Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (61)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tang, N. L.
Right arrow Articles by Hjelm, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tang, N. L.
Right arrow Articles by Hjelm, N. M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 655-660  

Mutations of OCTN2, an organic cation/carnitine transporter, lead to deficient cellular carnitine uptake in primary carnitine deficiency
Introduction
Results And Discussion
   Clinical data
   Mutation analysis
   Sequence comparisons among organic cation transporters
   In vitro expression studies of the effects of the mutations on transport activity
Materials And Methods
   DNA preparation and mutation detection
   Generation of mutants and analysis of transport activity
Acknowledgement
References

Mutations of OCTN2, an organic cation/carnitine transporter, lead to deficient cellular carnitine uptake in primary carnitine deficiency

Mutations of OCTN2, an organic cation/carnitine transporter, lead to deficient cellular carnitine uptake in primary carnitine deficiency

Nelson L. S. Tang+,*, V. Ganapathy2,+, Xiang Wu2, Joannie Hui1, Pankaj Seth2, Patrick M. P. Yuen1, T. F. Fok1 and N. M. Hjelm

See Corrigenda

Department of Chemical Pathology and 1Department of Paediatrics, Prince of Wales Hospital, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong, People’s Republic of China and 2Department of Biochemistry and Molecular Biology, Medical College of Georgia, Augusta, GA 30912-2100, USA

Received November 18, 1998; Revised and Accepted January 15, 1999

Systemic primary carnitine deficiency (CDSP, OMIM 212140) is an autosomal recessive disease characterized by low serum and intracellular concentrations of carnitine. CDSP may present with acute metabolic derangement simulating Reye’s syndrome within the first 2 years of life. After 3 years of age, patients with CDSP may present with cardiomyopathy and muscle weakness. A linkage with D5S436 in 5q was reported in a family. A recently cloned homologue of the organic cation transporter, OCTN2, which has sodium-dependent carnitine uptake properties, was also mapped to the same locus. We screened for mutation in OCTN2 in a confirmed CDSP family. One truncating mutation (Trp132Stop) and one missense mutation (Pro478Leu) of OCTN2 were identified together with two silent polymorphisms. Expression of the mutant cDNAs revealed virtually no uptake activity for both mutations. Our data indicate that mutations in OCTN2 are responsible for CDSP. Identification of the underlying gene in this disease will allow rapid detection of carriers and postnatal diagnosis of affected patients.

INTRODUCTION

CDSP is due to a defective plasmalemmal uptake of carnitine, which results in renal wastage (1) and a very low intracellular level of carnitine (2). Patients may present with acute illness simulating Reye’s syndrome in young babies or with cardiomyopathy in late infancy (3). Investigations of fibroblasts from these patients identified a defect in the sodium-dependent high-affinity transporter situated in the plasmalemmal membrane (4,5). This transporter mediates uptake of carnitine against a concentration gradient with an apparent Michaelis-Menten constant of 5-15 µmol/l (6,7). Hereditary severe carnitine deficiency in a mouse model has recently been described, where the defect could be mapped to chromosome 11 (8,9). Potential loci in human at 5q and 17q were inferred by comparative mapping. Shoji et al. revealed linkage to a region flanking D5S658 and D5S434 of 5q31-32 in a family (10). The authors and others have recently cloned an organic cation transporter gene, OCTN2, the product of which mediates the uptake of organic cations and carnitine. This gene was also mapped to the same region of chromosome 5 (11,12). We hypothesized that the OCTN2 locus is linked to primary carnitine deficiency and have carried out mutation analysis in a family with confirmed cases of primary carnitine deficiency. Genomic DNA from family members and the proband was studied and the effect of mutations on carnitine uptake was examined in a transient expression system, using a human retinal pigment epithelial cell line, HRPE.

RESULTS AND DISCUSSION

Clinical data

The clinical history of the family was reported previously (13). In brief, the proband (III:2) was the second child in a Chinese family (Fig. 1). He was admitted with acute metabolic derangement at the age of 6 months, went into cardiac arrest and succumbed shortly after admission. Peri-mortem serum free carnitine was 9 µmol/l (reference range 22-50 µmol/l) with a normal free carnitine to acylcarnitine ratio. The diagnosis was established by measurement of carnitine uptake into fibroblasts, which was only 5% of normal. His elder sister also died after a similar presentation, but tissue was not available for investigation. Carnitine loading was performed in the parents to determine the maximal renal re-absorption capacity (Tm) for free carnitine. The father (II:4) and mother (II:6) of the proband had reduced Tms of 24.5 and 29.7 µmol/l glomerular filtrate (GF), respectively. They were clearly below that of the control (47 µmol/l GF) and the control range reported in literature (55 ± 6.5 µmol/l) (14), indicating that both were heterozygotes for a defective carnitine transporter.


Figure 1. Pedigree, fasting serum free carnitine concentration and genotypes of the family. Filled symbol denotes the proband (III:2). Symbols marked with a dot represent those individuals carrying a loss-of-function OCTN2 mutation. Fasting serum free carnitine was expressed in µmol/l. Genotyping for the exon 2 Trp132Stop mutation was shown for paternal family members. The mutation removes a restriction site for NlaIV and results in a 102 bp fragment instead of a 74 bp fragment in the wild-type (4% agarose gel electrophoresis). Other restriction sites in the exon 2 PCR product produced additional digestion fragments of 60, 43 and 41 bp which were present in both mutant and wild-type. Exon 8 genotype was determined by a mismatch PCR among maternal relatives. Wild-type allele gives a 76 bp fragment after digestion by NlaIV. The Pro478Leu mutation abolishes the restriction site and the PCR product remains undigested at 93 bp (8% polyacrylamide gel electrophoresis).


Figure 2. Mutations in OCTN2 in the proband, III:2. (a) Sequence analysis of OCTN2 exon 2 shows a heterozygous G->A mutation at cDNA nucleotide position 617 (arrow). The sequence 5[prime] to base number 50 in the figure represents the sequence of intron 1. (b) Direct sequencing of exon 8 shows a C->T mutation at cDNA nucleotide position 1654 (arrow). Both exons were sequenced by the respective forward primers.

Mutation analysis

Four sequence variants were identified by single strand conformational polymorphism (SSCP) and determined by sequencing of both sense and antisense strands of the PCR products. The patient inherited a truncating mutation in exon 2 from his father. There was a G->A transition at cDNA nucleotide position 617 in codon 132 of exon 2 which codes for a stop signal instead of Trp (Fig. 2a). (The nucleotide positions of OCTN2 are according to GenBank accession no. AF057164.) Three sequence variants were found on the maternal chromosome, which included a missense mutation and two silent mutations. In exon 8, transition at cDNA nucleotide position 1654 from C to T predicts a Pro478Leu substitution (Fig. 2b). The two silent polymorphisms involved a C->T transition in cDNA nucleotide position 506 of exon 1 and a G->A substitution at position 1028 of exon 4. The truncating and the missense mutations were screened among 80 cord blood samples from a series of consecutive deliveries. The Trp132Stop mutation was screened by restriction analysis as it removed a restriction site for NlaIV. A mismatch PCR was used to identify Pro478Leu and the results were subsequently confirmed by direct sequencing. Neither Trp132Stop nor Pro478Leu were found in 160 chromosomes from this population sample (data not shown), confirming that they were uncommon alleles in the population.

Genotype was determined among relatives of the family (Fig. 1). Two siblings of the father (II:4) of the proband carried Trp132Stop. This mutation was presumably inherited from the grandfather (I:1). In addition, two siblings of the mother (II:6) carried Pro478Leu, which was inherited from the maternal grandfather (I:3). The serum carnitine level was significantly lower in the seven OCTN2 mutation carriers (23.2 ± 3.7 µmol/l, mean ± SD) than those of five relatives with the wild-type allele (36 ± 9.8 µmol/l, P < 0.05 by Mann-Whitney test). However, there were overlapping serum free carnitine levels in one carrier and one subject with the wild-type alleles, which were 29.4 and 26.6 µmol/l, respectively.

Sequence comparisons among organic cation transporters

OCTN2 belongs to the family of organic cation and anion transporters (15). The organic cation transporter members of this family include OCT1, OCT2, OCT3, OCTN1 and OCTN2 (11,16-19). A comparison of amino acid sequence among the family members indicates that OCTN1 and OCTN2 constitute a subfamily because they are related to each other much more closely than to the remaining members (Fig. 3). All of these transporters mediate the uptake of a variety of organic cations in a sodium-independent manner. Only OCTN2 has an additional property of sodium-dependent carnitine transport. Thus, OCTN2 mediates the uptake of organic cations in a sodium-independent manner and the uptake of carnitine in a sodium-dependent manner (11,12). Interestingly, a recently identified gene product in rat, rUST2r (20), shows an extremely high degree of homology at the level of amino acid sequence with OCTN2, which may be the rat homologue of a carnitine transporter.

   a
   b

Figure 3. (a) A model for membrane topology of OCTN2 and the position of the two loss-of-function mutations. The amino acid residues that are mutated are shown as closed circles. The potential glycosylation sites are marked (fork). (b) Multiple sequence alignment of OCTN2 with transmembrane domains from rat UST2r, human OCTN1, human OCT1, human OCT2, rat OCT1A, rat OCT2, rat OCT3, mouse OCT2, rabbit OCT1, pig OCT2 and fruit fly ORCT. Pro478 is shown in bold. Highly conserved residues are underlined. Positions of putative transmembrane domains are indicated at the top.

The locations of the two mutations in OCTN2 found in the family are indicated in Figure 3. Trp132, which is mutated to a termination codon, is present in the first extracellular loop of OCTN2 protein between transmembrane domains 1 and 2. This mutation will result in a premature termination of translation. Pro478, which is mutated to Leu, is present in transmembrane domain 11 near the extracellular surface. This residue is highly conserved among different members of the organic cation transporter family (Fig. 3). Substitution of proline with any [alpha] amino acid is expected to result in a significant change in the conformation of the protein. The presence of proline on the extracellular side of transmembrane domain 11 of the predicted topology of the protein may contribute to a particular conformation of the protein that is necessary for the formation of a proper substrate-binding site. This arrangement is expected to be disturbed when this amino acid residue is replaced by an [alpha] amino acid.

In vitro expression studies of the effects of the mutations on transport activity

The effects of the two mutations, Trp132Stop and Pro478Leu, on the transport function of OCTN2 were evaluated. The mutants were generated by site-directed mutagenesis and the transport function of the mutants and the wild-type OCTN2 was measured by expression in mammalian cells. A transient expression system using the vaccinia virus expression technique was employed for this purpose. Cells transfected with the vector (pSPORT) alone were used to measure endogenous carnitine transport activity. Transfection of the cells (HRPE) with wild-type OCTN2 cDNA increased sodium-dependent carnitine transport ~20-fold (incubated with a carnitine concentration of 25 nM) compared with transfection with the vector alone. In contrast, transfection with the Trp132Stop and Pro478Leu mutant cDNAs failed to increase carnitine transport significantly above the endogenous level (Fig. 4). Similar results were obtained at higher concentrations of carnitine, 5 and 25 µM. At all three concentrations of carnitine, the two mutants possessed <1% of transport activity compared with the wild-type. These results confirmed that both Trp132Stop and Pro478Leu were loss-of-function mutations in OCTN2.


Figure 4. Carnitine uptake function of the wild-type, Trp132Stop and Pro478Leu mutants. The cDNAs were expressed in HRPE cells and transport activity was measured at three different concentrations of carnitine (25 nM and 5 and 25 µM). Cells transfected with pSPORT vector alone were used to measure endogenous transport activity. This values was subtracted from the values obtained in cells transfected with cDNAs to calculate the specific transport activity induced by wild-type and mutant cDNAs. Average uptake activities of four experiments are shown.

In conclusion, we have demonstrated that two deleterious mutations in OCTN2, which is an organic cation transporter protein possessing sodium-dependent carnitine transport activity, underlie the early presentation form of CDSP. It is likely that the late presenting phenotype is also related to OCTN2, as both early onset and late onset diseases have been reported in two affected siblings from a single family (21). A truncating mutation and a missense mutation of a highly conserved residue in a transmembrane domain were described (Table 1).

Table 1. Summary of mutations and polymorphisms in OCTN2
Mutation Exon Found in Effect Carnitine transport activity
506 C/T 1 Mother, proband Silent -
Trp132Stop 2 Father, proband Truncating No activity
1028 G/A 4 Mother, proband Silent -
Pro478Leu 8 Mother, proband Missense No activity

Identification of the responsible gene, OCTN2, in CDSP will allow the disease to be diagnosed at the molecular level. As serum carnitine levels may overlap between carriers and non-carriers, as was shown in this family, reliable determination of carrier status can now be done by mutation analysis. More importantly, reliable prenatal diagnosis or early postnatal diagnosis of neonates suffering from CDSP would allow early institution of carnitine treatment, which would prevent both life-threatening Reye’s-like illness and cardiomyopathy. However, further studies are required to determine and compare the spectra of mutations responsible for the two different presentations of CDSP.

MATERIALS AND METHODS

DNA preparation and mutation detection

Genomic DNA from whole blood or fibroblast cultures was extracted with Qiagen DNA extraction kits. Amplification of the 10 exons of the OCTN2 gene was carried out by intron-based primers in genomic DNA from the patient and family members (Table 2). Exon 1 was amplified into two overlapping products of <400 bp to facilitate SSCP. An aliquot of 300 ng of genomic DNA was used in each PCR reaction, which contained 0.1 µg of each primer, 1 U Taq polymerase and 200 µM dNTP in 25 µl 1× PCR buffer (Life Technologies, Gaithersburg, MD). It was carried out with a programme of 95°C for 5 min followed by 35 cycles at 95°C for 45 s, 60°C for 30 s and 72°C for 30 s in a TC1 thermal cycler (Perkin Elmer, Foster City, CA).

Sequence variants were screened by SSCP on an MDE gel (FMC BioProducts, Rockland, ME) with or without 10% glycerol at room temperature. Samples showing mobility shift were sequenced with the PCR product as template on both strands with the primers shown in Table 2 on an ABI 377 automated fluorescence sequencer. Restriction digestion was carried out according to the manufacturer’s instructions (MBI, Lithuania).

A mismatach PCR was performed for detection of Pro 478Leu in exon 8 with a mismatch primer 5[prime]-CTGGGCAGCATCCTGGCTC-3[prime] and primer 8R (Table 2). The mismatch primer is located immediately upstream of position nt 1654. The wild-type allele is digested by NlaIV to give a 76 bp fragment. C->T mutation at position 1654 (Pro478Leu) abolishes the restriction site and the PCR product remains undigested at 93 bp. The products were seperated by 8% polyacrylamide gel electrophoresis.

Generation of mutants and analysis of transport activity

The QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) was used to generate the mutants according to the manufacturer’s protocol. The procedure uses Pfu DNA polymerase which replicates both strands with high fidelity and without displacing the mutant primers. Two synthetic oligonucleotide primers (sense and antisense) specific for the human OCTN2 cDNA and containing the desired mutation in the middle were used. Following PCR, the product was digested with DpnI to digest the parental DNA template, leaving behind the nicked dsDNA containing the mutation introduced in the primers (22). The resultant product was then transformed into Escherichia coli for repair of the nicks and amplification. The entire coding region of the mutant cDNAs was sequenced to confirm the presence of the introduced mutation and the absence of any unwanted mutations arising from PCR. The sense and antisense primers for generation of the Trp132Stop mutant were 5[prime]-ccattgtgaccgagTGAaacctggtgtgtgaggac-3[prime] and 5[prime]-cgtcctcacacaccaggttTCActcggtcacaatg-3[prime] (mutated codon in upper case letters). The sense and the antisense primers for generation of the Pro478Leu mutant were 5[prime]-gcatcctgtctCTCtacttcgtttaccttg-3[prime] and 5[prime]-caaggtaaacgaagtaGAGagacaggatgc-3[prime] (mutated codon in upper case letters).

Table 2. Primer sequences
Exon Primer Primers sequence (5[prime]->3[prime]) Product size (bp)
1 SCD1AF GCGCTCTGTGGGCCTCT 349
SCD1AR AGCTGCCCCAGGTCCAC  
SCD1BF GGCGCAACCACACTGTCC 250
SCD1BR TCCGAGCCCTGGTCTCAG  
2 SCD2F TTCCAGGATGCCTTTGCTTT 246
SCD2R ATCAAGGGCCAGGCACAC  
3 SCD3F GCTGCCCTTTTCCAGCTG 262
SCD3R GGTGATGGGATGATGGTGAA  
4 SCD4F CCAAATTAAACTGCTAACTCGACC 256
SCD4R ATCATCCTGCCAGTGGGC  
5 SCD5F GGCCTCACTGAGATTGGACC 219
SCD5R GCTGCTGCTCTCAAATCACG  
6 SCD6F CTGACCACCTCTTCTTCCCA 216
SCD6R TAAACAAGAGGCCCAATGGC  
7 SCD7F TTGGGAAAGATGTGGATACTGC 308
SCD7R TCAGTGAAGACCCCAAACCA  
8 SCD8F GCATGCCATGGGTTGGTAC 290
SCD8R GCCAGTTAGTACTTCCATCCCG  
9 SCD9F CTAACTGCAGCCCTGGGC 238
SCD9R TGAGACCTGGCCAGACCC  
10 SCD10F TGGAGACTGGGAGGCATCTT 222
SCD10R GGAGTCTGCACAAGCTGGC  
Nucleotide positions are according to OCTN2 cDNA (GenBank accession no. AF057164). Exon 1 is amplified into two overlapping products. The other exons are amplified as a single product by intron sequence primers.

Functional expression of the wild-type and mutant OCTN2 cDNAs was done in a HRPE cell line using the vaccinia virus expression technique (23,24). HRPE cells have very low levels of endogenous carnitine transport activity. Uptake of [3H]carnitine in transfected cells was studied at three different carnitine concentrations (25 nM and 5 and 25 µM). The uptake medium (pH 7.5) contained 20 mM HEPES-Tris, 140 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 0.8 mM MgSO4 and 5 mM glucose. After incubation of the cells with [3H]carnitine for 30 min, the medium was removed and cell monolayers were quickly washed three times with the uptake medium. The radioactivity associated with the cells was then measured following digestion of the cells with 0.2 M NaOH, 1% SDS.

ACKNOWLEDGEMENT

The authors would like to thank the family members who partcipated in this study.

REFERENCES

1. Engel, A.G., Rebouche, C.J., Wilson, D.M., Glasgow, A.M., Romshe, C.A. and Cruse, R.P. (1981) Primary systemic carnitine deficiency. II. Renal handling of carnitine. Neurology, 31, 819-825. MEDLINE Abstract

2. Karpati, G., Carpenter, S., Engel, A.G., Watters, G., Allen, J., Rothman, S., Klassen, G. and Mamer, O.A. (1975) The syndrome of systemic carnitine deficiency. Clinical, morphologic, biochemical and pathophysiologic features. Neurology, 25, 16-24. MEDLINE Abstract

3. Stanley, C.A., DeLeeuw, S., Coates, P.M., Vianey-Liaud, C., Divry, P., Bonnefont, J.P., Saudubray, J.M., Haymond, M., Trefz, F.K., Breningstall, G.N., Wappner, R.S., Byrd, D.J., Sansaricq, C., Tein, I., Grover, W., Valle, D., Rutledge, S.L. and Treem, W.R. (1991) Chronic cardiomyopathy and weakness or acute coma in children with a defect in carnitine uptake. Ann. Neurol., 30, 709-716. MEDLINE Abstract

4. Treem, W.R., Stanley, C.A., Finegold, D.N., Hale, D.E. and Coates, P.M. (1988) Primary carnitine deficiency due to a failure of carnitine transport in kidney, muscle and fibroblasts. New Engl. J. Med., 319, 1331-1336. MEDLINE Abstract

5. Tein, I., Bukovac, S.W. and Xie, Z.W. (1996) Characterization of the human plasmalemmal carnitine transporter in cultured skin fibroblasts. Arch. Biochem. Biophys., 329, 145-155. MEDLINE Abstract

6. Prasad, P.D., Huang, W., Ramamoorthy, S., Carter, A.L., Leibach, F.H. and Ganapathy, V. (1996) Sodium-dependent carnitine transport in human placental choriocarcinoma cells. Biochim. Biophys. Acta, 1284, 109-117. MEDLINE Abstract

7. Roque, A.S., Prasad, P.D., Bhatia, J.S., Leibach, F.H. and Ganapathy, V. (1996) Sodium-dependent high-affinity binding of carnitine to human placental brush border membranes. Biochim. Biophys. Acta, 1282, 274-282. MEDLINE Abstract

8. Horiuchi, M., Kobayashi, K., Yamaguchi, S., Shimizu, N., Koizumi, T., Nikaido, H., Hayakawa, J., Kuwajima, M. and Saheki, T. (1994) Primary defect of juvenile visceral steatosis (jvs) mouse with systemic carnitine deficiency is probably in renal carnitine transport system. Biochim. Biophys. Acta, 1226, 25-30. MEDLINE Abstract

9. Nikaido, H., Horiuchi, M., Hashimoto, N., Saheki, T. and Hayakawa, J. (1995) Mapping of jvs (juvenile visceral steatosis) gene, which causes systemic carnitine deficiency in mice, on chromosome 11. Mamm. Genome, 6, 369-370. MEDLINE Abstract

10. Shoji, Y., Koizumi, A., Kayo, T., Ohata, T., Takahashi, T., Harada, K. and Takada, G. (1998) Evidence for linkage of human primary systemic carnitine deficiency with D5S436: a novel gene locus on chromosome 5q. Am. J. Hum. Genet., 63, 101-108. MEDLINE Abstract

11. Wu, X., Prasad, P.D., Leibach, F.H. and Ganapathy, V. (1998) cDNA sequence, transport function and genomic organization of human OCTN2, a new member of the organic cation transporter family. Biochem. Biophys. Res. Commun., 246, 589-595. MEDLINE Abstract

12. Tamai, I., Ohashi, R., Nezu, J., Yabuuchi, H., Oku, A., Shimane, M., Sai, Y. and Tsuji, A. (1998) Molecular and functional identification of sodium ion-dependent, high affinity human carnitine transporter OCTN2. J. Biol. Chem., 273, 20378-20382. MEDLINE Abstract

13. Tang, N.L., Hui, J., Law, L.K., To, K.F., Ruiter, J.P., IJlst, L., Wanders, R.J., Ho, C.S., Fok, T.F., Yuen, P.M. and Hjelm, N.M. (1998) Primary plasmalemmal carnitine transporter defect manifested with dicarboxylic aciduria and impaired fatty acid oxidation. J. Inherit. Metab. Dis., 21, 423-425. MEDLINE Abstract

14. Rebouche, C.J., Lombard, K.A. and Chenard, C.A. (1993) Renal adaptation to dietary carnitine in humans. Am. J. Clin. Nutr., 58, 660-665. MEDLINE Abstract

15. Koepsell, H. (1998) Organic cation transporters in intestine, kidney, liver and brain. Annu. Rev. Physiol., 60, 243-266. MEDLINE Abstract

16. Grundemann, D., Gorboulev, V., Gambaryan, S., Veyhl, M. and Koepsell, H. (1994) Drug excretion mediated by a new prototype of polyspecific transporter. Nature, 372, 549-552. MEDLINE Abstract

17. Okuda, M., Saito, H., Urakami, Y., Takano, M. and Inui, K. (1996) cDNA cloning and functional expression of a novel rat kidney organic cation transporter, OCT2. Biochem. Biophys. Res. Commun., 224, 500-507. MEDLINE Abstract

18. Kekuda, R., Prasad, P.D., Wu, X., Wang, H., Fei, Y.J., Leibach, F.H. and Ganapathy, V. (1998) Cloning and functional characterization of a potential-sensitive, polyspecific organic cation transporter (OCT3) most abundantly expressed in placenta. J. Biol. Chem., 273, 15971-15979. MEDLINE Abstract

19. Tamai, I., Yabuuchi, H., Nezu, J., Sai, Y., Oku, A., Shimane, M. and Tsuji, A. (1997) Cloning and characterization of a novel human pH-dependent organic cation transporter, OCTN1. FEBS Lett., 419, 107-111. MEDLINE Abstract

20. Schoemig, E., Spitzenberger, F., Engelhardt, M., Martel, F., Oerding, N. and Gruendemann, D. (1998) Molecular cloning and characterization of two novel transport proteins from rat kidney. FEBS Lett., 425, 79-86. MEDLINE Abstract

21. Garavaglia, B., Uziel, G., Dworzak, F., Carrara, F. and DiDonato, S. (1991) Primary carnitine deficiency: heterozygote and intrafamilial phenotypic variation. Neurology, 41, 1691-1693. MEDLINE Abstract

22. Nelson, M. and McClelland, M. (1992) Use of DNA methyltransferase/endonuclease enzyme combinations for megabase mapping of chromosomes. Methods Enzymol., 216, 279-303. MEDLINE Abstract

23. Blakely, R.D., Clark, J.A., Rudnick, G. and Amara, S.G. (1991) Vaccinia-T7 RNA polymerase expression system: evaluation for the expression cloning of plasma membrane transporters. Anal. Biochem., 194, 302-308. MEDLINE Abstract

24. Kekuda, R., Torres-Zamorano, V., Fei, Y.J., Prasad, P.D., Li, H.W., Mader, L.D., Leibach, F.H. and Ganapathy, V. (1997) Molecular and functional characterization of intestinal Na(+)-dependent neutral amino acid transporter B0. Am. J. Physiol., 272, G1463-G1472. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +852 2632 2964; Fax: +852 2632 2964; Email: nelsontang@cuhk.edu.hk
+These authors contributed equally to this work

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 10 Mar 1999
Copyright©Oxford University Press, 1999.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Physiol. GenomicsHome page
W. Wu, M. E. Baker, S. A. Eraly, K. T. Bush, and S. K. Nigam
Analysis of a large cluster of SLC22 transporter genes, including novel USTs, reveals species-specific amplification of subsets of family members
Physiol Genomics, July 9, 2009; 38(2): 116 - 124.
[Abstract] [Full Text] [PDF]

Home page
 NeoReviewsHome page
K. W. So and P. C. Ng
International Perspectives: Neonatology in Hong Kong: 10 Years After the Return of Sovereignty to China
NeoReviews, December 1, 2007; 8(12): e513 - e521.
[Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
T. J. Urban, R. C. Gallagher, C. Brown, R. A. Castro, L. L. Lagpacan, C. M. Brett, T. R. Taylor, E. J. Carlson, T. E. Ferrin, E. G. Burchard, et al.
Functional Genetic Diversity in the High-Affinity Carnitine Transporter OCTN2 (SLC22A5)
Mol. Pharmacol., November 1, 2006; 70(5): 1602 - 1611.
[Abstract] [Full Text] [PDF]

Home page
 Drug Metab. Dispos.Home page
Y. Alnouti, J. S. Petrick, and C. D. Klaassen
TISSUE DISTRIBUTION AND ONTOGENY OF ORGANIC CATION TRANSPORTERS IN MICE
Drug Metab. Dispos., March 1, 2006; 34(3): 477 - 482.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
S. H. Wright and W. H. Dantzler
Molecular and Cellular Physiology of Renal Organic Cation and Anion Transport
Physiol Rev, July 1, 2004; 84(3): 987 - 1049.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
R. Ohashi, I. Tamai, A. Inano, M. Katsura, Y. Sai, J.-i. Nezu, and A. Tsuji
Studies on Functional Sites of Organic Cation/Carnitine Transporter OCTN2 (SLC22A5) Using a Ser467Cys Mutant Protein
J. Pharmacol. Exp. Ther., September 1, 2002; 302(3): 1286 - 1294.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
C. M. Rodriguez, J. C. Labus, and B. T. Hinton
Organic Cation/Carnitine Transporter, OCTN2, Is Differentially Expressed in the Adult Rat Epididymis
Biol Reprod, July 1, 2002; 67(1): 314 - 319.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Chem.Home page
J. R. Opalka, F.-N. Gellerich, and S. Zierz
Age and Sex Dependency of Carnitine Concentration in Human Serum and Skeletal Muscle
Clin. Chem., December 1, 2001; 47(12): 2150 - 2153.
[Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
D. H. Sweet, K. T. Bush, and S. K. Nigam
The organic anion transporter family: from physiology to ontogeny and the clinic
Am J Physiol Renal Physiol, August 1, 2001; 281(2): F197 - F205.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. E. Ganapathy, W. Huang, D. P. Rajan, A. L. Carter, M. Sugawara, K. Iseki, F. H. Leibach, and V. Ganapathy
beta -Lactam Antibiotics as Substrates for OCTN2, an Organic Cation/Carnitine Transporter
J. Biol. Chem., January 21, 2000; 275(3): 1699 - 1707.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. Seth, X. Wu, W. Huang, F. H. Leibach, and V. Ganapathy
Mutations in Novel Organic Cation Transporter (OCTN2), an Organic Cation/Carnitine Transporter, with Differential Effects on the Organic Cation Transport Function and the Carnitine Transport Function
J. Biol. Chem., November 19, 1999; 274(47): 33388 - 33392.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
X. Wu, W. Huang, P. D. Prasad, P. Seth, D. P. Rajan, F. H. Leibach, J. Chen, S. J. Conway, and V. Ganapathy
Functional Characteristics and Tissue Distribution Pattern of Organic Cation Transporter 2 (OCTN2), an Organic Cation/Carnitine Transporter
J. Pharmacol. Exp. Ther., September 1, 1999; 290(3): 1482 - 1492.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
Y. Wang, T. A. Meadows, and N. Longo
Abnormal Sodium Stimulation of Carnitine Transport in Primary Carnitine Deficiency
J. Biol. Chem., June 30, 2000; 275(27): 20782 - 20786.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
I. Tamai, R. Ohashi, J.-i. Nezu, Y. Sai, D. Kobayashi, A. Oku, M. Shimane, and A. Tsuji
Molecular and Functional Characterization of Organic Cation/Carnitine Transporter Family in Mice
J. Biol. Chem., December 15, 2000; 275(51): 40064 - 40072.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (61)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tang, N. L.
Right arrow Articles by Hjelm, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tang, N. L.
Right arrow Articles by Hjelm, N. M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?