Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (67)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Serratosa, J. M.
Right arrow Articles by de Cordoba, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Serratosa, J. M.
Right arrow Articles by de Cordoba, S. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 345-352  


A novel protein tyrosine phosphatase gene is mutated in progressive myoclonus epilepsy of the Lafora type (EPM2)
Introduction
Results And Discussion
Materials And Methods
   Patients
   Library screening and sequencing
   RNA isolation and RT-PCR analysis
   Mutation analysis
Acknowledgements
References


A novel protein tyrosine phosphatase gene is mutated in progressive myoclonus epilepsy of the Lafora type (EPM2)

A novel protein tyrosine phosphatase gene is mutated in progressive myoclonus epilepsy of the Lafora type (EPM2)

José M. Serratosa1,*, Pilar Gómez-Garre1, Ma Esther Gallardo2,3, Berta Anta1, Daniel Beltrán-Valero de Bernabé2,3, Dick Lindhout4, Paul B. Augustijn5, Carlo A. Tassinari6, Roberto Michelucci6, Alain Malafosse7, Meral Topcu8, Djamel Grid9, Charlotte Dravet10, Samuel F. Berkovic11 and Santiago Rodríguez de Córdoba2,3

1Laboratorio y Servicio de Neurología and 2Unidad de Patología Molecular, Fundación Jiménez Díaz, Avenida Reyes Católicos 2, 28040 Madrid, Spain, 3Departamento de Inmunología, Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas, Velázquez 144, 28006 Madrid, Spain, 4MGC Department of Clinical Genetics, Erasmus Universiteit Rotterdam, Rotterdam, The Netherlands, 5Instituut voor Epilepsiebestrijding ‘Meer en Bosch’-‘De Cruquiushoeve’, Heemstede, The Netherlands, 6Divisione di Neurologia, Ospedale Bellaria, Bologna, Italy, 7Division of Neuropsychiatry, Hospital Belle-Idee, University of Geneva Medical School, Geneve, Switzerland, 8Department of Child Neurology, Hacettepe Children’s Hospital, Ankara, Turkey, 9Généthon, Evry, France, 10Centre Saint Paul, Marseille, France and 11Department of Medicine (Neurology), Austin and Repatriation Medical Center, Melbourne, Australia

Received September 29, 1998; Revised and Accepted November 16, 1998

DDBJ/EMBL/GenBank accession nos AJ130763, AJ130764

Progressive myoclonus epilepsy of the Lafora type or Lafora disease (EPM2; McKusick no. 254780) is an autosomal recessive disorder characterized by epilepsy, myoclonus, progressive neurological deterioration and glycogen-like intracellular inclusion bodies (Lafora bodies). A gene for EPM2 previously has been mapped to chromosome 6q23-q25 using linkage analysis and homozygosity mapping. Here we report the positional cloning of the 6q EPM2 gene. A microdeletion within the EPM2 critical region, present inhomozygosis in an affected individual, was found to disrupt a novel gene encoding a putative protein tyrosine phosphatase (PTPase). The gene, denoted EPM2, presents alternative splicing in the 5[prime] and 3[prime] end regions. Mutational analysis revealed that EPM2 patients are homozygous for loss-of-function mutations in EPM2. These findings suggest that Lafora disease results from the mutational inactivation of a PTPase activity that may be important in the control of glycogen metabolism.

INTRODUCTION

The epilepsies constitute one of the most common neurological disorders, affecting 1-3% of the population (1,2). Among the epilepsies, the progressive myoclonus epilepsies (PMEs) constitute a rare, heterogeneous group characterized by the presence of myoclonus, seizures and progressive neurological deterioration (3). PME with polyglucosan intracellular inclusion bodies (EPM2) was first described in 1911 by Gonzalo R. Lafora (4,5). He originally called the inclusion bodies ‘intracellular amyloid bodies’ when he observed them in the brain and spinal cord of an adolescent patient who presented a progressive and fatal myoclonic epilepsy. In 1955, Harriman and Millar showed that the inclusions were not limited to the central nervous system and described similar intracellular inclusions in the heart and liver of one patient affected with PME (6). Also in 1955, Lafora suggested that the disease he had described almost half a century before could possibly be a generalized storage disorder and that it might be related to the glycogenoses (7).

EPM2 is inherited as an autosomal recessive trait. Linkage analysis and homozygosity mapping have localized a gene for EPM2 to a 2.7 cM region in chromosome 6q23-25 flanked by D6S1003 and D6S311 (8,9). Five microsatellite markers (D6S1010, D6S1049, D6S1703, D6S1042 and D6S978) were found to be included within the critical region (9). However, there is evidence supporting genetic heterogeneity with at least a second locus responsible for a minority of EPM2 families (10).

RESULTS AND DISCUSSION

We have identified a patient (FD-3), born to a consanguineous marriage, with EPM2 and complete loss of the D6S1703 microsatellite marker. Analysis of D6S1703 alleles in the members of family FD is consistent with the presence of a null allele segregating with the disease (Fig. 1). A vectorette-PCR strategy (11,12) was used to amplify the genomic sequences flanking D6S1703 from normal human genomic DNA. We obtained PCR fragments that overlap and extend both ends of D6S1703. The PCR fragments flanking D6S1703 are also lost in the genomic DNA of FD-3, excluding the possibility that the loss of D6S1703 in the patient was a consequence of primer mismatch due to a point mutation. These data indicate that FD-3 is homozygous for a microdeletion in the EPM2 critical region and suggest that the phenotype may result from the disruption of a gene adjacent to D6S1703.


Figure 1. Homozygous deletion within the EPM2 critical region. Relevant portions of gels showing the typing of the non-polymorphic STS markers stsg31268 and WI-13634 (ethidium bromide-stained agarose gels) and the microsatellite marker D6S1703 (polyacrylamide sequencing gel) in family FD. The affected individual is identified in the pedigree with a solid symbol. Segregation of the D6S1703 marker in this family indicates that both parents are heterozygous for a D6S1703 null allele.

The PCR fragments flanking D6S1703 were used as probes to screen cosmid and phage P1-derived artificial chromosome (PAC) human genomic libraries. Several overlapping clones were identified and characterized by restriction endonuclease digestion, Southern blot hybridization, PCR and sequence analyses. These clones organize a contig that encompasses the deletion in patient FD-3 (Fig. 2A). To identify the deletion breakpoints, we designed several amplimers along the contig and tested them by PCR in DNA of the patient presenting the homozygous deletion. During the course of these experiments, the Sanger Centre (Cambridgeshire, UK) released the complete nucleotide sequence of a 150 kb clone (466P17) including D6S1703 and encompassing the deletion. These sequence data facilitated the accurate localization of the breakpoints and provided us with the complete sequence of the 60 kb DNA fragment that is lost in FD-3.


Figure 2. Genomic organization and mRNA structure of the EPM2 positional candidate gene. (A) Diagram of the genomic structure of the EPM2 gene. The thick line represents the genomic DNA, in which the position of the deletion characterized in family FD is illustrated with a thin line. The exons of the EPM2 positional candidate gene are indicated with vertical bars. Exons detected in RT-PCR experiments (B) are labeled 1, 2, 3 and 4. Exons a, 2a, 2b, b, c, d, 3a, 4a and 4b were characterized in cDNA clones. The position of the human PAC and cosmid genomic clones generated in the cloning of the DNA encompassing the deletion are indicated below the map. LAF-LD5 and LAF-LD6 are PCR fragments generated by LD-PCR. (B) Schematic representation of the exon organization of five overlapping EST clones and four RT-PCR fragments. [lambda]DR2-A is a PCR fragment that corresponds to the 5[prime] end of a cDNA clone in a human fetal liver cDNA library (HL5003A; Clontech, Palo Alto, CA). For each of the clones, the exons are indicated with boxes numbered with the same code as in the genetic map. (C) Composite cDNA of the EPM2 positional candidate gene based on RT-PCR analysis of skeletal muscle and liver mRNA. This composite sequence is probably incomplete at its 5[prime] end and, thus, the translation start ATG codon has not been determined yet. This composite sequence and the deduced amino acid sequences were deposited in GenBank under accession nos AJ130763 and AJ130764.

A search of the expressed sequence tag (EST) database with this 60 kb nucleotide sequence identified a human testis 986 bp cDNA sequence (zu70h03). The nucleotide sequence of zu70h03 does not contain any open reading frame (ORF) of significant length. Alignment of the nucleotide sequences of the 150 kb 466P17 clone and zu70h03 revealed that the first 595 nucleotides of zu70h03 are arranged in six exons (a, 2a, 2b, b, c and d) located within the 60 kb DNA fragment that is deleted in FD-3. The last 391 nucleotides of zu70h03, encoded by a separate exon named 3a, were mapped by long distance-PCR (LD-PCR) to PAC3, outside the deleted region (Fig. 2A and B).

In an attempt to isolate a full-length cDNA, we screened human brain (hippocampus, fetal brain and adult brain) and testis cDNA libraries with probes derived from zu70h03. We also searched the EST databases with the nucleotide sequence of zu70h03. These analyses resulted in the identification of additional cDNA clones. Four of them (DKFZp596H2425Q2, yx64g05, aa52d08 and yg02h03) were fully sequenced in both strands. Exon organization of these clones was analyzed by sequence comparison between them and with the sequence of clone 466P17 (Fig. 2A and B). Exon entities were confirmed by PCR using normal human genomic DNA. Careful examination of the exon organization of the DKFZp596H2425Q2, yx64g05, aa52d08 and yg02h03 clones indicated that they are transcripts (also incomplete) that result from the alternative splicing of the same gene. Additional nucleotide sequences upstream of the most 5[prime] end of the cDNA clones described above were obtained by PCR amplification from a human fetal liver cDNA library ([lambda]DR2-A; Fig. 2B).

RT-PCR amplification using human liver and skeletal muscle mRNA was used to determine the exon composition of the EPM2 transcript in these tissues (Fig. 2B). Only primers derived from exons 1, 2, 3 and 4 resulted in amplification of EPM2 PCR products, suggesting that the EPM2 exons a, 2a, 2b, b, c, d and 3a are not present in the majority of the EPM2 transcripts in these tissues. The information obtained from these RT-PCR fragments was used to assemble a composite cDNA describing the organization of the EPM2 transcript (Fig. 2C).

By northern blot hybridization using the yx64g05 EST as a probe, we detected transcription of the EPM2 candidate gene as a single mRNA band of ~3 kb in length in different adult human tissues (Fig. 3).


Figure 3. Expression of the EPM2 gene. A northern blot containing poly(A)+ mRNA from various adult human tissues was hybridized with probe yx64g05 (top) and GAPDH (bottom). An mRNA band of ~3 kb was detected in most of the tissues. Sp, spleen; Th, thymus; Pr, prostate; Te, testis; Ov, ovary; SI, small intestine; Co, colon; PBL, peripheral blood lymphocytes; He, heart; Br, brain; Pl, placenta; Lu, lung; Li, liver; SM, skeletal muscle; Ki, kidney; Pa, pancreas.

The composite sequence of the EPM2 positional candidate gene depicted in Figure 2C contains two alternative ORFs of 250 amino acids (exons 1, 2, 3 and 4) and 236 amino acids (exons 1, 2, 3, 4a and 4b) (Fig. 4A). These ORFs seem to be incomplete at their N-terminal ends, suggesting that the translation start ATG codon is located within a yet to be identified exon upstream of exon 1. The EPM2 ORFs were compared by BLAST analysis with sequences deposited in pertinent databases. This analysis demonstrated that the amino acid sequence encoded by exon 4a is 25-37% identical (in a 64 amino acid ungapped alignment) to the amino acid sequence of protein tyrosine phosphatases (PTPases) from different species. All PTPases have a conserved catalytic domain with a unique motif (I/V)HCxAGxxR(S/T)G(x = any amino acid) in which the cysteine residue is critical for enzyme function (13). This motif is conserved in the putative protein encoded by the candidate gene for EMP2 (Fig. 4). We postulate that the positional candidate gene for EPM2 encodes a PTPase. We denoted this protein as LAFPTPase (from LAFora PTPase). No other similarities were found between sequences in the databases and the LAFPTPase amino acid sequence.


Figure 4. cDNA sequence and derived animo acid sequence of EPM2. (A) Nucleotide sequence of the cDNA corresponding to EPM2 exons 1, 2, 3 and 4. Exon junctions are indicated with small vertical arrows. The conceptual translation of the EPM2 ORF is shown below the cDNA sequence in one-letter code. The sequences containing the translation start ATG codon have not been found yet. (B) Alignment of the deduced amino acid sequence of the putative catalytic site of LAFPTPase and the catalytic site of other PTPases. Identities are shadowed. The consensus motif shared by all PTPases is shown. The critical cysteine residue is indicated with an arrow below the alignment.

We have shown above that the EPM2 patient in family FD presents a 60 kb deletion in homozygosis (EPM2-60kbdel) that disrupts the EPM2 gene. Characterization of the genomic organization of the EPM2 transcript (Fig. 2 and C) illustrates that transcription of the EPM2 gene in patient FD-3 would result in a EPM2 transcript that lacks exon 2. Deletion of exon 2 causes an ORF frameshift that generates a stop codon within exon 3. EPM2-60kbdel is, therefore, a loss-of-function mutation.

To determine whether the EPM2 gene is also mutated in other EPM2 families, we performed a mutational analysis by single strand conformation polymorphism (SSCP). One family (S114) with band-shifts in exon 2, two families (S2 and S12) with band-shifts in exon 3 and five families (F38, S109, F119, F95 and F102) with band-shifts in exon 4 were identified. None of these band-shifts in EPM2 exons 2, 3 and 4 were detected by SSCP in 60 healthy controls. Mendelian inheritance of the mutations was confirmed in all the EPM2 families.

Sequence analysis of the fragments presenting band-shifts revealed that in family S114, both parents were heterozygous at the EPM2 exon 2 (Fig. 5). They did both present a normal allele, with a sequence identical to the sequence of the EPM2 cDNA clones, and a second allele that we denoted EPM2Y31fs. This mutated allele is characterized by an insertion of an A at nucleotide position 95, changing a tyrosine residue at position 31 (TAC) to a stop codon (TAA). The Y31fs mutation truncates LAFPTPase at the N-terminal region of the amino acid sequence and, therefore, it is considered a loss-of-function mutation. The affected individual in family S114 is homozygous for the EPM2Y31fs allele (Fig. 5). This segregation pattern is in full agreement with the autosomal recessive mode of transmission of EPM2, strongly suggesting that Y31fs is the causative mutation.


Figure 5. Segregation of the EPM2Y31fs loss-of-function mutation in family S114. The affected individual is identified in the pedigree by a solid symbol. Relevant portions of a sequencing chromatogram are shown to illustrate the segregation of the EPM2Y31fs allele. The insertion of an A, present in homozygosis in the affected individual, is indicated with an arrow.

Another frameshift mutation (H172fs) was also found in heterozygosis in the affected individuals of a second EPM2 pedigree (F119). In addition, we found one nonsense (R160stop) and four missense (R90H, T113I, G198S and Y213N) mutations in several other EPM2 patients (Table 1).

Our EPM2 mutational analysis is not complete, as it has been focused only on EPM2 exons 2, 3 and 4a. Notably, we have identified 13 EPM2 chromosomes carrying a total of eight different EPM2 mutations in 20 EPM2 pedigrees, whereas we found none in a scan of 120 normal chromosomes. We, therefore, conclude that the gene described here is the gene responsible for EPM2 and postulate that the four missense mutations that we have described here are non-functional alleles, either because they are not properly expressed or because the encoded polypeptide lacks enzymatic activity.

Autosomal recessive diseases commonly are caused by enzymatic defects which may result in the accumulation of storage material within the cells. In EPM2, an abnormal glucose polymer accumulates in diverse body tissues including the central and peripheral nervous system. Biochemical studies of isolated Lafora bodies showed that they are composed of 6% protein and 80-93% glucose. The fact that Lafora bodies can be hydrolyzed enzymatically by [alpha]-amylase indicated that they are glucose polymers (14,15). The effects of digestions with [alpha]-amylase, [beta]-amylase and phosphorylase suggested that Lafora bodies contain glucose polymers linked with [alpha](1->4) and [alpha](1->6) bonds. Infrared spectroscopy studies have revealed that the deposits are not mucopolysaccharides, glycoproteins or gangliosides (14,15). Interestingly, the storage material in EPM2 is histochemically, ultrastructurally and biochemically similar to the polysaccharide that accumulates in branching enzyme deficiency (type IV glycogenosis) (16). However, branching enzyme activity was normal in brain and muscle from one patient (17). In type IV glycogenosis, an abnormal glycogen is produced as a consequence of branching enzyme deficiency. Abnormal and normal glycogen co-exist in diverse tissues including nervous tissue. As in EPM2, type IV glycogenosis patients are normal at birth. However, in type IV glycogenosis, the onset is much earlier than in EPM2. Gastrointestinal and neuromuscular symptoms predominate, with liver cirrhosis and muscular atrophy. Death usually occurs before the third year of life. The poor solubility of the abnormal glycogen appears to be the origin of the cellular injury. Similarities among the deposits of type IV glycogenosis and Lafora bodies suggest a common structure and, possibly, common etiological factors (16).

We identify here a novel gene encoding a putative PTPase, denoted LAFPTPase, that is mutated in patients with EPM2. PTPases are a heterogeneous group of enzymes involved in the regulation of diverse metabolic and development pathways. Although the mechanisms involved in the production of the Lafora bodies appear intriguing at this point, it is tempting to speculate that the putative metabolic pathway altered in EPM2 is regulated by LAFPTPase. One way by which loss of LAFPTPase function may result in the production of Lafora bodies is by inducing an imbalance between glycogen synthase and branching enzyme activities. This imbalance could result in the production of an abnormal glycogen.

Table 1. Summary of EPM2 mutations in EPM2 patients
Family Exon Namea Mutation Nucleotide changeb Amino acid change predicted consequence
FD 2 EPM2-60kbdel Deletion Deletion exon 2 Truncation at exon 3
S114 2 Y31fs Frameshift c94insA Truncation after Tyr31
S2 3 R90H Missense c271G->A Arg90His
S12 3 T113I Missense c340C->T Thr113Ile
F38/S109 4a R160stop Nonsense c480C->T Arg160stop
F119 4a H172fs Frameshift c518T->CATGCA Truncation after H172
F38/S109/F95 4a G198S Missense c594G->A Gly198Ser
F102 4a Y213N Missense c639T->A Tyr213Asn
aNucleotide and amino acid positions were assigned based on the sequences depicted in Figure 4.

In spite of the homogeneity of the EPM2 phenotype, with the presence of Lafora bodies in all affected individuals, there are ~20% of the EPM2 families in which the phenotype does not segregate with the 6q23-q25 critical region (10). The simplest explanation for this genetic heterogeneity is that other gene(s) in the same metabolic pathway is(are) altered in the EPM2 families not linked to 6q23-q25. Confirmation that the EPM2 gene in 6q23-q25 encodes a protein with PTPase activity and the identification of the corresponding substrates for the LAFPTPase should provide candidate genes for EPM2 in the families not linked to 6q23-q25.

In conclusion, the identification of the EPM2 gene and the characterization of the corresponding enzymatic defect will increase our knowledge of the metabolic pathways involved in the accumulation of Lafora bodies and the pathogenesis of Lafora disease. It should also lead to the development of novel modalities of diagnosis and therapy for this fatal form of PME.

MATERIALS AND METHODS

Patients

The clinical diagnosis of EPM2 was based on the presentation of epilepsy, myoclonus, rapidly progressive neurological deterioration and a slow background with polyspike wave complexes in the electroencephalogram (18). In addition, we required a biopsy of skin, muscle, liver or brain showing the characteristic periodic acid-Schiff-positive Lafora bodies (19). All families included in this study were genotyped with the chromosome 6q23-q25 microsatellite markers contained in the critical region, which showed segregation with the EPM2 phenotype.

Library screening and sequencing

Two human genomic libraries (RPCI1,3-5 human PAC library and human chromosome 6 specific cosmid library, both supplied by the RZPD, German Human Genome Resource Center) and human cDNA libraries (human hippocampus library 569, human adult brain library 588 and human testis library 596, supplied by the RZPD) were screened with appropriate labeled probes. Genomic and cDNA clones were isolated by standard techniques and, if needed, subcloned into pBluescript SK+ (Stratagene, La Jolla, CA). Sequencing of the cloned fragments of the EPM2 gene was performed automatically in an ABI-377 sequencer using a dye terminator cycle sequencing kit (Perkin-Elmer). Direct sequencing of PCR products was always performed after purification of the fragments using Wizard PCR Preps DNA Purification System (Promega).

Table 2. Primers for amplification, sequencing and mutation detection
Exon Primers for SSCP Product size (bp) Primers for sequencing Product size (bp)
Exon 2 F: GTATCAGCTGCTTGAGGATA 291 F: GTATCAGCTGCTTGAGGATA 291
R: CTTGTCCTACTTCTATGCCTA R: CTTGTCCTACTTCTATGCCTA
Exon 3 F: ACCAAATATCTGGCTGGGTA 230 F: CTACATGTTTTATGCAGCTCC 431
R: TGCTCATATCTGGTGTTGGC R: ATTTATTCCATTTCTACCATTCAT
Exon 4a F: GCCGAGTACAGATGCTGC 202 F: GAGAGAGCCTCTGGCCTC 483
R: TCGTCAATGTAGACAGCCG R: CAGAAGAACGAACCTTCCCA
F, forward; R, reverse.

RNA isolation and RT-PCR analysis

Total RNA was isolated by the guanidinium thiocyanate method (20). Poly(A)+ RNA was prepared using oligo(dT)-magnetic beads as described by the manufacturer (MPG mRNA Purification kit; CPG, NJ). Reverse transcription was performed on 1 µg of total RNA prepared from appropriate tissues using oligo(dT) as a primer and MMLV reverse transcriptase (Amersham, Cleveland, OH). One-tenth of the reaction was amplified with the corresponding primer pairs. A minus-RT control for each RNA was included in all experiments. The generated fragments were electrophoresed on 1.3% agarose gels, transferred onto nylon membranes and hybridized with the appropriate probe to confirm their identity.

Mutation analysis

SSCP analysis was performed by PCR, using total genomic DNA, as described elsewhere (21). Briefly, for SSCP analysis, amplification was performed in a total volume of 10 µl containing 40 ng of genomic DNA; 12.5 pmol of each primer; 1 U of Taq polymerase (Perkin-Elmer Cetus); 250 µM dATP, dGTP and dTTP; 25 µM dCTP; 1 µCi of [[alpha]-32P]dCTP at 300 Ci/mmol; 1.5 mM MgCl2; 50 mM KCl; and 10 mM Tris-HCl (pH 8.3). PCR conditions were one cycle at 94°C for 2 min, followed by 30 cycles of 94°C for 30s, 59°C for 1 min, and 72°C for 30s, and one cycle at 72°C for 3 min. Samples were resolved on 8% and/or 10% non-denaturing polyacrylamide gels, and exposed to Kodak XAR film with intensifying screens at -70°C for 2 h. Sequencing of the PCR fragments of the EPM2 gene was performed automatically in an ABI-377 sequencer using a dye terminator cycle sequencing kit (Perkin-Elmer). Primers used for amplification of exons 2, 3 and 4 of the EPM2 gene for SSCP and sequence mutation analysis are shown in Table 22.

ACKNOWLEDGEMENTS

The authors wish to thank all the patients and family members who participated in this study. We also thank Drs J. Jimenez, M.A. Peñalva, A. Silva and D. Heine for encouragement and critical reading of the manuscript, and Dr M. Robledo, Dr J. Benítez, Dr A. Díaz, Ms G. Porras, Ms S. Carnejo and Mr R. Iranmanesh for their help and contribution to this work. This work was supported by the Asociación Lafora España, the Fundación Jose Antonio de Castro, the Spanish Comisión Interministerial de Ciencia y Tecnología (SAF96/0318, SAF96/0055), the Fondo de Investigaciones Sanitarias (FIS98/0687), the Junta de Comunidades de Castilla-La Mancha and the Comunidad Autónoma de Madrid (08.6/0015/1997). P.G-G was supported by a fellowship from the Association France Lafora. In addition, this study is based upon work supported by the Fundación Conchita Rabago de Jímenez Díaz under fellowships awarded to B.A. and D.B.-V.d.B.

REFERENCES

1. Hauser, W.A. and Kurland, L.T. (1975) The epidemiology of epilepsy in Rochester, Minnesota, 1935 through 1967. Epilepsia, 16, 1-66. MEDLINE Abstract

2. Juul-Jensen, P. and Foldspang, A. (1983) Natural history of epileptic seizures. Epilepsia, 24, 297-312. MEDLINE Abstract

3. Berkovic, S.F., Andermann, F., Carpenter, S. and Wolfe, L.S. (1986) Progressive myoclonus epilepsies: specific causes and diagnosis. N. Engl. J. Med., 315, 296-305. MEDLINE Abstract

4. Lafora, G.R. (1911) Über das Vorkommen amyloider Körperchen im Innern der Ganglienzellen; zugleich Ein zum Studium der amyloiden Substanz im Nervensystem. Virchows Arch. (Pathol. Anat.), 205, 295-303.

5. Lafora, G.R. and Glueck, B. (1911) Beitrag zur Histopathologie der myoklonischen Epilepsie. Z. Gesamte Neurol. Psychiatr., 6, 1-14.

6. Harriman, D.G.F. and Millar, J.H.D. (1955) Progressive familial myoclonic epilepsy in three families: its clinical features and pathological basis. Brain, 78, 325-349.

7. Lafora, G.R. (1955) Myoclonus. Physiological and pathological considerations. In Proceedings of the Second International Congress of Neuropathology. Part I. Excerpta Medica Foundation, Amsterdam, pp. 9-21.

8. Serratosa, J.M., Delgado-Escueta, A.V., Posada, I., Shih, S., Drury, I., Berciano, J., Zabala, J.A., Antúnez, M.C. and Sparkes, R.S. (1995) The gene for progressive myoclonus epilepsy of the Lafora type maps to chromosome 6q. Hum. Mol. Genet., 4, 1657-1663. MEDLINE Abstract

9. Sainz, J., Minassian, B.A., Serratosa, J.M. Gee, M.N., Sakamoto, L.M., Iranmanesh, R., Bohlega, S., Baumann, R.J., Ryan, S., Sparkes, R.S. and Delgado-Escueta, A.V. (1997) Lafora progressive myoclonus epilepsy: narrowing the chromosome 6q24 locus by recombinations and homozygosities. Am. J. Hum. Genet., 61, 1205-1209. MEDLINE Abstract

10. Gómez-Garre, P., Anta, B., Castro-Gago, M., Lindhout, D., Tassinari C.A., Michelucci, R., Malafosse A., Topcu, M., Grid, D., Dravet, C. and Serratosa, J. (1998) Reduction of the Lafora disease candidate gene region to a 2 cM interval in chromosome 6q24 and evidence for genetic heterogeneity. Eur. J. Hum. Genet., 6, 152 (abstract).

11. Roberts, R.G., Coffey, A.J. Bobrow, M. and Bentley, D.R. (1992) Determination of the exon structure of the distal portion of the dystrophin gene by vectorette PCR. Genomics, 13, 942-950. MEDLINE Abstract

12. Arnold, C. and Hodgson, I. (1991) A novel approach to genomic walking. PCR Methods Appl., 1, 39-42. MEDLINE Abstract

13. Barford, D., Flint, A.J. and Tonks, N.K. (1994) Crystal structure of human protein tyrosine phosphatase 1B. Science, 263, 1397-1404. MEDLINE Abstract

14. Yokoi, S., Austin, J., Witmer, F. and Sakai, M. (1968) Studies in myoclonus epilepsy (Lafora body form). I. Isolation and preliminary characterization of Lafora bodies in two cases. Arch. Neurol., 19, 15-33. MEDLINE Abstract

15. Sakai, M., Austin, J., Witmer, F. and Trueb, L. (1970) Studies in myoclonus epilepsy (Lafora body form). II. Polyglucosans in the systemic deposits of myoclonus epilepsy and in corpora amylacea. Neurology, 20, 160-176. MEDLINE Abstract

16. Hers, H.-G., Hoof, F.V. and de Barsy, T. (1993) Glycogen storage disease. In Scriver, C.R., Beaudet, A.L., Sly, W. and Valle D. (eds), The Metabolic and Molecular Bases of Inherited Disease. MacGraw-Hill, New York, pp. 425-452.

17. Gambetti, P., Di Mauro, S., Hirt, L. and Blume, R.P. (1971) Myoclonic epilepsy with Lafora bodies. Arch. Neurol., 25, 483-493. MEDLINE Abstract

18. Tassinari, C.A., Bureau-Paillas, M., Dalla Bernardina, B., Picornell-Darder, I., Mouren, M.C., Dravet, C. and Roger, J. (1978) La maladie de Lafora. Rev. EEG Neurophysiol., 8, 107-122.

19. Van Heycop Ten Ham, M.V. (1974) Lafora disease, a form of progressive myoclonus epilepsy. In Vinken, P.J. and Bruin, G.W. (eds), Handbook of Clinical Neurology. North Holland, Amsterdam, Vol. 15, pp. 382-422.

20. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol chloroform extraction. Anal. Biochem., 162, 156-162. MEDLINE Abstract

21. Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K. and Sekiya, T. (1989) Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphism. Proc. Natl Acad. Sci. USA, 86, 2766-2770. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +34 91 550 4854; Fax: +34 91 549 7381; Email: serratosa@jet.es


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 4 Feb 1999
Copyright©Oxford University Press, 1999.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Plant CellHome page
O. Kotting, D. Santelia, C. Edner, S. Eicke, T. Marthaler, M. S. Gentry, S. Comparot-Moss, J. Chen, A. M. Smith, M. Steup, et al.
STARCH-EXCESS4 Is a Laforin-Like Phosphoglucan Phosphatase Required for Starch Degradation in Arabidopsis thaliana
PLANT CELL, January 1, 2009; 21(1): 334 - 346.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. C. Solaz-Fuster, J. V. Gimeno-Alcaniz, S. Ros, M. E. Fernandez-Sanchez, B. Garcia-Fojeda, O. C. Garcia, D. Vilchez, J. Dominguez, M. Garcia-Rocha, M. Sanchez-Piris, et al.
Regulation of glycogen synthesis by the laforin-malin complex is modulated by the AMP-activated protein kinase pathway
Hum. Mol. Genet., March 1, 2008; 17(5): 667 - 678.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. A. Worby, M. S. Gentry, and J. E. Dixon
Malin Decreases Glycogen Accumulation by Promoting the Degradation of Protein Targeting to Glycogen (PTG)
J. Biol. Chem., February 15, 2008; 283(7): 4069 - 4076.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. Cheng, M. Zhang, M. S. Gentry, C. A. Worby, J. E. Dixon, and A. R. Saltiel
A role for AGL ubiquitination in the glycogen storage disorders of Lafora and Cori's disease
Genes & Dev., October 1, 2007; 21(19): 2399 - 2409.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. S. Gentry, R. H. Dowen III, C. A. Worby, S. Mattoo, J. R. Ecker, and J. E. Dixon
The phosphatase laforin crosses evolutionary boundaries and links carbohydrate metabolism to neuronal disease
J. Cell Biol., July 24, 2007; 178(3): 477 - 488.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
P. Gomez-Garre, E. Gutierrez-Delicado, C. Gomez-Abad, J. Morales-Corraliza, V. E. Villanueva, S. Rodriguez de Cordoba, J. Larrauri, M. Gutierrez, J. Berciano, and J. M. Serratosa
Hepatic disease as the first manifestation of progressive myoclonus epilepsy of Lafora
Neurology, April 24, 2007; 68(17): 1369 - 1373.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Mittal, D. Dubey, K. Yamakawa, and S. Ganesh
Lafora disease proteins malin and laforin are recruited to aggresomes in response to proteasomal impairment
Hum. Mol. Genet., April 1, 2007; 16(7): 753 - 762.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. A. Worby, M. S. Gentry, and J. E. Dixon
Laforin, a Dual Specificity Phosphatase That Dephosphorylates Complex Carbohydrates
J. Biol. Chem., October 13, 2006; 281(41): 30412 - 30418.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S Singh, I Sethi, S Francheschetti, C Riggio, G Avanzini, K Yamakawa, A V Delgado-Escueta, and S Ganesh
Novel NHLRC1 mutations and genotype-phenotype correlations in patients with Lafora's progressive myoclonic epilepsy.
J. Med. Genet., September 1, 2006; 43(9): e48 - e48.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. S. Gentry, C. A. Worby, and J. E. Dixon
From The Cover: Insights into Lafora disease: Malin is an E3 ubiquitin ligase that ubiquitinates and promotes the degradation of laforin
PNAS, June 14, 2005; 102(24): 8501 - 8506.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
C. Gomez-Abad, P. Gomez-Garre, E. Gutierrez-Delicado, S. Saygi, R. Michelucci, C. A. Tassinari, S. Rodriguez de Cordoba, and J. M. Serratosa
Lafora disease due to EPM2B mutations: A clinical and genetic study
Neurology, March 22, 2005; 64(6): 982 - 986.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. E. Fernandez-Sanchez, O. Criado-Garcia, K. E. Heath, B. Garcia-Fojeda, I. Medrano-Fernandez, P. Gomez-Garre, P. Sanz, J. M. Serratosa, and S. Rodriguez de Cordoba
Laforin, the dual-phosphatase responsible for Lafora disease, interacts with R5 (PTG), a regulatory subunit of protein phosphatase-1 that enhances glycogen accumulation
Hum. Mol. Genet., December 1, 2003; 12(23): 3161 - 3171.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Ganesh, N. Tsurutani, T. Suzuki, K. Ueda, K. L. Agarwala, H. Osada, A. V. Delgado-Escueta, and K. Yamakawa
The Lafora disease gene product laforin interacts with HIRIP5, a phylogenetically conserved protein containing a NifU-like domain
Hum. Mol. Genet., September 15, 2003; 12(18): 2359 - 2368.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Ganesh, A. V. Delgado-Escueta, T. Sakamoto, M. R. Avila, J. Machado-Salas, Y. Hoshii, T. Akagi, H. Gomi, T. Suzuki, K. Amano, et al.
Targeted disruption of the Epm2a gene causes formation of Lafora inclusion bodies, neurodegeneration, ataxia, myoclonus epilepsy and impaired behavioral response in mice
Hum. Mol. Genet., May 16, 2002; 11(11): 1251 - 1262.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Ganesh, A. V. Delgado-Escueta, T. Suzuki, S. Francheschetti, C. Riggio, G. Avanzini, A. Rabinowicz, S. Bohlega, J. Bailey, M. E. Alonso, et al.
Genotype-phenotype correlations for EPM2A mutations in Lafora's progressive myoclonus epilepsy: exon 1 mutations associate with an early-onset cognitive deficit subphenotype
Hum. Mol. Genet., May 16, 2002; 11(11): 1263 - 1271.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
P. Labauge, L. O. Amer, M. Simonetta-Moreau, F. Attane, C. Tannier, M. Clanet, G. Castelnovo, I. An-Gourfinkel, Y. Agid, A. Brice, et al.
Absence of linkage to 8q24 in a European family with familial adult myoclonic epilepsy (FAME)
Neurology, March 26, 2002; 58(6): 941 - 944.
[Abstract] [Full Text] [PDF]


Home page
J Child NeurolHome page
L. J. Willmore and Y. Ueda
Genetics of Epilepsy
J Child Neurol, January 1, 2002; 17(1_suppl): S18 - S27.
[Abstract] [PDF]


Home page
NeurologyHome page
N. Raben, M. Danon, N. Lu, E. Lee, L. Shliselfeld, A. V. Skurat, P. J. Roach, J.C. Lawrence Jr., O. Musumeci, S. Shanske, et al.
Surprises of genetic engineering: A possible model of polyglucosan body disease
Neurology, June 26, 2001; 56(12): 1739 - 1745.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
B. A. Minassian, L. Ianzano, A. V. Delgado-Escueta, and S. W. Scherer
Identification of new and common mutations in the EPM2A gene in Lafora disease
Neurology, January 25, 2000; 54(2): 488 - 488.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
N. M. Plaster, E. Uyama, M. Uchino, T. Ikeda, K. M. Flanigan, I. Kondo, and L. J. Ptacek
Genetic localization of the familial adult myoclonic epilepsy (FAME) gene to chromosome 8q24
Neurology, October 1, 1999; 53(6): 1180 - 1180.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wang, J. A. Stuckey, M. J. Wishart, and J. E. Dixon
A Unique Carbohydrate Binding Domain Targets the Lafora Disease Phosphatase to Glycogen
J. Biol. Chem., January 18, 2002; 277(4): 2377 - 2380.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Lerche, C. R. Scherer, G. Seebohm, C. Derst, A. D. Wei, A. E. Busch, and K. Steinmeyer
Molecular Cloning and Functional Expression of KCNQ5, a Potassium Channel Subunit That May Contribute to Neuronal M-current Diversity
J. Biol. Chem., July 14, 2000; 275(29): 22395 - 22400.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (67)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Serratosa, J. M.
Right arrow Articles by de Cordoba, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Serratosa, J. M.
Right arrow Articles by de Cordoba, S. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?