Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (89)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Swaroop, A.
Right arrow Articles by Sieving, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Swaroop, A.
Right arrow Articles by Sieving, P. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 299-305  

Leber congenital amaurosis caused by a homozygous mutation (R90W) in the homeodomain of the retinal transcription factor CRX: direct evidence for the involvement of CRX in the development of photoreceptor function
Introduction
Results
   A homozygous CRX-R90W mutation in LCA
   The CRXR90W protein shows reduced binding to DNA sequence elements
   The R90W mutation reduces CRX-mediated transactivation of the rhodopsin promoter
   Clinical characteristics of affected individuals
Discussion
Materials And Methods
   Mutation analysis
   DNA binding studies
   Transient transfection studies
   Visual function analysis
Acknowledgements
References

Leber congenital amaurosis caused by a homozygous mutation (R90W) in the homeodomain of the retinal transcription factor CRX: direct evidence for the involvement of CRX in the development of photoreceptor function

Leber congenital amaurosis caused by a homozygous mutation (R90W) in the homeodomain of the retinal transcription factor CRX: direct evidence for the involvement of CRX in the development of photoreceptor function

Anand Swaroop1,2,3,4,*, Qing-Liang Wang5, Weiping Wu1, Jason Cook1, Caraline Coats1, Siqun Xu6, Shiming Chen6, Donald J. Zack5,7 and Paul A. Sieving1,4,8

1Department of Ophthalmology, 2Department of Human Genetics, 3Program in Cellular and Molecular Biology, 4Program in Neuroscience and 8Program in Bioengineering, W.K.Kellogg Eye Center, University of Michigan, Ann Arbor, MI 48105-0714, USA, 5Department of Ophthalmology and 7Department of Molecular Biology and Genetics and Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD, USA and 6Department of Ophthalmology and Visual Sciences, Washington University School of Medicine, St Louis, MO, USA

Received September 9, 1998; Revised and Accepted November 15, 1998

The CRX (cone-rod homeobox) gene is specifically expressed in developing and mature photoreceptors and encodes an otd/Otx-like paired homeodomain protein. Mutant alleles of the CRX gene have recently been associated with autosomal dominant cone-rod dystrophy (CORD) as well as dominant Leber congenital amaurosis (LCA). Since LCA is more commonly inherited in an autosomal recessive manner, we examined a cohort of recessive LCA patients for CRX mutations. A homozygous substitution of arginine (R) at codon 90 by tryptophan (W) was identified in the CRX homeodomain of one of the probands who was nearly blind from birth. A group of 48 control individuals and 190 previously characterized CORD probands did not reveal this sequence change. The mutant CRXR90W homeodomain demonstrated decreased binding to the previously identified cis sequence elements in the rhodopsin promoter. In transient transfection experiments, the mutant protein showed significantly reduced ability to transactivate the rhodopsin promoter, as well as lower synergistic activation with the bZIP trans-cription factor NRL. Heterozygosity of the mutant CRX (R90W) allele was detected in both parents and in an older sibling. Ophthalmologic examination and electro-retinography revealed a subtle abnormality of cone function in both the parents. These data suggest that the R90W mutation results in a CRX protein with reduced DNA binding and transcriptional regulatory activity and that the subsequent changes in photoreceptor gene expression lead to the very early onset severe visual impairment in LCA.

INTRODUCTION

The mammalian retina is derived from neural ectoderm and consists of many distinct neurons that are organized in three cell layers to perform phototransduction and initial visual processing (1). Extensive studies have indicated that various retinal cell types arise from common progenitors (2). As with other developing systems (3-5), retinal differentiation and function require precise control of temporal and spatial patterns of gene expression. Two complementary strategies have been employed to gain insights into the transcriptional control of retinal genes. One is to dissect the cis-acting elements in the promoter-enhancer regions of photoreceptor-specific genes (6) and the other is to directly isolate transcription factor genes using molecular techniques (7,8). The cone-rod homeobox (CRX) gene was independently identified using these approaches and shown to be expressed predominantly in photoreceptors (9-11). It encodes a paired homeodomain protein of 299 amino acids with high homology to proteins of the otd/Otx gene family, members of which participate in regulating early neuronal development (12). The CRX protein binds to specific DNA sequence elements in vitro and transactivates expression from minimal promoters of several photoreceptor-specific genes, including rhodopsin (9,11). In transient transfection experiments, CRX acts synergistically with NRL, a transcription factor of the basic leucine zipper motif (bZIP) family (7).


Figure 1. (A) Sequence of the CRX exon 3 (antisense strand). The identity of the sequenced product is shown above the sequence. Circles and squares represent females and males, respectively. A filled circle indicates the proband in this autosomal recessive LCA family (UM D188). The arrow on the left indicates the mutation. The proband is homozygous whereas both the parents and an older sister carry a normal and a mutated allele. (B) Sequence of the normal and mutated CRX alleles, showing the altered amino acid (R90W). (C) Alignment of the human CRX homeodomain helix 3 with other homeodomain sequences (based on refs 9-11). The R90 codon is shown in bold.

We and others have previously identified CRX mutations in patients with autosomal dominant cone-rod dystrophy (CORD), a relatively early onset (often in the teens) disease involving degeneration of cone and rod photoreceptors (10,13). Since CRX is expressed early in development (11) and is functionally implicated in photoreceptor differentiation (9), we hypothesized that a homozygous mutation in the CRX gene would result in a congenital or early onset retinopathy. Leber congenital amaurosis (LCA) is a clinically and genetically heterogeneous disease, which is usually inherited in an autosomal recessive manner and is characterized by total blindness at birth or shortly thereafter (MIM 204000) (14). In a small number of LCA patients, mutations have been reported in genes for a retina-specific guanylate cyclase (15) and a retinal pigment epithelium-specific 65 kDa protein, RPE65 (16,17). In addition, two separate CRX mutations (E168[Delta]2bp and G217[Delta]1bp) have recently been described in LCA patients (18). Surprisingly, however, in each of these reported cases CRX sequence changes were identified in only one allele and the mutation appeared to originate de novo, as neither parent carried the mutant allele. Here, we demonstrate for the first time that a novel CRX mutation (R90W) can cause LCA in an autosomal recessive manner. We also present biochemical and clinical data that provide insights into the mechanism by which the mutation causes the disease.


Figure 2. Decreased DNA binding caused by the R90W mutation. (A) Protein gel, stained with Coomassie blue, demonstrating the purification of CRXHD-GST (WT) and CRXHDR90W-GST (R90W) fusion proteins. Lane 1 contains protein molecular weight markers (Bio-Rad); lanes 2 and 3 contain 100 ng of the indicated protein. The numbers on the left represent the apparent molecular weight in kDa. (B-D) EMSAs with CRXHD-GST (lanes 1-3) and CRXHDR90W-GST (lanes 4-6) fusion proteins. Within the rhodopsin promoter, Crx has been shown to bind to three separate sites (11); these are the Ret 1/PCE (29,30), Ret 4 (31) and BAT-1 elements (32). The 32P-labeled oligonucleotide probes used for EMSA are indicated at the bottom of each panel. The amount of fusion protein used for lanes 1 and 4, 2 and 5 and 3 and 6 were: 10, 2 and 0.4 ng, respectively, for (B); 2, 0.2 and 0.02 ng, respectively, for (C); 40, 20 and 10 ng, respectively, for (D).

RESULTS

A homozygous CRX-R90W mutation in LCA

The three CRX exons and their flanking regions were examined in nine probands diagnosed with LCA by direct sequencing of amplified products. This analysis revealed a C->T nucleotide transition in the CRX exon 3 of the proband (II-1) from family UM D188 (Fig. 1A, showing a G->A sequence change in the antisense strand). Since only a T nucleotide was detected at this position, the sequence alteration was present in both CRX alleles of the proband. No other nucleotide change was observed. Both the parents and an older full sister of the affected girl demonstrated heterozygosity, i.e. carried both a C and a T nucleotide (Fig. 1A). The C->T change had not been detected in our previous analysis of the CRX gene from 170 CORD probands (13) or in 20 additional CORD patients screened later (data not shown). Since this nucleotide change creates a new BsrI restriction site, we digested PCR-amplified products of CRX exon 3 from 48 control individuals with this restriction enzyme. The C->T nucleotide change was not detected in any control sample (data not shown), further confirming that it is not a common polymorphic variant in the population.

The C->T transition results in the substitution of a tryptophan (W) residue for arginine (R) at codon 90, which is in helix 3 of the CRX homeodomain (Fig. 1B). R90 is conserved in the CRX protein from different species, in all members of the otd/Otx family and in many other homeodomains (Fig. 1C).

The CRXR90W protein shows reduced binding to DNA sequence elements

To examine the effect of the mutation, wild-type and mutated CRX homeodomains (CRXHD and CRXHDR90W, respectively) were expressed in bacteria as GST fusion proteins, purified and tested for DNA binding activity (Fig. 2). SDS-PAGE analysis demonstrated that an equivalent amount of the wild-type and mutant fusion protein was used for the binding experiments (Fig. 2A). Electrophoretic mobility shift assays (EMSAs) were performed with each of the rhodopsin promoter elements that had been previously shown to bind to Crx; Ret 1, BAT-1 and Ret 4 (Fig. 2B-D). In all cases, the mutant homeodomain (CRXHDR90W) showed reduced binding activity compared with the wild-type (CRXHD). The maximum decrease in binding was noted with the Ret 1 and Ret 4 sites. With the Ret 4 site, CRXHDR90W also demonstrated a slightly different mobility shift compared with the wild-type protein (Fig. 2D).

The R90W mutation reduces CRX-mediated transactivation of the rhodopsin promoter

To further assess the functional consequence of the R90W mutation, we performed transient transfection studies using a bovine rhodopsin promoter (-130 to +70 bp)-luciferase reporter assay with human 293 cells. Compared with the wild-type, the mutant CRXR90W protein demonstrated minimal, if any, ability to transactivate expression of the reporter gene (Fig. 3A). Additionally, in the presence of bZIP transcription factor NRL, the CRXR90W protein significantly reduced synergistic transactivation of the rhodopsin promoter (Fig. 3B). Taken together, these results suggest that the R90W mutation reduces but does not abolish the transcriptional regulatory activity of CRX.


Figure 3. Effect of the R90W mutation on CRX-mediated transactivation of the rhodopsin promoter, both alone and in combination with NRL. (A) Ability of the indicated amounts (µg) of wild-type (CRX/pcDNA3.1) and CRXR90W/pcDNA3.1 mutant constructs to transactivate expression of the bovine rhodopsin promoter(-130 to +70 bp)-reporter construct. (B) Same experiment as in (A), but in the absence or presence of 1 µg of NRL expression construct.

Clinical characteristics of affected individuals

The proband (II-1) homozygous for the CRX-R90W mutation had severe and nearly complete vision loss from birth, with ‘counting fingers’ visual acuity and nearly global loss of visual fields with no ability to detect light presented other than directly ahead of her. Her ocular fundus showed extensive pigmentary retinopathy and electroretinogram (ERG) responses had >98% amplitude loss of rod and cone components (Fig. 4). This constellation of clinical features is termed Leber congenital amaurosis (http://www.ncbi.nlm.nih.gov/Omim/ ) (14). No systemic abnormalities were noted. Normal developmental milestones were attained and intelligence was normal.

The heterozygous parents retained normal visual acuity and were relatively asymptomatic clinically, except for being photoaversive to bright lights and preferring not to drive at or after dusk (Table 1 and Fig. 4). The mother (I-1) retained normal color discrimination on the Farnsworth D-15 test (which, like visual acuity, probes only the central-most cone function); however, she missed six of 12 Ishihara plates, indicating that her color vision was grossly deficient across the central 5-10° of vision. This is evidence of a functional deficit of macular cones outside the central fovea, mirroring the punctate retinopathy that was observed at the edges of her macula, in which the retinal pigment epithelium (RPE) shows early atrophy in a 20-40° band in the rod-rich region of the retina. Both parents had photopic cone and 30 Hz flicker ERG abnormalities, which were more advanced in the mother, and both had impaired rod threshold sensitivities centrally in the macula but not in the peripheral retina. These changes indicate a mild form of disease, clinically termed cone-rod dystrophy. When examined at age 15, the sister of the proband (II-2) did not have apparent fundus abnormalities by direct and indirect ophthalmoscopy.

Table 1. Clinical characteristics (CRX-R90W, UM D188)
Patient (age) Visual acuity Visual fields Electroretinogram Dark adapted threshholds Comments Fundus Color vision
Scotopic
b-wave		 Photopic
b-wave		 30 Hz flicker
I-1 (38 years) Mother 20/20 Full V4e and I4e, but I2e sensitivity depressed centrally Marginal; 218&nbs;;µV OD, 216 µV OS (NL > 201 µV) Abnormal; 36 µV and electronegative shape (NL > 51 µV) Abnormal; 40 µV but nl timing (NL >61 µV) NL, except 0.4 log loss at 20° nasal retina OU Photoaversive; avoids driving at dusk and night RPE granular pigment in nasal macula, and granular and thin in 20-40° mid-peripheral band No errors on D-15, but missed 6 of 12 Isihara plates with each eye
I-2 (45 years) Father 20/20 Full V4e and I4e, and I2e sensitivity normal centrally Normal, 250 µV OU, but white flash is electronegative Normal 60 µV, but shape is nearly electronegative Marginally abnormal, 58 µV but normal timing NL, except 1.0 log loss centrally OS Photoaversive RPE thinning in periphery No errors on D-15 or Isihara plates
II-1 (11 years) CF 3 feet Eccentric fixation only, with 5° field to V4e target Noise level only; >98% loss Noise level only; >98% loss Noise level only; >98% loss - Healthy child; normal intelligence; plays violin RPE atrophy of central 8° macula, and gliotic reticular RPE whitening out to equatorial retina Only gross color discrimination for reds and greens
II-2 (15 years) 20/15 Full V4e, I4e and I2e - - - - No vision symptoms Normal No errors on D-15 or Isihara plates

DISCUSSION

The structure and function of photoreceptors appear to be under strict genetic control since mutations in a large number of genes (or genetic loci, >40 at this stage) can lead to retinal and macular dystrophies (19) (http://www.sph.uth.tmc.edu/www/utsph/RetNet/disease.htm ). Most of the identified ‘disease’ genes encode photoreceptor-specific proteins that are involved in phototransduction or are structural proteins. It has, therefore, been expected that mutations in transcription factors that control the expression of photoreceptor-specific genes (e.g. rhodopsin) would result in retinopathies. The bZIP transcription factor NRL and the homeodomain protein CRX have been implicated in rhodopsin regulation and probably act in a synergistic manner (11,20,21). Although initial screening did not reveal causative NRL mutations in a cohort of 53 retinal dystrophy patients (22), mutations in the CRX gene were recently reported in families with autosomal dominant CORD and LCA (10,13,18). This is the first report of a homozygous mutation in CRX resulting in LCA.

   A, B
   C

Figure 4. Clinical characterization of individuals from the LCA pedigree UM D118. (A) (top) Fundus photograph of the left eye of II-1, an 11-year-old female (proband) with Leber’s congenital amaurosis, shows central macular atrophy with extensive pigmentary disruption and early mottled atrophy of the RPE into the periphery. The arterioles are narrowed. (B) (bottom) Fluorescein angiogram of the right eye superior to the macula of I-1, the 38-year-old mother of II-1 and heterozygous for the R90W mutation, shows tiny, punctate pigmentary retinopathy and marked thinning of the RPE causing a ‘window defect’ through which the white choroidal fluorescence is evident. This band of early RPE atrophy extends along the macular arcade vessels (curving along the bottom of this photograph), 20-40° from the fovea in the rod-dense region of the retina. (C) Retinal function testing on the CRX-R90W family. ERG responses from the proband II-1, shown here at age 2 years, are >98% reduced for both rod and cone test conditions. Both parents with the heterozygous R90W mutation show ERG abnormalities: responses from rods and rod pathway neurons to the scotopic white flash (3.6 cd s/m2, condition) are ‘electronegative’ from reduction of the positive b-wave. A blue scotopic flash (0.014 cd s/m2, dark-adapted, normally producing the maximal rod system b-wave) gives normal amplitude for I-2 but is sub-normal for I-1 (Table 1). For I-1, the cone system response is reduced and electronegative (arrow) with the photopic flash (8.5 cd s/m2 flash on a light-adapting 43 cd/m2 background) and has sub-normal amplitude to 30 Hz flicker.

The R90W substitution shows a classical autosomal recessive pattern of inheritance with one mutated allele provided by each parent. This change was not observed in 48 control individuals or in 190 CORD probands. Although the parents are unaware of consanguinity in the ancestry, both families originated from a small community near Bombay, India. In an otherwise Hindu region, this community was converted to Christianity by Portuguese missionaries some 450 years ago, possibly leading to a sequestered population with an ancestral CRX-R90W allele, which converged in the proband and resulted in LCA. The arginine codon 90 is a highly conserved residue in recognition helix 3 of the homeodomain. It seemed likely that its substitution with tryptophan would alter the DNA-binding and transcriptional regulatory potential of CRX. This hypothesis was confirmed by the finding that in vitro the mutation was associated with both reduced DNA binding and decreased transcriptional activity. It should be noted that another mutation in the homeodomain (R41W) has previously been shown to decrease the DNA-binding activity of CRX protein in vitro (13). Further evidence for R90W being a causative mutation in this LCA family is provided by ophthalmologic and physiological studies. Both of the parents are heterozygous for the CRXR90W mutation and showed clinical and ERG characteristics of mild cone-rod disease and macular involvement. We had previously reported a CORD family (UM H0992) with autosomal dominant disease resulting from an R41W mutation in the CRX homeodomain that caused maculopathy from cone-rod disease (13). Overall, the disease features in that previous R41W family are concordant with the R90W parents in this LCA family. In both families, the heterozygous individuals show punctuate pigmentary maculopathy and early mild RPE atrophy that extends into the nasal retina and surrounds the macula in a band extending from 20 to 40° in the rod-rich mid-peripheral retina. However, amongst the patients examined, the R41W mutation in the heterozygous state caused a more severe disease phenotype than did the R90W mutation. This is consistent with the finding that in vitro the R41W mutation affects DNA binding more severely than does the R90W mutation (13). Based on these findings, we would predict that an R41W homozygote or an R90W/R41W compound hetero-zygote would also exhibit an LCA phenotype.

Both the mother and the father in this Leber family have the same CRX gene mutation, yet the mother, who is younger by 7 years, has more pronounced disease. A similar degree of phenotype variability was observed in our previous CORD family (UM H0992), in which the younger siblings were more severely affected (13). Compared with the older brother (III-I) in that family, the mother (I-1) in this Leber family had quite a similar disease; both retained normal acuity but had abnormal color discrimination, relative visual field loss centrally, punctuate RPE pigmentary maculopathy and ERG changes. Both the previous CRX cone-rod disease family (UM H0992) and the current LCA family showed electronegative scotopic and photopic ERG responses that suggest impaired signal transfer from both rod and cone photoreceptors to the bipolar second-order retinal neurons (23). In both families, the heterozygous state can be described as having macular degeneration as a component of a more generalized ‘cone-rod dystrophy’ (24). Since the parents in this Leber family are relatively asymptomatic, we do not know exactly when the disease condition became manifest, although based on our previous CRX study of CORD (13) and on ophthalmic examination of the carrier daughter (II-2) we presume that it was not congenital and that it may be progressive to some degree for these heterozygous individuals. Consistent with these findings, CRX mutations in heterozygote individuals are reported to result in varying degrees of photoreceptor degeneration (25,26).

Identification of a homozygous mutation in the LCA child provides evidence for the involvement of CRX in early differentiation of cones and rods. Her visual function was quite severely compromised from the youngest age and apparently from birth. In addition, the molecular and physiological data reported here on the heterozygous parents support a role for the CRX protein in maintaining normal function even in differentiated photoreceptors. Together with the previous clinical findings in a CORD family (13), our results of cone dysfunction in the heterozygous carrier parents indicate that different mutations within the CRX homeodomain can result in varying degrees of severity, which sometimes may not be recognized clinically until later in life. It is tempting to speculate that certain CRX mutations (in particular those in less conserved functional domains), alone or in combination with other genes [e.g. ABCR (27)], may result in progressive yet slow loss of cone function, as observed in elderly patients with age-related macular degeneration.

MATERIALS AND METHODS

Mutation analysis

Blood samples were collected from participants in the study after obtaining informed consent. Standard methods were used for genomic DNA preparation. The procedures for mutation analysis have been described earlier (13,28). Briefly, oligonucleotide primers flanking the CRX exons (see ref. 13 for primer sequences) were used for PCR amplification of genomic DNA and the products were directly sequenced using the Sequenase kit (Amersham Life Science). When indicated, PCR products were digested with BsrI restriction enzyme (New England Biolabs), as per the manufacturer’s instructions.

DNA binding studies

CRXHDR90W-GST was generated as previously described for CRXHD-GST (11), except that the CRXR90W/pcDNA3.1/HisC vector was used as template DNA for the PCR reaction. Recombinant CRXHD-GST and CRXHDR90W-GST proteins were expressed, purified, analyzed by SDS-PAGE and immunoblot and tested by EMSA, as described (11).

Transient transfection studies

A mammalian expression construct for the CRXR90W mutant was generated from a human CRX/pcDNA3.1/HisC vector (11) using the QuickChange site-directed mutagenesis kit according to the manufacturer’s instructions (Stratagene). The primers used for the mutagenesis were CAGGTTTGGTTCAAGAACTGGAGGGCTAAATGCAGGC and GCCTGCATTTAGCCCTCCAGTTCTTGAACCAAACCTG. The mutation was confirmed by sequencing. Transient transfection assays were performed and analyzed as previously described (11), except that the total amount of DNA was kept constant in each transfection by the addition of an appropriate amount of ‘empty’ pcDNA3.1/His C plasmid (Invitrogen).

Visual function analysis

Clinical evaluation and retinal function testing, including visual fields measurement by Goldmann perimetry, dark-adapted absolute threshold sensitivity by Goldmann-Weekers determination and color vision testing with Ishihara plates and Farnsworth’s dichromate (D-15) panel were performed in standard fashion; retinal function testing by ERG recordings are described elsewhere (23).

ACKNOWLEDGEMENTS

We thank Ms Dorothy Giebel for assistance in preparing the manuscript. This research was supported by grants from the National Institutes of Health (EY06094, EY07003, EY09769 and EY11115), the Foundation Fighting Blindness (Hunt Valley, MD), the Rebecca P. Moon, Charles M. Moon Jr and Dr P. Thomas Manchester Research Fund and the Lois Duffey AMD Research Fund. Q.W. is the recipient of a Knights Templar Foundation fellowship and S.C. a grant-in-aid from Fight for Sight. A.S. is the recipient of a Lew R.Wasserman Merit Award, D.J.Z. and S.C. career development awards and P.A.S. a Senior Scientific Investigator Award, from Research to Prevent Blindness Inc.

REFERENCES

1. Dowling, J.E. (1987) The Retina-An Approachable Part of the Brain. Harvard University Press, Cambridge, MA.

2. Cepko, C.L., Austin, C.P., Yang, X., Alexiades, M. and Ezzeddine, D. (1996) Cell fate determination in the vertebrate retina. Proc. Natl Acad. Sci. USA, 93, 589-595. MEDLINE Abstract

3. He, X. and Rosenfeld, M.G. (1991) Mechanisms of complex transcriptional regulation: implications for brain development. Neuron, 7, 183-196. MEDLINE Abstract

4. Struhl, K. (1991) Mechanisms for diversity in gene expression patterns. Neuron, 7, 177-181. MEDLINE Abstract

5. Blau, H.M. (1992) Differentiation requires continuous active control. Annu. Rev. Biochem., 61, 1213-1230. MEDLINE Abstract

6. Kumar, R. and Zack, D.J. (1994) Regulation of visual pigment gene expression. In Wiggs, J.L. (ed.), Molecular Genetics of Ocular Disease. Wiley-Liss, New York, NY, pp. 139-160.

7. Swaroop, A., Xu, J., Pawar, H., Jackson, A., Skolnick, C. and Agarwal, N. (1992) A conserved retina-specific gene encodes a basic motif/leucine zipper domain. Proc. Natl Acad. Sci. USA, 89, 266-270. MEDLINE Abstract

8. Freund. C., Horsford, D.J. and McInnes, R.R. (1996) Transcription factor genes and the developing eye: a genetic perspective. Hum. Mol. Genet., 5, 1471-1488. MEDLINE Abstract

9. Furukawa, T., Morrow, E.M. and Cepko, C.L. (1997) Crx, a novel otx-like homeobox gene shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell, 91, 531-541. MEDLINE Abstract

10. Freund, C.L., Gregory-Evans, C.Y., Furukawa, T., Papaioannou, M., Looser, J., Ploder, L., Bellingham, J., Ng, D., Herbrick, J.-A.S., Duncan, A., Scherer, S.W., Tsui, L.-C., Loutradis-Anagnostou, A., Jacobson, S.G., Cepko, C.L., Bhattacharya, S. and McInnes, R.R. (1997) Cone-rod dystrophy due to mutations in novel photoreceptor-specific homeobox gene (CRX) essential for maintenance of the photoreceptor. Cell, 91, 543-553. MEDLINE Abstract

11. Chen, S., Wang, Q.-L., Nie, Z., Sun, H., Lennon, G., Copeland, N.G.,Gilbert, D.J., Jenkins, N.A. and Zack, D.J. (1997) Crx, a novel Otx-like paired-homeodomain protein, binds to and transactivates photoreceptor cell-specific genes. Neuron, 19, 1017-1030. MEDLINE Abstract

12. Finkelstein, R. and Boncinelli, E. (1994) From fly head to mammalian forebrain: the story of otd and Otx. Trends Genet., 10, 310-315. MEDLINE Abstract

13. Swain, P.K., Chen, S., Wang, Q.-L, Affatigato, L.M., Coats, C.L., Brady, K.D., Fishman, G.A., Jacobson, S.G., Swaroop, A., Stone, E., Sieving, P.A. and Zack, D.J. (1997) Mutations in the cone-rod homeobox gene are associated with the cone-rod dystrophy photoreceptor degeneration. Neuron, 19, 1329-1336. MEDLINE Abstract

14. Schroeder R., Mets, M.B. and Maumenee, I.H. (1987) Leber's congenital amaurosis. Arch. Ophthalmol., 105, 356-359. MEDLINE Abstract

15. Perrault, I., Rozet, J.M., Calvas, P., Gerber, S., Camuzat, A., Dollfus, H., Chatelin, S., Souied, E., Ghazi, I., Leowski, C., Bonnemaison, M., Pralier, D.L., Frezal, J., Dufier, J.-L., Ipttler, S., Munnich, A. and Kaplan, J. (1996) Retinal-specific guanylate cyclase gene mutations in Leber's congenital amaurosis. Nature Genet., 14, 461-464. MEDLINE Abstract

16. Marlhens, F., Bareil, C., Griffoin, J.-M., Zrenner, E., Amalric, P., Eliaou,Liu, S.-Y., Harris, E., Redmond, T.M., Arnaud, B., Claustres, M. and Hamel, C.P. (1997) Mutations in RPE65 cause Leber's congenital amaurosis. Nature Genet., 17, 139-141. MEDLINE Abstract

17. Morimura, H., Fishman, G.A., Grover, S.A., Fulton, A.B., Berson, E.L. and Dryja, T.P. (1998) Mutations in the RPE65 gene in patients with autosomal recessive retinitis pigmentosa or Leber congenital amaurosis. Proc. Natl Acad. Sci. USA, 95, 3088-3093. MEDLINE Abstract

18. Freund, C.L., Wang, Q.-L., Chen, S., Muskat, B.L., Wiles, C.D., Sheffield, V.C., Jacobson, S.G., McInnes, R.R., Zack, D.J. and Stone, E.M. (1998) De novo mutations in the CRX homeobox gene associated with Leber congenital amaurosis. Nature Genet., 18, 311-312. MEDLINE Abstract

19. Farber, D.B. and Danciger, M. (1997) Identification of genes causing photoreceptor degenerations leading to blindness. Curr. Opin. Neurobiol., 7, 666-673. MEDLINE Abstract

20. Rehemtulla, A., Warwar, R., Kumar, R., Ji, X., Zack, D.J. and Swaroop, A. (1996) The basic motif-leucine zipper transcription factor Nrl can positively regulate rhodopsin gene expression. Proc. Natl Acad. Sci. USA, 93, 191-195. MEDLINE Abstract

21. Kumar, R., Chen, S., Scheurer, D., Wang, Q.L., Duh, E., Sung, C.H., Rehemtulla, A., Swaroop, A., Adler, R. and Zack, D.J. (1996) The bZIP transcription factor Nrl stimulates rhodopsin promoter activity in primary retinal cell cultures. J. Biol. Chem., 271, 29612-29618. MEDLINE Abstract

22. Farjo, Q., Jackson, A., Pieke-Dahl, S., Scott, K., Kimberling, W.J., Sieving, P.A., Richards, J.R. and Swaroop, A. (1997) Human bZIP transcription factor gene NRL: structure, genomic sequence, fine linkage mapping at 14q11.2 and negative mutation analysis in patients with retinal degeneration. Genomics, 45, 395-401. MEDLINE Abstract

23. Sieving, P.A. (1993) Photopic ON- and OFF-pathway abnormalities in retinal dystrophies. Trans. Am. Ophthalmol. Soc., 91, 701-773. MEDLINE Abstract

24. Sieving, P.A. (1995) Diagnostic issues with inherited retinal and macular dystrophies. In Gorin, M. (ed.), Seminars in Ophthalmology. W.B.Saunders, Philadelphia, PA, pp. 279-294.

25. Jacobson, S.G., Cideciyan, A.V., Huang, Y., Hanna, D.B., Freund, C.L., Affatigato, L.M., Carr, R.E., Zack, D.J., Stone, E.M. and McInnes, R.R. (1998) Retinal degenerations with truncation mutations in the Cone-Rod Homeobox (CRX) gene. Invest. Ophthalmol. Vis. Sci., 39, 2417-2426. MEDLINE Abstract

26. Sohocki, M.M., Sullivan, L.S., Mintz-Hittner, H.A., Birch, D.,Heckenlively, J.R., Freund, C.L., McInnes, R.R. and Daiger, S.P. (1998) A range of clinical phenotypes associated with mutations in CRX, a photoreceptor transcription-factor gene. Am. J. Hum. Genet., 63, 1307-1315. MEDLINE Abstract

27. Allikmets, R., Shroyer, N.F, Singh, N., Seddon, J.M., Lewis, R.A., Bernstein, P.S., Peiffer, A., Zabriskie, N.A., Li, Y., Hutchinson, A., Dean, M., Lupski, J.R. and Leppert, M. (1997) Mutation of the Stargardt disease gene (ABCR) in age-related macular degeneration. Science, 277, 1805-1807. MEDLINE Abstract

28. Fujita, R., Buraczynska, M., Gieser, L., Wu, W., Forsythe, P., Abrahamson, M., Jacobson, S.G., Andreasson, S., Sieving, P.A. and Swaroop, A. (1997) Analysis of the RPGR gene in 11 families with the RP3 genotype: paucity of mutations in the coding region, but splice defects in two families. Am. J. Hum. Genet., 61, 571-580. MEDLINE Abstract

29. Morabito, M.A., Yu, X. and Barnstable, C.J. (1991) Characterization of developmentally regulated and retina-specific nuclear protein binding to a site in the upstream region of the rat opsin gene. J. Biol. Chem., 266, 9667-9672. MEDLINE Abstract

30. Kikuchi, T., Raju, K., Breitman, M.L. and Shinohara, T. (1993) The proximal promoter of the mouse arrestin gene directs gene expression in photoreceptor cells and contains an evolutionarily conserved retinal factor-binding site. Mol. Cell. Biol., 13, 4400-4408. MEDLINE Abstract

31. Chen, S. and Zack, D.J. (1996) Ret 4, a positive acting rhodopsin regulatory element identified using a bovine retina in vitro transcription system. J. Biol. Chem., 271, 28549-28557. MEDLINE Abstract

32. DesJardin, L.E. and Hauswirth, W.W. (1996) Developmentally important DNA elements within the bovine opsin upstream region. Invest. Ophthalmol. Vis. Sci., 37, 154-165. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +1 734 936 9547; Fax: +1 734 647 0228; Email: swaroop@umich.edu

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 4 Feb 1999
Copyright©Oxford University Press, 1999.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 IOVSHome page
Y. Li, H. Wang, J. Peng, R. A. Gibbs, R. A. Lewis, J. R. Lupski, G. Mardon, and R. Chen
Mutation Survey of Known LCA Genes and Loci in the Saudi Arabian Population
Invest. Ophthalmol. Vis. Sci., March 1, 2009; 50(3): 1336 - 1343.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
G.-H. Peng and S. Chen
Crx activates opsin transcription by recruiting HAT-containing co-activators and promoting histone acetylation
Hum. Mol. Genet., October 15, 2007; 16(20): 2433 - 2452.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Khanna, M. Akimoto, S. Siffroi-Fernandez, J. S. Friedman, D. Hicks, and A. Swaroop
Retinoic Acid Regulates the Expression of Photoreceptor Transcription Factor NRL
J. Biol. Chem., September 15, 2006; 281(37): 27327 - 27334.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. Zernant, M. Kulm, S. Dharmaraj, A. I. den Hollander, I. Perrault, M. N. Preising, B. Lorenz, J. Kaplan, F. P. M. Cremers, I. Maumenee, et al.
Genotyping Microarray (Disease Chip) for Leber Congenital Amaurosis: Detection of Modifier Alleles
Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3052 - 3059.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. Lord-Grignon, N. Tetreault, A. J. Mears, A. Swaroop, and G. Bernier
Characterization of New Transcripts Enriched in the Mouse Retina and Identification of Candidate Retinal Disease Genes
Invest. Ophthalmol. Vis. Sci., September 1, 2004; 45(9): 3313 - 3319.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
K. M. B. O'Brien, H. Cheng, Y. Jiang, D. Schulte, A. Swaroop, and A. E. Hendrickson
Expression of Photoreceptor-Specific Nuclear Receptor NR2E3 in Rod Photoreceptors of Fetal Human Retina
Invest. Ophthalmol. Vis. Sci., August 1, 2004; 45(8): 2807 - 2812.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
H. Cheng, H. Khanna, E. C.T. Oh, D. Hicks, K. P. Mitton, and A. Swaroop
Photoreceptor-specific nuclear receptor NR2E3 functions as a transcriptional activator in rod photoreceptors
Hum. Mol. Genet., August 1, 2004; 13(15): 1563 - 1575.
[Abstract] [Full Text] [PDF]

Home page
 Arch OphthalmolHome page
S. Dharmaraj, B. P. Leroy, M. M. Sohocki, R. K. Koenekoop, I. Perrault, K. Anwar, S. Khaliq, R. S. Devi, D. G. Birch, E. De Pool, et al.
The Phenotype of Leber Congenital Amaurosis in Patients With AIPL1 Mutations
Arch Ophthalmol, July 1, 2004; 122(7): 1029 - 1037.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
J. E. Ploski, M. K. Shamsher, and A. Radu
Paired-Type Homeodomain Transcription Factors Are Imported into the Nucleus by Karyopherin 13
Mol. Cell. Biol., June 1, 2004; 24(11): 4824 - 4834.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
Q.-l. Wang, S. Chen, N. Esumi, P. K. Swain, H. S. Haines, G. Peng, B. M. Melia, I. McIntosh, J. R. Heckenlively, S. G. Jacobson, et al.
QRX, a novel homeobox gene, modulates photoreceptor gene expression
Hum. Mol. Genet., May 15, 2004; 13(10): 1025 - 1040.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
A. D. Rutherford, N. Dhomen, H. K. Smith, and J. C. Sowden
Delayed Expression of the Crx Gene and Photoreceptor Development in the Chx10-Deficient Retina
Invest. Ophthalmol. Vis. Sci., February 1, 2004; 45(2): 375 - 384.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
S. Chen, G.-H. Peng, X. Wang, A. C. Smith, S. K. Grote, B. L. Sopher, and A. R. La Spada
Interference of Crx-dependent transcription by ataxin-7 involves interaction between the glutamine regions and requires the ataxin-7 carboxy-terminal region for nuclear localization
Hum. Mol. Genet., January 1, 2004; 13(1): 53 - 67.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
I Perrault, S Hanein, S Gerber, F Barbet, J-L Dufier, A Munnich, J-M Rozet, and J Kaplan
Evidence of autosomal dominant Leber congenital amaurosis (LCA) underlain by a CRX heterozygous null allele
J. Med. Genet., July 1, 2003; 40(7): e90 - 90.
[Full Text] [PDF]

Home page
 Hum Mol GenetHome page
K. P. Mitton, P. K. Swain, H. Khanna, M. Dowd, I. J. Apel, and A. Swaroop
Interaction of retinal bZIP transcription factor NRL with Flt3-interacting zinc-finger protein Fiz1: possible role of Fiz1 as a transcriptional repressor
Hum. Mol. Genet., February 15, 2003; 12(4): 365 - 373.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. Wang, S. Xu, C. Rivolta, L. Y. Li, G.-H. Peng, P. K. Swain, C.-H. Sung, A. Swaroop, E. L. Berson, T. P. Dryja, et al.
Barrier to Autointegration Factor Interacts with the Cone-Rod Homeobox and Represses Its Transactivation Function
J. Biol. Chem., November 1, 2002; 277(45): 43288 - 43300.
[Abstract] [Full Text] [PDF]

Home page
 Arch OphthalmolHome page
R. K. Koenekoop, G. A. Fishman, A. Iannaccone, H. Ezzeldin, M. L. Ciccarelli, A. Baldi, J. S. Sunness, A. J. Lotery, M. M. Jablonski, S. J. Pittler, et al.
Electroretinographic Abnormalities in Parents of Patients With Leber Congenital Amaurosis Who Have Heterozygous GUCY2D Mutations
Arch Ophthalmol, October 1, 2002; 120(10): 1325 - 1330.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. P. Van Hooser, Y. Liang, T. Maeda, V. Kuksa, G.-F. Jang, Y.-G. He, F. Rieke, H. K. W. Fong, P. B. Detwiler, and K. Palczewski
Recovery of Visual Functions in a Mouse Model of Leber Congenital Amaurosis
J. Biol. Chem., May 17, 2002; 277(21): 19173 - 19182.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
F. P. M. Cremers, J. A. J. M. van den Hurk, and A. I. den Hollander
Molecular genetics of Leber congenital amaurosis
Hum. Mol. Genet., May 15, 2002; 11(10): 1169 - 1176.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
S. Chen, Q.-L. Wang, S. Xu, I. Liu, L. Y. Li, Y. Wang, and D. J. Zack
Functional analysis of cone-rod homeobox (CRX) mutations associated with retinal dystrophy
Hum. Mol. Genet., April 15, 2002; 11(8): 873 - 884.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
L. C. Bibb, J. K.L. Holt, E. E. Tarttelin, M. D. Hodges, K. Gregory-Evans, A. Rutherford, R. J. Lucas, J. C. Sowden, and C. Y. Gregory-Evans
Temporal and spatial expression patterns of the CRX transcription factor and its downstream targets. Critical differences during human and mouse eye development.
Hum. Mol. Genet., July 1, 2001; 10(15): 1571 - 1579.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
R. T. Tzekov, Y. Liu, M. M. Sohocki, D. J. Zack, S. P. Daiger, J. R. Heckenlively, and D. G. Birch
Autosomal Dominant Retinal Degeneration and Bone Loss in Patients with a 12-bp Deletion in the CRX Gene
Invest. Ophthalmol. Vis. Sci., May 1, 2001; 42(6): 1319 - 1327.
[Abstract] [Full Text]

Home page
 IOVSHome page
E. Tan, Q. Wang, A. B. Quiambao, X. Xu, N. M. Qtaishat, N. S. Peachey, J. Lem, S. J. Fliesler, D. R. Pepperberg, M. I. Naash, et al.
The Relationship between Opsin Overexpression and Photoreceptor Degeneration
Invest. Ophthalmol. Vis. Sci., March 1, 2001; 42(3): 589 - 600.
[Abstract] [Full Text]

Home page
 IOVSHome page
Y. Liu, Y.-C. Shen, J. S. Rest, P. A. Raymond, and D. J. Zack
Isolation and Characterization of a Zebrafish Homologue of the Cone Rod Homeobox Gene
Invest. Ophthalmol. Vis. Sci., February 1, 2001; 42(2): 481 - 487.
[Abstract] [Full Text]

Home page
 Hum Mol GenetHome page
P. Q. Thomas, M. T. Dattani, J. M. Brickman, D. McNay, G. Warne, M. Zacharin, F. Cameron, J. Hurst, K. Woods, D. Dunger, et al.
Heterozygous HESX1 mutations associated with isolated congenital pituitary hypoplasia and septo-optic dysplasia
Hum. Mol. Genet., January 1, 2001; 10(1): 39 - 45.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
K.-Y. Chau, N. Munshi, A. Keane-Myers, K.-W. Cheung-Chau, A. K.-F. Tai, G. Manfioletti, C. K. Dorey, D. Thanos, D. J. Zack, and S. J. Ono
The Architectural Transcription Factor High Mobility Group I(Y) Participates in Photoreceptor-Specific Gene Expression
J. Neurosci., October 1, 2000; 20(19): 7317 - 7324.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Y. Fei and T. E. Hughes
Nuclear Trafficking of Photoreceptor Protein Crx: The Targeting Sequence and Pathologic Implications
Invest. Ophthalmol. Vis. Sci., September 1, 2000; 41(10): 2849 - 2856.
[Abstract] [Full Text]

Home page
 Am. J. Physiol. Cell Physiol.Home page
B. A. Hughes, G. Kumar, Y. Yuan, A. Swaminathan, D. Yan, A. Sharma, L. Plumley, T. L. Yang-Feng, and A. Swaroop
Cloning and functional expression of human retinal Kir2.4, a pH-sensitive inwardly rectifying K+ channel
Am J Physiol Cell Physiol, September 1, 2000; 279(3): C771 - C784.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
B. Lorenz, P. Gyürüs, M. Preising, D. Bremser, S. Gu, M. Andrassi, C. Gerth, and A. Gal
Early-Onset Severe Rod-Cone Dystrophy in Young Children with RPE65 Mutations
Invest. Ophthalmol. Vis. Sci., August 1, 2000; 41(9): 2735 - 2742.
[Abstract] [Full Text]

Home page
 IOVSHome page
E. Silva, J.-M. Yang, Y. Li, S. Dharmaraj, O. H. Sundin, and I. H. Maumenee
A CRX Null Mutation Is Associated with Both Leber Congenital Amaurosis and a Normal Ocular Phenotype
Invest. Ophthalmol. Vis. Sci., July 1, 2000; 41(8): 2076 - 2079.
[Abstract] [Full Text]

Home page
 Arch OphthalmolHome page
A. J. Lotery, P. Namperumalsamy, S. G. Jacobson, R. G. Weleber, G. A. Fishman, M. A. Musarella, C. S. Hoyt, E. Heon, A. Levin, J. Jan, et al.
Mutation Analysis of 3 Genes in Patients With Leber Congenital Amaurosis
Arch Ophthalmol, April 1, 2000; 118(4): 538 - 543.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K.-Y. Chau, S. Chen, D. J. Zack, and S. J. Ono
Functional Domains of the Cone-Rod Homeobox (CRX) Transcription Factor
J. Biol. Chem., November 17, 2000; 275(47): 37264 - 37270.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. P. Mitton, P. K. Swain, S. Chen, S. Xu, D. J. Zack, and A. Swaroop
The Leucine Zipper of NRL Interacts with the CRX Homeodomain. A POSSIBLE MECHANISM OF TRANSCRIPTIONAL SYNERGY IN RHODOPSIN REGULATION
J. Biol. Chem., September 15, 2000; 275(38): 29794 - 29799.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. K. Swain, D. Hicks, A. J. Mears, I. J. Apel, J. E. Smith, S. K. John, A. Hendrickson, A. H. Milam, and A. Swaroop
Multiple Phosphorylated Isoforms of NRL Are Expressed in Rod Photoreceptors
J. Biol. Chem., September 21, 2001; 276(39): 36824 - 36830.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (89)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Swaroop, A.
Right arrow Articles by Sieving, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Swaroop, A.
Right arrow Articles by Sieving, P. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?