Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (146)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Feng, L.
Right arrow Articles by Swank, R. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Feng, L.
Right arrow Articles by Swank, R. T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 323-330  

The [beta]3A subunit gene (Ap3b1) of the AP-3 adaptor complex is altered in the mouse hypopigmentation mutant pearl, a model for Hermansky-Pudlak syndrome and night blindness
Introduction
Results
   Positional/candidate cloning identifies [beta]3A as a candidate gene for pearl
   [beta]3A is mutated in two pearl alleles
   Expression of [beta]3A transcripts is altered in pearl alleles
Discussion
Materials And Methods
   Mice
   Probes
   Interspecific backcross and construction of physical maps with YACs and BACs
   YAC/BAC end clone isolation
   3[prime] Exon trapping
   Mouse [beta]3A isolation
   Northern blots, RT-PCR and sequencing
Acknowledgements
Note Added In Proof
References

The [beta]3A subunit gene (Ap3b1) of the AP-3 adaptor complex is altered in the mouse hypopigmentation mutant pearl, a model for Hermansky-Pudlak syndrome and night blindness

The [beta]3A subunit gene (Ap3b1) of the AP-3 adaptor complex is altered in the mouse hypopigmentation mutant pearl, a model for Hermansky-Pudlak syndrome and night blindness

Lijun Feng+, Albert B. Seymour1,+, Shelley Jiang, Agnes To2, Andrew A. Peden3, Edward K. Novak, Lijie Zhen, Michael E. Rusiniak, Eva M. Eicher4, Margaret S. Robinson3, Michael B. Gorin2 and Richard T. Swank*

Department of Molecular and Cell Biology, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, NY 14263, USA, 1Pfizer Central Research, Department of Genomics, Targets and Cancer, Eastern Point Road, Groton, CT 06340, USA, 2Department of Human Genetics and Department of Ophthalmology, University of Pittsburgh, Pittsburgh, PA 15213, USA, 3University of Cambridge, Department of Clinical Biochemistry, Cambridge CB2 2QR, UK and 4The Jackson Laboratory, 600 Main Street, Bar Harbor, ME 04609, USA

Received September 18, 1998; Revised and Accepted November 6, 1998

Lysosomes, melanosomes and platelet-dense granules are abnormal in the mouse hypopigmentation mutant pearl. The [beta]3A subunit of the AP-3 adaptor complex, which likely regulates protein trafficking in the trans-Golgi network/endosomal compartments, was iden-tified as a candidate for the pearl gene by a positional/candidate cloning approach. Mutations, including a large internal tandem duplication and a deletion, were identified in two respective pearl alleles and are predicted to abrogate function of the [beta]3A protein. Significantly lowered expression of altered [beta]3A transcripts occurred in kidney of both mutant alleles. The several distinct pearl phenotypes suggest novel functions for the AP-3 complex in mammals. These experiments also suggest mutations in AP-3 subunits as a basis for unique forms of human Hermansky-Pudlak syndrome and congenital night blindness, for which the pearl mouse is an appropriate animal model.

INTRODUCTION

The autosomal recessive mouse mutation pearl (pe) (1) maps to distal chromosome 13 (2-4). Pearl mice are appropriate models for Hermansky-Pudlak syndrome (HPS) as they exhibit hypopigmentation, lysosomal secretion abnormalities and platelet-dense granules with reduced levels of adenine nucleotides and serotonin (5). The latter leads to the prolonged bleeding symptomatic of platelet storage pool deficiency and HPS. Additionally, pearl mice exhibit reduced sensitivity in the dark-adapted state, suggesting a model for human congenital stationary night blindness (6).

HPS patients have altered biosynthesis/function of melanosomes, platelet-dense granules and lysosomes (7-9). Due to associated fibrotic lung disease, prolonged bleeding and colitis, HPS leads to high morbidity and increased mortality (8-10) in the third to fifth decades of life. It occurs in diverse populations worldwide and is especially prevalent in selected regions such as Puerto Rico, due to founder effects. No curative therapies exist.

Intracellular protein sorting and trafficking are conducted by means of carrier vesicles (11) whose formation is mediated by adaptor protein (AP) complexes (12). An adaptor-related coat complex, termed AP-3, likely facilitates trafficking of vesicles from the trans-Golgi network and/or endosomal compartments by interacting with tyrosine and di-leucine signals on proteins of lysosomes and other intracellular organelles (13,14). AP-3 is heterotetrameric containing two large subunits, [delta] and [beta]3, a medium subunit, µ3, and a small subunit, [sigma]3. Details of the function of AP-3 in mammals are not well understood. We report positional/candidate cloning of pearl and evidence from mutational analysis that the primary pearl gene defect is in the [beta]3A subunit (the Ap3b1 gene) of the AP-3 adaptor complex.

RESULTS

Positional/candidate cloning identifies [beta]3A as a candidate gene for pearl

Identification of [beta]3A as a candidate for the pearl (pe) gene required high resolution genetic and physical maps. We previously localized pe to a 0.5 cM region (2,3) on chromosome 13 between D13Mit28/29 and Cf2r using an interspecific backcross of 1250 progeny. Further analyses (Fig. 1A) showed that D13Mit28 is 0.2 cM proximal of pe and is, in fact, the closest recombinant proximal marker to pe. Also, several new non-recombinant markers (defined by 1L, 8L, 2E and 18E) derived from yeast artifical chromosome (YAC) and bacterial artificial chromosome (BAC) end clones were positioned on the genetic and physical maps.


Figure 1. (A) Expanded and current high resolution molecular map around the pearl (pe) gene. The centromere (circle) is at left; distances between adjacent markers are given below in map units (cM). Bold markers are expressed genes. Numbered markers are D13Mit microsatellites. Other markers were derived from BAC or YAC end clones. The darkened portion of the chromosome indicates the maximum genetic interval containing the pe gene. (B) Physical map of the pe region of chromosome 13. The 0.4 map unit region between D13Mit28 and Cf2r is expanded. The positions of individual microsatellites (D13Mit28, 108, 161, 169, 258 and 104), YAC ends (1L and 8L), BAC ends (18E and 2E) and the expressed gene Cf2r are indicated at the top. YACs (Y) and BACs (B) are located at their approximate chromosomal positions, represented by horizontal lines (not drawn to scale). Triangles indicate BAC/YAC end clones, circles indicate microsatellites and squares indicate expressed sequences. Four BACs (B255G14, B326G19, B146H3 and B194B1) were subjected to exon trapping. There is a gap between 2E and D13Mit104.

This high resolution genetic map enabled the selection of a series of overlapping YACs and BACs in the region of pe. Two overlapping YACs (Y1 and Y8), selected with markers either non-recombinant with or flanking pe, covered most of the critical region between D13Mit28 and several markers non-recombinant with pe (D13Mit108, 161, 169 and 258). Twenty BACs were found later to cover the region that included four D13Mit markers that were non-recombinant with pe (D13Mit108, 161, 169 and 258) and four markers that were derived from end clones of either YACs (1L and 8L) or BACs (2E and 8E). These markers were physically ordered by their presence or absence on these BACs. The physical contig, with a gap between 2E and D13Mit104, is depicted in Figure 1B.

To identify candidate genes for pe, four BACs (B255G14, B194B1, B326G19 and B146H3) harboring the eight markers non-recombinant with pe were subjected to 3[prime] exon trapping. A total of 22 potential exons were isolated. One exon-trapped clone (Xho57) found on BAC255G14 exhibited significant homology to the recently cloned [beta]3A subunit of the human AP-3 adaptor complex (13,14). Because the AP-3 complex is involved in vesicle targeting at the trans-Golgi network/endosome subcellular sites (13,14), Southern analyses revealed alterations in various pearl alleles (data not shown) and high resolution genetic and physical maps (Fig. 1) localized [beta]3A in the region of pe, [beta]3A was considered a promising candidate gene for pe.

[beta]3A is mutated in two pearl alleles

Primers were designed from human and mouse [beta]3A cDNA sequences to search for mutations by amplifying overlapping regions (Fig. 2). Primers 2092/3102 (Fig. 3A and B gives primer locations), within the mouse cDNA sequence corresponding to the hinge region (13) of the [beta]3A protein, amplified an ~800 bp larger product from pe/pe compared with +/+ (normal) cDNA (Fig. 2), suggesting an insertion or duplication involved in the pe mutation. Other sets of primers within this region produced additional novel results (Fig. 2). For example, primer pair 1720/2272 gave the predicted 553 bp product from control C57BL/6J cDNA, but produced an additional 1.3 kb fragment from pearl cDNA. This result was expected, given a duplication (Fig. 3B) within the pearl transcript. To further test the duplication model, amplification was performed with a primer pair (2628/2496) contained within the putative duplicated region but oriented so that a product is expected from mutant but not normal cDNA (Fig. 3B). As predicted by the duplication model, no PCR product was obtained from control C57BL/6J cDNA, while a product of ~670 bp was obtained from pearl cDNA, confirming the duplication model. Another primer pair (1476/2112) amplifying a region upstream of the duplication produced the expected 637 bp fragment from control and pearl cDNAs. Similarly, primers targeted to downstream regions gave equal size products from control and mutant cDNA (data not shown).


Figure 2. Alterations in transcripts of [beta]3A of normal and pearl mice detected by RT-PCR amplification. Transcripts from normal and mutant kidney were amplified by RT-PCR with the indicated primer pairs below. A negative cDNA control (-) was included for each primer pair. The locations of individual primers within the [beta]3A sequence are given in Figures 3A and B.

PCR amplification across cDNA derived from mice carrying an independent mutation, pearl-8J (pe8J), revealed alterations of a different nature within this same region of the [beta]3A transcript (Fig. 2). A smaller than expected product appeared when pe8J/pe8J cDNA was amplified by primers 1720/2649, suggesting a deletion. No alterations were noted when the same samples were amplified by primers directed to cDNA regions upstream (1720/2496) or downstream (2628/3328) of the deletion (Fig. 2).

The regions of [beta]3A cDNA altered in pearl and pearl-8J were amplified and directly sequenced (Fig. 3A). As predicted by the PCR results, the pearl mutation contains a tandem duplication of a 793 bp region starting at nt 2135 (Fig. 3B). Further, the duplication alters the reading frame producing a stop codon at the duplication junction. This is expected to yield a protein with 130 amino acids truncated from the C-terminus of the 1105 amino acid [beta]3A protein. In contrast, the pearl-8J mutation contains a 107 bp deletion from nt 2504 to 2610 (Fig. 3C). Again, an alteration in reading frame occurs, predicting a stop codon at position 2644 together with the addition of 12 foreign C-terminal amino acids. As in the case of the pearl mutant, the expected result is a substantial C-terminal truncation (in this case 233 amino acids) of [beta]3A protein. No additional alterations of the [beta]3A cDNAs were found in either the pearl or pearl-8J mutants when the complete coding regions were sequenced and compared with their respective parental inbred strains of origin, C3H/HeJ and DBA/2J, respectively. In fact, the complete [beta]3A coding sequences were found to be identical in cDNAs isolated from C3H/HeJ and DBA/2J.

Sequence comparisons showed that the coding region of the cDNA of mouse [beta]3A (DDBJ/EMBL/GenBank accession no. AF103809) is highly related (88% identity) to the human counterpart (13,14) (DDBJ/EMBL/GenBank accession nos U91931 and U81504).

Expression of [beta]3A transcripts is altered in pearl alleles

The effects of the indicated duplication and deletion of portions of the [beta]3A transcript on its expression were determined by northern blotting. The distribution of the [beta]3A transcript was determined in total RNA from several tissues (Fig. 4A), including those (kidney, bone marrow, eye and macrophages) affected in pearl mice (5). The 4.2 kb (13) [beta]3A mRNA was expressed at significant levels in kidney, heart, bone marrow, eye and macrophages in control mice. However, consistent with nonsense-mediated mRNA decay, it was undetectable in total RNA from any tissue of pearl mice, nor were transcripts of altered size apparent. However, [beta]3A transcripts were detectable, though at considerably reduced levels, in poly(A)+ RNA from kidney of both pearl and pearl-8J mice (Fig. 4B). A larger transcript of 5.1 kb was detected in pearl and its expression was considerably reduced (to 17% of control). A transcript of approximately normal size, but considerably reduced in concentration (12% of control), was visible in pearl-8J kidney poly(A)+ RNA. The apparent mutant transcript sizes are consistent with the duplications and deletions detected by sequencing using the pearl and pearl-8J cDNAs, respectively (Fig. 3).

   A
   B, C

Figure 3. (A) The sequence of the region of normal [beta]3A cDNA surrounding pearl mutation sites. Vertical arrows indicate the beginning and end of the 793 bp sequence which is tandemly duplicated in the pe allele. The 107 bp which is deleted in the pe8J allele is underlined. Numbered forward (F) and reverse (R) primers used to amplify specific regions of cDNA are drawn above their sequence with numbers identifying the first nucleotide at the 5[prime]-end of the primer. The numbering convention is derived from the mouse [beta]3A coding sequence with number 1 indicating the start of the initiation codon. (B) (top) Tandem duplication of a 793 bp region predicts a truncated [beta]3A protein in the pe allele. Nucleotides 2135-2927 of the [beta]3A sequence are tandemly duplicated (large box). This results in the introduction of a stop codon (small box) at the duplication junction. Approximate positions of primers used in RT-PCR analyses (Fig. 2) are indicated above. (C) (bottom) Deletion of 107 bp of [beta]3A transcript leads to a frameshift and predicted truncated [beta]3A protein in the pe8J allele. Sequences of cDNAs and predicted amino acid sequences of mutant and the normal DBA/2J [beta]3A gene are indicated. The deletion (box) extends from nt 2504 to 2610 and produces a stop codon 36 nt downstream of the deletion.

   A
   B

Figure 4. [beta]3A mRNA is altered in size and expressed at very low levels in tissues of pearl and pearl-8J mice. (A) Total RNAs of kidney, heart, bone marrow, eye and macrophages of homozygous pearl mice and parental control C3H and C57BL/6J mice were tested by northern blotting with a [beta]3A probe. Control C3H/HeJ and C57BL/6J mice were included because the pe mutation arose in C3H/HeJ (1) and was subsequently transferred by repeated backcrossing to the C57BL/6J strain. (B) Northern blots of poly(A)+ RNA from kidneys of pearl and control C57BL/6J mice and kidneys of pearl-8J and control DBA/2J mice were probed with [beta]3A. The migration positions of standard RNAs are indicated. The same blots were reprobed with mouse [beta]-actin (below) as a loading control.

DISCUSSION

The data from high resolution genetic crosses together with mutation analyses of two independent pearl alleles provide strong evidence that the pearl gene (now designated Ap3b1) encodes the [beta]3A subunit of the AP-3 adaptor complex. The severe reductions in expression of transcripts in pearl and pearl-8J mice together with predicted large truncations in the [beta]3A subunit protein are expected to abrogate or at least seriously affect normal [beta]3A and AP-3 functions. Analyses of decreased levels of other AP-3 subunits in pearl mice (L.Zhen et al., manuscript in preparation) support this proposed loss of AP-3 function. The reduction in [beta]3A transcript levels in all tissues examined indicates that the mutation likely affects most tissues. Widespread tissue involvement is a characteristic of HPS (7). Further, the effects on transcripts are both quantitative and qualitative.

The several phenotypes of the pearl mutant mice suggest novel roles for the AP-3 complex in mammalian tissues. Pearl mice have abnormalities in structure and/or function of at least three related organelles: lysosomes, melanosomes and platelet-dense granules (5). Constitutive secretion of lysosomes from kidney proximal tubule cells of pearl mice is reduced to one third the normal rate and thrombin-mediated secretion of lysosomal enzymes from platelets occurs at half the normal rate. Increased rates of synthesis of lysosomal enzymes have been observed in kidney of the pearl mutant. Melanosomes of retinal pigment epithelium of pearl mice are morphologically abnormal and are mislocalized, being absent within the apical processes (15). The dense granules of pearl platelets are grossly abnormal in content. Together these varied phenotypes suggest that these three types of organelle are highly related and require AP-3 for their normal formation. This conclusion is consistent with an expanding body of biochemical and cell biological data (5) indicating that these organelles share certain membrane and lumenal components, maintain an acidic interior and can receive extracellular components internalized by endocytosis and phagocytosis. Also, the subcellular locations of the AP-3 complex in the trans-Golgi network and in more peripheral endosomal regions of the cell (13,14) are within the widely accepted subcellular pathway(s) for biogenesis/trafficking of lysosomes. Further, as pearl is a model for some forms of human congenital night blindness (6), a role for AP-3 in sensitivity of the retina to light, altered somatostatin binding (16) and acceleration of retinal apoptosis (17) is likely.

Supporting evidence for participation of the AP-3 complex in granule biogenesis/processing is derived from recent in vitro analyses of binding of granule proteins to AP-3 (18) and formation of synaptic vesicles from endosomes (19) together with studies of lysosomal trafficking in yeast AP-3 mutants (20,21) and pigment granule biogenesis in the garnet mutant of Drosophila (13,22). Additionally, a genetically distinct mouse hypopigmentation mutant, mocha, has reduced expression of the AP-3 complex as a result of a mutation in the [delta] subunit of AP-3 (23). As expected for mutations affecting subunits of a common protein complex, the effects of the mocha mutant on intracellular granules are similar to those of pearl (5). In both, the biosynthesis, function and/or morphology of the related cytoplasmic organelles lysosomes, melansomes and platelet-dense granules are abnormal. Both are appropriate models for HPS. In addition, mocha mice display an interesting hyperactive phenotype associated with reduced brain levels of the zinc transporter ZnT-3 (23), a fact which suggests that AP-3 function is lost in brain of mocha and maintained in brain of pearl. A possible mechanism for abnormal function of cytoplasmic organelles in pearl and mocha mice is that the AP-3 mutation causes mistargeting of organellar proteins similarly to the observed (20,21) abnormalities in targeting of proteins to the vacuole in yeast AP-3 mutants.

Pearl is one of a series of 14 distinct mouse pigment mutants (5) which exhibit phenotypes similar to those of HPS patients, making them ideal animal models for this syndrome. The existence of a large number of mouse HPS-like mutants is consistent with finding that >40 separate genes regulate the biosynthesis of the yeast vacuole (24,25) and suggests that additional human HPS genotypes, including pearl homologs, will be identified. This prediction has been at least partially fulfilled by evidence for genetic heterogeneity in HPS patients (26,27). A subgroup of HPS patients are altered in genes other than the recently cloned (28) human HPS gene. This indicates that identification and characterization of other mouse HPS genes such as the pe-[beta]3A gene, in addition to the recently identified ep (pale ear) gene (29,30), will be required for complete and accurate molecular and mutant animal modeling of these patients.

MATERIALS AND METHODS

Mice

The pearl (pe/pe) mutant occurred spontaneously on the C3H/He strain (1). C57BL/6J pe/pe mutant mice together with control C57BL/6J, C57BL/6J pe/+ and C3H/HeJ mice were obtained from the Jackson Laboratory (Bar Harbor, ME). The pe8J/pe8J mutant was identified in 1995 by Barbara Wilcomb. It occurred on the DBA/2J inbred strain. This mutant and control DBA/2J and pe8J/pe8J mice were likewise obtained from the Jackson Laboratory. Mice were subsequently bred and maintained in the animal facilities of Roswell Park Cancer Institute (Buffalo, NY).

Probes

For northern blotting, a 1.2 kb fragment from the 3[prime]-end of the mouse [beta]3A cDNA was used. Primers for PCR amplification of this fragment were 5[prime]-AACCCCAGCAAGAAAGACATCC-3[prime] (forward) and 5[prime]-CAAGAATGTCGAGAGTGCG-3[prime] (reverse), corresponding to nt 2461-2582 and 3463-3445, respectively, of human [beta]3A cDNA (13).

Other PCR primers were: 1476F, TGTTCCTGTGGCTAGAGCAAGC; 1720F, CGCACACGATTTATTAGGCAGC; 2092F, GAAGATGAGGATGAGAACCCC; 2112R, GGGGTTCTCATCCTCATCTTC; 2272R, TGGTTTTGGAGTTCCTCTTGGC; 2496R, GTCGACCAGATCTAGAAGG; 2628F, CGTGCCAACAAAAACACATGAG; 2649R, CTCATGTGTTTTTGTTGGCACG; 3102R, GAGGATCATGGAGGGAGTGA; 3328R, TGTAAGCAGGTTACCCCTGG.

Interspecific backcross and construction of physical maps with YACs and BACs

A large-scale interspecific mouse backcross (2,3) was used to map the pearl gene with high resolution (±0.3 cM) to the distal region of mouse chromosome 13.

Mouse YAC and BAC libraries were purchased from Research Genetics (Huntsville, AL). Libraries were screened by solution PCR and/or filter colony hybridization with markers near pe according to the manufacturer’s instruction. YAC or BAC clones were subjected to restriction enzyme (NotI) digestion and pulse field gel electrophoresis to determine the size of the insert. Clones for determination of overlap and sequence tag site mapping were derived from YACs or BACs as described below.

YAC/BAC end clone isolation

YAC and BAC genomic DNA was isolated as described (31). Specific YAC end clones were amplified using a bubble vector annealed template method using a YAC vector-derived primer from either the right or left arm and a bubble-specific primer. The right arm primer was 5[prime]-TCGAACGCCCGATCTCAAGATTAC-3[prime]; the left arm primer was 5[prime]-TCTCGGTAGCCAAGTTGGTTTAAGG-3[prime] (32). BAC end clones were isolated using the same technique with primers specific for the SP6 or T7 end of pBeloBAC11. Amplified products were subcloned into the pGEM-T vector according to the manufacturer’s protocol (Promega, Madison, WI). Aliquots of 0.5 µg DNA from positive end clones were sequenced using Cy5 fluorescently end-labeled M13 forward and reverse primers and the cycle sequencing kit from Pharmacia (Piscataway, NJ). The reactions were amplified for 35 cycles of 94°C, 30 s, 54°C, 45 s and 72°C, 1.5 min with 1 U Taq polymerase followed by a 72°C, 10 min extension at the end. Products were analyzed on an ALFexpress automated sequencer (Pharmacia). STSs were designed specific for the end clones using MacVector (Oxford Molecular, Campbell, CA).

3[prime] Exon trapping

To identify candidate genes for pe, four BACs (B255G14, B194B1, B326G19 and B146H3) harboring six markers non-recombinant with pe were subjected to 3[prime] exon trapping. A total of 22 potential exons were isolated. Aliquots of 5.0 µg of pooled genomic DNA from the four BACs were digested with either EcoRI, BamHI, XhoI, SalI, NotI or BglII according to the manufacturer’s conditions (New England Biolabs, Beverley, MA). An aliquot of 0.5 µg of digested genomic DNA was ligated into 0.5 µg NruI blunt-ended pTAG4 in a 10 µl reaction of 50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 10 mM DTT, 1.0 mM ATP, 25 µg/ml bovine serum albumin, with 400 U T4 DNA ligase overnight at 16°C. An aliquot of 1.0 µg of ligated DNA was transfected into COS-7 cells according to the manufacturer’s instructions (exon-trap kit; Gibco BRL, Gaithersburg, MD). Total RNA was isolated from the transfected cell lines using the Promega Reagents kit according to their protocol. Primary cDNA synthesis was performed using an adaptor primer, AAGGATCCGTCGACATC(T)17, and 1.0-3.0 µg of total RNA in a 20 µl reaction of 50.0 mM Tris-HCl, pH 8.3, 75.0 mM KCl, 3.0 mM MgCl2, 0.01 M DTT, 500 µM dNTPs, with 200 U reverse transcriptase for 5 min at 55°C. A two stage hemi-nested PCR was performed on the cDNA using primers specific for the SV40 site of the pTAG4 vector and for the adaptor primer at the 3[prime]-end. PCR reactions were 30 cycles of 94°C for 45 s, 55°C for 45 s and 72°C for 40 s in a standard PCR buffer. An aliquot of 1.0 µl of the PCR product was reamplified using a primer specific for the second exon of the adenovirus gene within the pTAG4 vector using identical PCR parameters. The PCR products were subcloned into the pAMP vector according to the manufacturer’s protocol (Gibco BRL) and used to transform DH10B cells via electroporation (Bio-Rad, Hercules, CA). Colonies were tested by PCR and selected based on size. Verification was performed primarily by hybridizing the trapped exon back to a panel of digested BAC genomic DNA. Trapped exon clones that mapped to the appropriate BAC clone were sequenced as described. Primers were designed to test for expression using pearl and wild-type (C57BL/6J) retinal cDNA libraries as templates. A BLAST search was performed on all sequenced clones to screen for homologies with known genes.

Mouse [beta]3A isolation

Trapped exon clone Xho57, containing a portion of the [beta]3A sequence, was used as a probe to screen a cDNA library derived from mouse retina/retinal pigment epithelial tissue propagated in [lambda]Zap (Stratagene, La Jolla, CA). The Xho57 clone was labeled with [32P]dCTP (DuPont, St Louis, MO) by the random hexamer method (33). The cDNA library was screened at a density of 50 000 plaques/150 mm Petri dish, for a total of 1 × 106 plaques. Isolated clones were sequenced in their entirety and used as templates for BLAST searches to identify 5[prime]-overlapping clones. Primers were designed from identified transcripts of the BLAST search and used to amplify the 5[prime]-regions of [beta]3A from the murine cDNA library or by RT-PCR using total RNA from C57Bl/6J retina/RPE.

Northern blots, RT-PCR and sequencing

Northern blotting was performed as described (31). Total RNA was isolated from mouse tissues with Trizol (Gibco BRL) according to the manufacturer’s protocol. The PolyATract mRNA Isolation System III kit (Promega) was used for isolation of poly(A)+ RNA. Total RNA (20 µg) or 7-10 µg poly(A)+ RNA was electrophoresed on 1% agarose gels, transferred to Hybond-N+ membranes and hybridized. 32P-labeled probes were generated from the 1.2 kb fragment of [beta]3A by random priming with the Prime-it kit (Stratagene). Molecular sizes were determined using a 0.24-9.5 kb RNA ladder from BRL. Blots were reprobed with a 502 bp fragment of mouse [beta]-actin as a loading control. [beta]-Actin PCR primers were from Stratagene. Northern blot signals were quantitated in duplicate with a Phosphorimager Storm 860 (Molecular Dynamics, Sunnyvale, CA).

Reverse transcription of RNA was performed using the Superscript preamplification system from BRL. Subsequent PCR amplification was performed with the Expand High Fidelity PCR system from Boehringer Mannheim (Indianapolis, IN). PCR products were treated with shrimp alkaline phosphatase and exonuclease I (Amersham, Piscataway, NJ) and then sequenced in a Perkin-Elmer Applied Biosystems (Foster City, CA) 373A DNA sequencer using an ABI Prism Dye Terminator Cycle Sequencing kit.

ACKNOWLEDGEMENTS

We thank Edward P. O’Brien for contributions to preliminary studies related to this research. Hope Sweet was responsible for determining that pearl-8J was an allele of the pearl gene. We are grateful to Dr Lawrence Pinto of Northwestern University and Dr Stephen Hardies of the University of Texas, San Antonio, for their help in earlier characterizations of the pearl mutant, to Debra Tabaczynski, Diane Poslinski, Barbara Wilcomb and Hope Sweet for capable animal husbandry and to Melissa Vetter, Mary Ketcham and Youhua Xie for aid in preparation of figures. This research was partially supported by shared resources of the Roswell Park Cancer Center Support grant P30 CA16056, NIH grants HL31698 and HL51480 (R.T.S.), grants from the Medical Research Council and the Wellcome Trust (M.S.R.), grants EY09192 and EY0898, grants from the Eye and Ear Foundation of Pittsburgh (M.B.G.) and resource grant RR01183 (E.M.E.).

NOTE ADDED IN PROOF

Two brothers with HPS and with molecular alterations of the [beta]3A subunit of the AP-3 complex have recently been identified: Gahl, W.A., Dell’Angelica, E., Shotelersuk, V. and Bonafacino, J.S. (1998) A human disorder due to a mutant beta3A subunit of adaptor complex-3: failed vesicle formation in brothers with Hermansky-Pudlak syndrome (HPS). Am. J. Hum. Genet., 63, A2 (abstract).

REFERENCES

1. Sarvella, P.A. (1954) Pearl, a new spontaneous coat and eye color mutation in the house mouse. J. Hered., 45, 19-20.

2. O'Brien, E.P., Novak, E.K., Zhen, L., Manly, K.F., Stephenson, D. and Swank, R.T. (1995) Molecular markers near two mouse chromosome 13 genes, muted and pearl, which cause platelet storage pool deficiency (SPD). Mamm. Genome, 6, 19-24. MEDLINE Abstract

3. Seymour, A.B., Yanak, B.L., O'Brien, E.P., Rusiniak, M.E., Novak, E.K., Pinto, L.H., Swank, R.T. and Gorin, M.B. (1996) An integrated genetic map of the pearl locus of mouse chromosome 13. Genome Res., 6, 538-544. MEDLINE Abstract

4. Sagai, T., Koide, T., Endo, M., Tanoue, K., Kikkawa, Y., Yonekawa, H., Ishiguro, S., Tamai, M., Matsuda, Y., Wakana, S. and Shiroishi, T. (1998) rim2 (recombination-induced mutation 2) is a new allele of pearl and a mouse model of human Hermansky-Pudlak Syndrome (HPS): genetic and physical mapping. Mamm. Genome, 9, 2-7. MEDLINE Abstract

5. Swank, R.T., Novak, E.K., McGarry, M.P., Rusiniak, M.E. and Feng, L. (1998) Mouse models of Hermansky-Pudlak syndrome: a review. Pigment Cell Res., 11, 60-80. MEDLINE Abstract

6. Balkema, G.W., Mangini, N.J. and Pinto, L.H. (1983) Discrete visual defects in pearl mutant mice. Science, 219, 1085-1087. MEDLINE Abstract

7. Witkop, C.J., Quevedo, W.C. Jr, Fitzpatrick, T.B. and King, R.A. (1989) In Scriver, C.R., Beaudet, A.L., Sly, W.S. and Valle, D. (eds), Albinism. The Metabolic Basis of Inherited Diseases. McGraw Hill, New York, NY,pp. 2905-2947.

8. King, R.A., Hearing, V.J., Creel, D.J. and Oetting, W.S. (1995) In Scriver, C.R., Beaudet, A.L., Sly, W.S. and Valle, D. (eds), Albinism. The Metabolic Basis of Inherited Disease. McGraw-Hill, New York, NY, Vol. III, pp. 4353-4392.

9. Witkop, C.J., Babcock, M.N., Rao, G.H.R., Gaudier, F., Summers, C.G., Shanahan, F., Harmon, K.R., Townsend, D., Sedano, H.O., King, R.A., Cal, S.X. and White, J.G. (1990) Albinism and Hermansky-Pudlak syndrome in Puerto Rico. Bol. Assoc. Med. Puerto Rico, 82, 333-339.

10. White, J.G. (1990) Structural defects in inherited and giant platelet disorders. Adv. Hum. Genet., 19, 133-234.

11. Schekman, R. and Orci, L. (1996) Coat proteins and vesicle budding. Science, 271, 1526-1533. MEDLINE Abstract

12. Robinson, M.S. (1997) Coats and vesicle budding. Trends Cell Biol., 7, 99-102.

13. Simpson, F., Peden, A.A., Christopoulou, L. and Robinson, M.S. (1997) Characterization of the adaptor-related protein complex, AP-3. J. Cell. Biol., 137, 835-845. MEDLINE Abstract

14. Dell'Angelica, E.C., Ooi, C.E. and Bonifacino, J.S. (1997) [beta]3A-adaptin, a subunit of the adaptor-like complex AP-3. J. Biol. Chem., 272, 15078-15084. MEDLINE Abstract

15. Mangini, N.J., Vanable, J.W. Jr, Williams, M.A. and Pinto, L.H. (1985) The optokinetic nystagmus and ocular pigmentation of hypopigmented mouse mutants. J. Comp. Neurol., 241, 191-209. MEDLINE Abstract

16. Kossut, M., Aldrich, L.B., Yamada, T. and Pinto, L.H. (1990) The binding of somatostatin to the mouse retina is altered by the pearl mutation. Brain Res., 522, 235-240. MEDLINE Abstract

17. Williams, M.A., Pinon, L.G.P., Liden, R. and Pinto, L.H. (1990) The pearl mutation accelerates the schedule of natural cell death in the early postnatal retina. Exp. Brain Res., 82, 393-400.

18. Honing, S., Sandoval, I.V. and von Figura, K. (1998) A di-leucine-based motif in the cytoplasmic tail of LIMP-II and tyrosinase mediates selective binding of AP-3. EMBO J., 17, 1304-1314. MEDLINE Abstract

19. Faundez, V., Horng, J.-T. and Kelly, R.B. (1998) A function for the AP3 coat complex in synaptic vesicle formation from endosomes. Cell, 93, 423-432. MEDLINE Abstract

20. Cowles, C.R., Odorizzi, G., Payne, G.S. and Emr, S.D. (1997) The AP-3 adaptor complex is essential for cargo-selective transport to the yeast vacuole. Cell, 91, 109-118. MEDLINE Abstract

21. Stepp, J.D., Huang, K. and Lemmon, S.K. (1997) The yeast adaptor protein complex, AP-3, is essential for the efficient delivery of alkaline phosphatase by the alternate pathway to the vacuole. J. Cell. Biol., 139, 1761-1774. MEDLINE Abstract

22. Ooi, C.E., Moreira, J.E., Dell'Angelica, E.C., Poy, G., Wassarman, D.A. and Bonifacino, J.S. (1997) Altered expression of a novel adaptin leads to defective pigment granule biogenesis in the Drosophila eye color mutant garnet. EMBO J., 16, 4508-4518. MEDLINE Abstract

23. Kantheti, P., Qiao, X., Diaz, M.E., Peden, A.P., Meyer, G.E., Carskadon, S.L., Kapfhamer, D., Sufalko, D., Robinson, M.S., Noebels, J.L. and Burmeister, M. (1998) Mutation of the AP-3 delta subunit in the mocha mouse links endosomal cargo transport to storage deficiency in platelets, melanosomes and neurotransmitter vesicles. Neuron, 21, 111-122. MEDLINE Abstract

24. Raymond, C.K., Robers, C.J., Moore, K.E., Howald, I. and Stevens, T.H. (1992) Biogenesis of the vacuole in Saccharomyces cerevisiae. Int. Rev. Cytol., 139, 59-120. MEDLINE Abstract

25. Stack, J.H., Horazdovsky, B. and Emr, S.D. (1995) Receptor-mediated protein sorting to the vacuole in yeast: roles for a protein kinase, a lipid kinase and GTP-binding proteins. Annu. Rev. Cell Dev. Biol., 11, 1-33.

26. Hazelwood, S., Shotelersuk, V., Wildenberg, S.C., Chen, D., Iwata, I., Kaiser-Kupfer, M.I., White, J.G., King, R.A. and Gahl, W.A. (1997) Evidence for locus heterogeneity in Puerto Ricans with Hermansky-Pudlak syndrome. Am. J. Hum. Genet., 61, 1088-1094. MEDLINE Abstract

27. Oh, J., Ho, L., Ala-Mello, S., Amato, D., Armstrong, L., Bellucci, S., Carakushansky, G., Ellis, J.P., Fong, C.-T., Green, J.S., Heon, E., Legius, E., Levin, A.V., Nieuwenhuis, H.K., Pinckers, A., Tamura, N., Whiteford, M.L., Yamasaki, H. and Spritz, R.A. (1998) Mutation analysis of patients with Hermansky-Pudlak syndrome: a frameshift hot spot in the HPS gene and apparent locus heterogeneity. Am. J. Hum. Genet., 62, 593-598. MEDLINE Abstract

28. Oh, J., Bailin, T., Fukai, K., Feng, G.H., Ho, L., Mao, J.-I., Frenk, E., Tamura, N. and Spritz, R.A. (1996) Positional cloning of a gene for Hermansky-Pudlak syndrome, a disorder of cytoplasmic organelles. Nature Genet., 14, 300-306. MEDLINE Abstract

29. Feng, G.H., Bailin, T., Oh, J. and Spritz, R.A. (1997) Mouse pale ear (ep) is homologous to human Hermansky-Pudlak syndrome and contains a rare `AT-AC' intron. Hum. Mol. Genet., 6, 793-797. MEDLINE Abstract

30. Gardner, J.M., Wildenberg, S.C., Keiper, N.M., Novak, E.K., Rusiniak, M.E., Swank, R.T., Puri, N., Finger, J.N., Hagiwara, N., Lehman, A.L., Gales, T.L., Bayer, M., King, R.A. and Brilliant, M.N. (1997) The mouse pale ear (ep) mutation is the homologue of human Hermansky-Pudlak syndrome. Proc. Natl Acad. Sci. USA, 94, 9238-9243. MEDLINE Abstract

31. Ausubel, F.M., Brent, R., Kingston, R.E., Moor, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (1997) Current Protocols in Molecular Biology. John Wiley & Sons, New York, NY, Vol. 4.9.

32. Kere, J., Nagaraja, R., Mumm, S., Ciccodiola, A., D'Urso, M. and Schlessinger, D. (1992) Mapping human chromosomes by walking with sequence-tagged sites from end fragments or yeast artificial chromosome inserts. Genomics, 14, 241-248. MEDLINE Abstract

33. Feinberg, A.P. and Vogelstein, B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem., 132, 6-13. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +1 716 845 3429; Fax: +1 716 845 8169; Email: rswank@mcbio.med.buffalo.edu
+These two authors contributed equally to this study

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 4 Feb 1999
Copyright©Oxford University Press, 1999.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Mol. Biol. CellHome page
C. G. Angers and A. J. Merz
HOPS Interacts with Apl5 at the Vacuole Membrane and Is Required for Consumption of AP-3 Transport Vesicles
Mol. Biol. Cell, November 1, 2009; 20(21): 4563 - 4574.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
K. Newell-Litwa, G. Salazar, Y. Smith, and V. Faundez
Roles of BLOC-1 and Adaptor Protein-3 Complexes in Cargo Sorting to Synaptic Vesicles
Mol. Biol. Cell, March 1, 2009; 20(5): 1441 - 1453.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
T. Baust, M. Anitei, C. Czupalla, I. Parshyna, L. Bourel, C. Thiele, E. Krause, and B. Hoflack
Protein Networks Supporting AP-3 Function in Targeting Lysosomal Membrane Proteins
Mol. Biol. Cell, May 1, 2008; 19(5): 1942 - 1951.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
C. U. Niemann, M. Abrink, G. Pejler, R. L. Fischer, E. I. Christensen, S. D. Knight, and N. Borregaard
Neutrophil elastase depends on serglycin proteoglycan for localization in granules
Blood, May 15, 2007; 109(10): 4478 - 4486.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
M. S. Horwitz, Z. Duan, B. Korkmaz, H.-H. Lee, M. E. Mealiffe, and S. J. Salipante
Neutrophil elastase in cyclic and severe congenital neutropenia
Blood, March 1, 2007; 109(5): 1817 - 1824.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
K. Newell-Litwa, E. Seong, M. Burmeister, and V. Faundez
Neuronal and non-neuronal functions of the AP-3 sorting machinery
J. Cell Sci., February 15, 2007; 120(4): 531 - 541.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
R. Bahadori, O. Rinner, H. B. Schonthaler, O. Biehlmaier, Y. V. Makhankov, P. Rao, P. Jagadeeswaran, and S. C. F. Neuhauss
The Zebrafish fade out Mutant: A Novel Genetic Model for Hermansky-Pudlak Syndrome.
Invest. Ophthalmol. Vis. Sci., October 1, 2006; 47(10): 4523 - 4531.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
G. Salazar, B. Craige, M. L. Styers, K. A. Newell-Litwa, M. M. Doucette, B. H. Wainer, J. M. Falcon-Perez, E. C. Dell'Angelica, A. A. Peden, E. Werner, et al.
BLOC-1 Complex Deficiency Alters the Targeting of Adaptor Protein Complex-3 Cargoes
Mol. Biol. Cell, September 1, 2006; 17(9): 4014 - 4026.
[Abstract] [Full Text] [PDF]

Home page
 J BiochemHome page
O. J. Holt, F. Gallo, and G. M. Griffiths
Regulating secretory lysosomes.
J. Biochem., July 1, 2006; 140(1): 7 - 12.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J. Jung, G. Bohn, A. Allroth, K. Boztug, G. Brandes, I. Sandrock, A. A. Schaffer, C. Rathinam, I. Kollner, C. Beger, et al.
Identification of a homozygous deletion in the AP3B1 gene causing Hermansky-Pudlak syndrome, type 2
Blood, July 1, 2006; 108(1): 362 - 369.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. P. Grabner, S. D. Price, A. Lysakowski, A. L. Cahill, and A. P. Fox
Regulation of large dense-core vesicle volume and neurotransmitter content mediated by adaptor protein 3
PNAS, June 27, 2006; 103(26): 10035 - 10040.
[Abstract] [Full Text] [PDF]

Home page
 J BiochemHome page
H. Ohno
Physiological Roles of Clathrin Adaptor AP Complexes: Lessons from Mutant Animals
J. Biochem., June 1, 2006; 139(6): 943 - 948.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. R. Young, M. T. Borchers, H. L. Allen, R. S. Gibbons, and F. X. McCormack
Lung-Restricted Macrophage Activation in the Pearl Mouse Model of Hermansky-Pudlak Syndrome
J. Immunol., April 1, 2006; 176(7): 4361 - 4368.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
T. Baust, C. Czupalla, E. Krause, L. Bourel-Bonnet, and B. Hoflack
Proteomic analysis of adaptor protein 1A coats selectively assembled on liposomes
PNAS, February 28, 2006; 103(9): 3159 - 3164.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
A. C. Theos, D. Tenza, J. A. Martina, I. Hurbain, A. A. Peden, E. V. Sviderskaya, A. Stewart, M. S. Robinson, D. C. Bennett, D. F. Cutler, et al.
Functions of Adaptor Protein (AP)-3 and AP-1 in Tyrosinase Sorting from Endosomes to Melanosomes
Mol. Biol. Cell, November 1, 2005; 16(11): 5356 - 5372.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
G. Salazar, B. Craige, B. H. Wainer, J. Guo, P. De Camilli, and V. Faundez
Phosphatidylinositol-4-Kinase Type II {alpha} Is a Component of Adaptor Protein-3-derived Vesicles
Mol. Biol. Cell, August 1, 2005; 16(8): 3692 - 3704.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Kyttala, K. Yliannala, P. Schu, A. Jalanko, and J. P. Luzio
AP-1 and AP-3 Facilitate Lysosomal Targeting of Batten Disease Protein CLN3 via Its Dileucine Motif
J. Biol. Chem., March 18, 2005; 280(11): 10277 - 10283.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
R. E. Boissy, B. Richmond, M. Huizing, A. Helip-Wooley, Y. Zhao, A. Koshoffer, and W. A. Gahl
Melanocyte-Specific Proteins Are Aberrantly Trafficked in Melanocytes of Hermansky-Pudlak Syndrome-Type 3
Am. J. Pathol., January 1, 2005; 166(1): 231 - 240.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
E. Seong, B. H. Wainer, E. D. Hughes, T. L. Saunders, M. Burmeister, and V. Faundez
Genetic Analysis of the Neuronal and Ubiquitous AP-3 Adaptor Complexes Reveals Divergent Functions in Brain
Mol. Biol. Cell, January 1, 2005; 16(1): 128 - 140.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
K. F. Benson, R. E. Person, F.-Q. Li, K. Williams, and M. Horwitz
Paradoxical homozygous expression from heterozygotes and heterozygous expression from homozygotes as a consequence of transcriptional infidelity through a polyadenine tract in the AP3B1 gene responsible for canine cyclic neutropenia
Nucleic Acids Res., December 1, 2004; 32(21): 6327 - 6333.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
M. L. Styers, G. Salazar, R. Love, A. A. Peden, A. P. Kowalczyk, and V. Faundez
The Endo-Lysosomal Sorting Machinery Interacts with the Intermediate Filament Cytoskeleton
Mol. Biol. Cell, December 1, 2004; 15(12): 5369 - 5382.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
B. Gwynn, J. A. Martina, J. S. Bonifacino, E. V. Sviderskaya, M. L. Lamoreux, D. C. Bennett, K. Moriyama, M. Huizing, A. Helip-Wooley, W. A. Gahl, et al.
Reduced pigmentation (rp), a mouse model of Hermansky-Pudlak syndrome, encodes a novel component of the BLOC-1 complex
Blood, November 15, 2004; 104(10): 3181 - 3189.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
F. Nakatsu, M. Okada, F. Mori, N. Kumazawa, H. Iwasa, G. Zhu, Y. Kasagi, H. Kamiya, A. Harada, K. Nishimura, et al.
Defective function of GABA-containing synaptic vesicles in mice lacking the AP-3B clathrin adaptor
J. Cell Biol., October 25, 2004; 167(2): 293 - 302.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. Gautam, S. Chintala, W. Li, Q. Zhang, J. Tan, E. K. Novak, S. M. Di Pietro, E. C. Dell'Angelica, and R. T. Swank
The Hermansky-Pudlak Syndrome 3 (Cocoa) Protein Is a Component of the Biogenesis of Lysosome-related Organelles Complex-2 (BLOC-2)
J. Biol. Chem., March 26, 2004; 279(13): 12935 - 12942.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
Z. Duan, F.-Q. Li, J. Wechsler, K. Meade-White, K. Williams, K. F. Benson, and M. Horwitz
A Novel Notch Protein, N2N, Targeted by Neutrophil Elastase and Implicated in Hereditary Neutropenia
Mol. Cell. Biol., January 1, 2004; 24(1): 58 - 70.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Cernadas, M. Sugita, N. van der Wel, X. Cao, J. E. Gumperz, S. Maltsev, G. S. Besra, S. M. Behar, P. J. Peters, and M. B. Brenner
Lysosomal Localization of Murine CD1d Mediated by AP-3 Is Necessary for NK T Cell Development
J. Immunol., October 15, 2003; 171(8): 4149 - 4155.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. A. Lyerla, M. E. Rusiniak, M. Borchers, G. Jahreis, J. Tan, P. Ohtake, E. K. Novak, and R. T. Swank
Aberrant lung structure, composition, and function in a murine model of Hermansky-Pudlak syndrome
Am J Physiol Lung Cell Mol Physiol, September 1, 2003; 285(3): L643 - L653.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. A. Martina, K. Moriyama, and J. S. Bonifacino
BLOC-3, a Protein Complex Containing the Hermansky-Pudlak Syndrome Gene Products HPS1 and HPS4
J. Biol. Chem., August 1, 2003; 278(31): 29376 - 29384.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. L. Klebig, M. D. Wall, M. D. Potter, E. L. Rowe, D. A. Carpenter, and E. M. Rinchik
Mutations in the clathrin-assembly gene Picalm are responsible for the hematopoietic and iron metabolism abnormalities in fit1 mice
PNAS, July 8, 2003; 100(14): 8360 - 8365.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. L. Ciciotte, B. Gwynn, K. Moriyama, M. Huizing, W. A. Gahl, J. S. Bonifacino, and L. L. Peters
Cappuccino, a mouse model of Hermansky-Pudlak syndrome, encodes a novel protein that is part of the pallidin-muted complex (BLOC-1)
Blood, June 1, 2003; 101(11): 4402 - 4407.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P.-W. Chiang, N. Oiso, R. Gautam, T. Suzuki, R. T. Swank, and R. A. Spritz
The Hermansky-Pudlak Syndrome 1 (HPS1) and HPS4 Proteins Are Components of Two Complexes, BLOC-3 and BLOC-4, Involved in the Biogenesis of Lysosome-related Organelles
J. Biol. Chem., May 23, 2003; 278(22): 20332 - 20337.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
K. Ono, S. O. Kim, and J. Han
Susceptibility of Lysosomes to Rupture Is a Determinant for Plasma Membrane Disruption in Tumor Necrosis Factor Alpha-Induced Cell Death
Mol. Cell. Biol., January 15, 2003; 23(2): 665 - 676.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. M. Falcon-Perez, M. Starcevic, R. Gautam, and E. C. Dell'Angelica
BLOC-1, a Novel Complex Containing the Pallidin and Muted Proteins Involved in the Biogenesis of Melanosomes and Platelet-dense Granules
J. Biol. Chem., July 26, 2002; 277(31): 28191 - 28199.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
N. Nishimura, H. Plutner, K. Hahn, and W. E. Balch
The delta subunit of AP-3 is required for efficient transport of VSV-G from the trans-Golgi network to the cell surface
PNAS, May 14, 2002; 99(10): 6755 - 6760.
[Abstract] [Full Text] [PDF]

Home page
 Arch. Dis. Child.Home page
C Harrison, K Khair, B Baxter, I Russell-Eggitt, I Hann, and R Liesner
Hermansky-Pudlak syndrome: infrequent bleeding and first report of Turkish and Pakistani kindreds
Arch. Dis. Child., April 1, 2002; 86(4): 297 - 301.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
Q. Zhang, W. Li, E. K. Novak, A. Karim, V. S. Mishra, S. F. Kingsmore, B. A. Roe, T. Suzuki, and R. T. Swank
The gene for the muted (mu) mouse, a model for Hermansky-Pudlak syndrome, defines a novel protein which regulates vesicle trafficking
Hum. Mol. Genet., March 1, 2002; 11(6): 697 - 706.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
L. Feng, E. K. Novak, L. M. Hartnell, J. S. Bonifacino, L. M. Collinson, and R. T. Swank
The Hermansky-Pudlak syndrome 1 (HPS1) and HPS2 genes independently contribute to the production and function of platelet dense granules, melanosomes, and lysosomes
Blood, March 1, 2002; 99(5): 1651 - 1658.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
H. Sprong, S. Degroote, T. Claessens, J. van Drunen, V. Oorschot, B. H.C. Westerink, Y. Hirabayashi, J. Klumperman, P. van der Sluijs, and G. van Meer
Glycosphingolipids are required for sorting melanosomal proteins in the Golgi complex
J. Cell Biol., October 29, 2001; 155(3): 369 - 380.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
J. Blumstein, V. Faundez, F. Nakatsu, T. Saito, H. Ohno, and R. B. Kelly
The Neuronal Form of Adaptor Protein-3 Is Required for Synaptic Vesicle Formation from Endosomes
J. Neurosci., October 15, 2001; 21(20): 8034 - 8042.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
M. Boehm and J. S. Bonifacino
Adaptins. The Final Recount
Mol. Biol. Cell, October 1, 2001; 12(10): 2907 - 2920.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
M. Huizing, R. Sarangarajan, E. Strovel, Y. Zhao, W. A. Gahl, and R. E. Boissy
AP-3 Mediates Tyrosinase but Not TRP-1 Trafficking in Human Melanocytes
Mol. Biol. Cell, July 1, 2001; 12(7): 2075 - 2085.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
J. M. H. Kijas, M. Moller, G. Plastow, and L. Andersson
A Frameshift Mutation in MC1R and a High Frequency of Somatic Reversions Cause Black Spotting in Pigs
Genetics, June 1, 2001; 158(2): 779 - 785.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
R. Le Borgne, N. Planque, P. Martin, F. Dewitte, S. Saule, and B. Hoflack
The AP-3-dependent targeting of the melanosomal glycoprotein QNR-71 requires a di-leucine-based sorting signal
J. Cell Sci., January 8, 2001; 114(15): 2831 - 2841.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
B. Gwynn, S. L. Ciciotte, S. J. Hunter, L. L. Washburn, R. S. Smith, S. G. Andersen, R. T. Swank, E. C. Dell'Angelica, J. S. Bonifacino, E. M. Eicher, et al.
Defects in the cappuccino (cno) gene on mouse chromosome 5 and human 4p cause Hermansky-Pudlak syndrome by an AP-3-independent mechanism
Blood, December 15, 2000; 96(13): 4227 - 4235.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
M. T. Drake, Y. Zhu, and S. Kornfeld
The Assembly of AP-3 Adaptor Complex-containing Clathrin-coated Vesicles on Synthetic Liposomes
Mol. Biol. Cell, November 1, 2000; 11(11): 3723 - 3736.
[Abstract] [Full Text]

Home page
 NEJMHome page
V. M. Olkkonen and E. Ikonen
Genetic Defects of Intracellular-Membrane Transport
N. Engl. J. Med., October 12, 2000; 343(15): 1095 - 1104.
[Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
V. V. Faundez and R. B. Kelly
The AP-3 Complex Required for Endosomal Synaptic Vesicle Biogenesis is Associated with a Casein Kinase Ialpha -Like Isoform
Mol. Biol. Cell, August 1, 2000; 11(8): 2591 - 2604.
[Abstract] [Full Text]

Home page
 Mol. Biol. CellHome page
J. Shim, P. W. Sternberg, and J. Lee
Distinct and Redundant Functions of {micro}1 Medium Chains of the AP-1 Clathrin-Associated Protein Complex in the Nematode Caenorhabditis elegans
Mol. Biol. Cell, August 1, 2000; 11(8): 2743 - 2756.
[Abstract] [Full Text]

Home page
 FASEB J.Home page
E. C. DELL’ANGELICA, C. MULLINS, S. CAPLAN, and J. S. BONIFACINO
Lysosome-related organelles
FASEB J, July 1, 2000; 14(10): 1265 - 1278.
[Abstract] [Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
R. Halaban, S. Svedine, E. Cheng, Y. Smicun, R. Aron, and D. N. Hebert
Endoplasmic reticulum retention is a common defect associated with tyrosinase-negative albinism
PNAS, May 23, 2000; 97(11): 5889 - 5894.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
D. Kretzschmar, B. Poeck, H. Roth, R. Ernst, A. Keller, M. Porsch, R. Strauss, and G. O. Pflugfelder
Defective Pigment Granule Biogenesis and Aberrant Behavior Caused by Mutations in the Drosophila AP-3{beta} Adaptin Gene ruby
Genetics, May 1, 2000; 155(1): 213 - 223.
[Abstract] [Full Text]

Home page
 Hum Mol GenetHome page
J. Oh, Z.-X. Liu, G. H. Feng, G. Raposo, and R. A. Spritz
The Hermansky-Pudlak syndrome (HPS) protein is part of a high molecular weight complex involved in biogenesis of early melanosomes
Hum. Mol. Genet., February 12, 2000; 9(3): 375 - 385.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. C. Dell'Angelica, R. C. Aguilar, N. Wolins, S. Hazelwood, W. A. Gahl, and J. S. Bonifacino
Molecular Characterization of the Protein Encoded by the Hermansky-Pudlak Syndrome Type 1 Gene
J. Biol. Chem., January 14, 2000; 275(2): 1300 - 1306.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
W Yang, C Li, D. Ward, J Kaplan, and S. Mansour
Defective organellar membrane protein trafficking in Ap3b1-deficient cells
J. Cell Sci., January 11, 2000; 113(22): 4077 - 4086.
[Abstract] [PDF]

Home page
 J. Cell Sci.Home page
W. Rohn, Y Rouille, S Waguri, and B Hoflack
Bi-directional trafficking between the trans-Golgi network and the endosomal/lysosomal system
J. Cell Sci., January 6, 2000; 113(12): 2093 - 2101.
[Abstract] [PDF]

Home page
 ChestHome page
M. Brantly, N. A. Avila, V. Shotelersuk, C. Lucero, M. Huizing, and W. A. Gahl
Pulmonary Function and High-Resolution CT Findings in Patients With an Inherited Form of Pulmonary Fibrosis, Hermansky-Pudlak Syndrome, Due to Mutations in HPS-1*
Chest, January 1, 2000; 117(1): 129 - 136.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
J. C. Stinchcombe and G. M. Griffiths
Regulated Secretion from Hemopoietic Cells
J. Cell Biol., October 4, 1999; 147(1): 1 - 5.
[Full Text] [PDF]

Home page
 Arch DermatolHome page
J. Toro, M. Turner, and W. A. Gahl
Dermatologic Manifestations of Hermansky-Pudlak Syndrome in Patients With and Without a 16-Base Pair Duplication in the HPS1 Gene
Arch Dermatol, July 1, 1999; 135(7): 774 - 780.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
L. Zhen, S. Jiang, L. Feng, N. A. Bright, A. A. Peden, A. B. Seymour, E. K. Novak, R. Elliott, M. B. Gorin, M. S. Robinson, et al.
Abnormal Expression and Subcellular Distribution of Subunit Proteins of the AP-3 Adaptor Complex Lead to Platelet Storage Pool Deficiency in the Pearl Mouse
Blood, July 1, 1999; 94(1): 146 - 155.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Ujvari, R. Aron, T. Eisenhaure, E. Cheng, H. A. Parag, Y. Smicun, R. Halaban, and D. N. Hebert
Translation Rate of Human Tyrosinase Determines Its N-Linked Glycosylation Level
J. Biol. Chem., February 16, 2001; 276(8): 5924 - 5931.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. C. Aguilar, M. Boehm, I. Gorshkova, R. J. Crouch, K. Tomita, T. Saito, H. Ohno, and J. S. Bonifacino
Signal-binding Specificity of the {micro}4 Subunit of the Adaptor Protein Complex AP-4
J. Biol. Chem., April 13, 2001; 276(16): 13145 - 13152.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. M. Wilson, R. Yip, D. A. Swing, T. N. O'Sullivan, Y. Zhang, E. K. Novak, R. T. Swank, L. B. Russell, N. G. Copeland, and N. A. Jenkins
A mutation in Rab27a causes the vesicle transport defects observed in ashen mice
PNAS, July 5, 2000; 97(14): 7933 - 7938.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
A. A. Peden, R. E. Rudge, W. W.Y. Lui, and M. S. Robinson
Assembly and function of AP-3 complexes in cells expressing mutant subunits
J. Cell Biol., January 21, 2002; 156(2): 327 - 336.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (146)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Feng, L.
Right arrow Articles by Swank, R. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Feng, L.
Right arrow Articles by Swank, R. T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?