S. E. Croul, C. A. Smith, M. D. Taylor, and J. T. Rutka
An Epigenetic Genome-Wide Screen Identifies SPINT2 as a Novel Tumor Suppressor Gene in Pediatric Medulloblastoma
Cancer Res., December 1, 2008; 68(23): 9945 - 9953.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
Z Fan, J Li, J Du, H Zhang, Y Shen, C-Y Wang, and S Wang
A missense mutation in PTCH2 underlies dominantly inherited NBCCS in a Chinese family
J. Med. Genet., May 1, 2008; 45(5): 303 - 308.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
E. Nieuwenhuis, J. Motoyama, P. C. Barnfield, Y. Yoshikawa, X. Zhang, R. Mo, M. A. Crackower, and C.-c. Hui
Mice with a Targeted Mutation of Patched2 Are Viable but Develop Alopecia and Epidermal Hyperplasia.
Mol. Cell. Biol., September 1, 2006; 26(17): 6609 - 6622.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Y. Lee, H. L. Miller, H. R. Russell, K. Boyd, T. Curran, and P. J. McKinnon
Patched2 modulates tumorigenesis in patched1 heterozygous mice.
Cancer Res., July 15, 2006; 66(14): 6964 - 6971.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
K. Nagao, N. Togawa, K. Fujii, H. Uchikawa, Y. Kohno, M. Yamada, and T. Miyashita
Detecting tissue-specific alternative splicing and disease-associated aberrant splicing of the PTCH gene with exon junction microarrays
Hum. Mol. Genet., November 15, 2005; 14(22): 3379 - 3388.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. Traiffort, C. Dubourg, H. Faure, D. Rognan, S. Odent, M.-R. Durou, V. David, and M. Ruat
Functional Characterization of Sonic Hedgehog Mutations Associated with Holoprosencephaly
J. Biol. Chem., October 8, 2004; 279(41): 42889 - 42897.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Y. Lee, H. L. Miller, P. Jensen, R. Hernan, M. Connelly, C. Wetmore, F. Zindy, M. F. Roussel, T. Curran, R. J. Gilbertson, et al.
A Molecular Fingerprint for Medulloblastoma
Cancer Res., September 1, 2003; 63(17): 5428 - 5437.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
C. G. Eberhart
Medulloblastoma in Mice Lacking p53 and PARP: All Roads Lead To Gli
Am. J. Pathol., January 1, 2003; 162(1): 7 - 10.
[Full Text] [PDF]

Home page
 Arch DermatolHome page
H. Tsao
Genetics of Nonmelanoma Skin Cancer
Arch Dermatol, November 1, 2001; 137(11): 1486 - 1492.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. E. Bale and K.-p. Yu
The hedgehog pathway and basal cell carcinomas
Hum. Mol. Genet., April 1, 2001; 10(7): 757 - 762.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
C Hartmann and C. Tabin
Dual roles of Wnt signaling during chondrogenesis in the chicken limb
Development, January 7, 2000; 127(14): 3141 - 3159.
[Abstract] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (74)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Smyth, I.
Right arrow Articles by Wainwright, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smyth, I.
Right arrow Articles by Wainwright, B. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?